One-step multiplex fluorescent quantitative PCR kit for detecting and differentiating poxviruses

Abstract

The present invention provides a one-step multiplex fluorescence quantitative PCR kit for detecting and distinguishing poxviruses. It comprises a quantitative PCR reaction solution, an enzyme mixture, a primer-probe mixture, a standard, a positive control substance, and a negative control substance. The poxviruses include monkeypox virus, cowpox virus, and varicella virus. The present invention designs highly specific primer probes according to the highly conserved nucleotide sequences of the three poxviruses and the internal standard RNase P, and simultaneously detects and distinguishes the presence of monkeypox virus, cowpox virus, and varicella virus from samples such as blood, follicle fluid, and rash swabs through a PCR reaction, and uses RNase P as the internal standard for evaluating the amplification system, which is simpler, faster, and less costly than the single-plex fluorescence quantitative PCR method, and has better sensitivity, specificity, and repeatability. The viruses to be tested are fully enclosed for detection and single-tube real-time quantification, and the three poxviruses can be efficiently and quickly screened and identified according to the number of copies of the virus infection.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a fluorescence quantitative PCR detection kit, in particular to a multiplex fluorescence quantitative PCR kit for detecting infectious viruses. The invention is a one-step multiplex real-time fluorescence quantitative PCR nucleic acid detection technology for detecting monkeypox virus (MPXV), cowpox virus (CPXV), varicella virus (VARV) and ribonuclease (RNase P) in samples such as blood, follicle fluid and rash swabs in the same reaction tube, and can be applied to epidemiological research on rapid screening and identification of monkeypox virus, cowpox virus and varicella virus. Background Art

[0002] Monkeypox is a zoonotic infectious disease caused by the monkeypox virus, with fever, rash and swollen lymph nodes as the main symptoms, and a mortality rate of 1%-10%. It belongs to the Poxviridae family and belongs to the Orthopoxvirus genus along with the smallpox virus and the cowpox virus. The monkeypox virus is mainly prevalent in central and western Africa. However, recently, the monkeypox virus has been reported in countries outside Africa and has been prevalent in some areas, including the United States, China, the United Kingdom and other countries and regions. On July 23, 2022, the World Health Organization (WHO) announced that the ongoing monkeypox outbreak is a public health emergency of international concern in the context of the 2019 coronavirus disease pandemic. The rapid increase in the number of confirmed cases may pose a threat to the international community. The monkeypox virus is mainly transmitted through close contact between humans and infected animals, and the main mode of transmission of the monkeypox virus is currently "close contact between people", but it is not yet clear whether the virus can be transmitted through aerosols. Monkeypox virus is a double-stranded DNA virus with a total length of about 197kb. According to the molecular characteristics and evolution of monkeypox virus variants, WHO calls the former Congo Basin (Central Africa) branch branch I and the former West African branch branch II, and believes that branch II consists of two sub-branches, IIa and IIb, the latter mainly referring to a group of variants that are mainly spread in the global epidemic in 2022. For the prevention and control of monkeypox virus, WHO and my country have formulated corresponding guidelines to support the improvement of awareness, monitoring, laboratory testing, case investigation and contact tracing, clinical management and infection prevention and control, vaccines and immunization, as well as risk communication and community participation. Timely and accurate laboratory confirmation of monkeypox virus is the key to breaking the chain of transmission and preventing the outbreak. At present, the main application for monkeypox virus detection is real-time / traditional polymerase chain reaction (PCR) technology based on nucleic acid amplification technology (NAAT), and it can also be done through gene sequencing technology. Laboratory confirmation samples are exudates from the surface of the rash, and samples such as blood and secretions are also important supplements. Monkeypox virus has common antigens with smallpox virus and cowpox virus, and has strong serum cross-reaction and cross-immunity with each other. In addition, the early clinical symptoms are similar to those of human infection with varicella virus. It also has similar clinical features with human infection with varicella virus. The identification and diagnosis of monkeypox virus, cowpox virus and varicella virus are particularly important. The current PCR technology for detecting monkeypox virus, cowpox virus and varicella virus mainly uses single-plex real-time fluorescence PCR technology. Therefore, it is crucial to establish a one-step multiplex real-time fluorescence PCR technology to detect and identify monkeypox virus, cowpox virus and varicella virus for the prevention and control of the epidemic.

[0003] At present, the detection and differentiation of monkeypox virus, cowpox virus and varicella virus in one step at home and abroad mainly adopts single nucleic acid detection or gene sequencing technology. Gene sequencing technology requires professional personnel, increases the workload of laboratory personnel, and factors such as expensive detection costs and long operation time seriously affect the widespread application of this technology. Although single real-time fluorescence PCR technology can quickly detect monkeypox virus, cowpox virus and varicella virus, it requires more costs for monkeypox virus, cowpox virus and varicella virus. Multiplex real-time fluorescence quantitative PCR technology has the advantages of fully enclosed detection, single-tube amplification real-time quantification, simplicity and speed, cost saving, good repeatability, and high specificity and sensitivity. It is more optimized than ordinary and single PCR detection, and can be used as a one-step detection and differentiation of monkeypox virus, cowpox virus and varicella virus. Rapid and efficient detection means.

[0004] The purpose of the present invention is to provide a one-step multiplex fluorescence quantitative PCR kit for detecting and distinguishing poxviruses, which is a one-step multiplex fluorescence quantitative PCR kit for detecting monkeypox virus (MPXV), cowpox virus (CPXV), varicella virus (VARV) and internal standard RNase P. This kit comprises a quantitative PCR reaction solution, an enzyme mixture, a primer and probe mixture, a standard (MPXV, CPXV, VARV and RNase P plasmids at appropriate concentrations), a positive control (MPXV, CPXV, VARV and internal standard RNase P plasmids at appropriate concentrations), and a negative control. The box body is provided with container holes, which are respectively placed with a quantitative PCR reaction solution tube, an enzyme mixture tube, a primer and probe mixture tube, a standard tube (MPXV, CPXV, VARV and internal standard RNase P plasmid), a positive control tube (MPXV, CPXV, VARV and internal standard RNase P), and a negative control tube.

[0005] The quantitative PCR reaction solution tube includes a PCR reaction buffer tube (containing magnesium chloride and a mixture of deoxyribonucleotide triphosphates, etc.), an enzyme mixture tube (containing heat-resistant Taq DNA polymerase and heat-resistant RNase H, etc.). The primer and probe mixture tube contains four sets of primers and four corresponding probes with different fluorescent labels, and the primer and probe mixture tube is a brown tube. The negative control is high-temperature and high-pressure sterilized DEPC (diethyl pyrocarbonate) treated water, and the positive control is a positive plasmid sample of MPXV, CPXV, VARV and internal standard RNase P.

[0006] The upstream primers and downstream primers and the corresponding specific probe sequences used for one-step multiplex fluorescence quantitative PCR detection are as follows: Upstream primer MPXV-F: 5'-GTCAGCAGTGGCGATTTTCT-3'

[0007] Downstream primer MPXV-R: 5'-TGAACCAGATGGTCCTCTCAATA-3'

[0008] Specific probe MPXV-P: 5'-FAM-TAATAAACACCCACGTAAATACAAAACAGA-BHQ1-3'

[0009] Upstream primer CPXV-F: 5'-CAGCATTAATTATATTGTCGGC-3'

[0010] Downstream primer CPXV-R: 5-TGAACCAGATGGTCCGCTCAATA-3'

[0011] Specific probe CPXV-P: 5'-ROX-TAATAAACGTTCACGTAAATACAAAACAGA-BHQ2-3'

[0012] Upstream primer VARV-F: 5'-GGTGAGGGAGTTCCAACAGTAC-3'

[0013] Downstream primer VARV-R: 5'-TCTCGTCCAATCACTACATCGT-3'

[0014] Specific probe VARV-P: 5'-CY5-CCGTGTCGTCACCGTGTAAATATTC-BHQ3-3'

[0015] Upstream primer RNase PF: 5'-AGATTTGGACCTGCGAGCG-3'

[0016] Downstream primer RNase PR: 5'-GAGCGGCTGTCTCCACAAGT-3'

[0017] Specific probe RNase PP: 5'-VIC-TTCTGACCTGAAGGCTCTGCGCG-BHQ1-3'

[0018] The specific probes for MPXV, CPXV, VARV and internal standard RNase P were labeled with four different fluorescent markers, FAM, ROX, CY5 and VIC, respectively, and the primers and probes were synthesized by Zhuhai Huirui Biotechnology Co., Ltd.

[0019] The above standards include MPXV, CPXV, VARV and internal standard RNase P standards, and the gene sequences of the conserved regions are as follows:

[0020] The sequence of the monkeypox virus standard is:

[0021] ATATTTGGTATTACCACATTAATTATATTGTCAGCAGTGGCGATTTTCTGTATTACGTATTATATATGTAATAAACACCCACGTAAATACAAACAGAGAACAAAGTCTAGATTTTGACTTACATAAATATCTGGGATAATAAAATCTATCATATTGAGAGGACCATCTGGTTCAGGAAAGACAGCCATAACCAAAAGA.

[0022] The standard sequence of vaccinia virus is:

[0023] AGACTATGTCGAAGTATTTGGTATTGCAGCATTAATTATATTGTCGGCCGTGGCAGTTTTCTGTATCACATATTATATATGTAATAAACGTTCACGTAAATACAAAACAGAAAACAAAGTCTAGATTTTGACTTACATAAATGTCTGGGATAGTAAATCTATCATATTGAGCGGACCATCTGGTTCAGGAAAGACAGCTATAGTCA.

[0024] The standard sequence of varicella virus is:

[0025] TTCAAAGGATTGCGATTGCGGTTGGTGAGGGAGTTCCAACAGTACTTAAAACGTGTTGTGCCCCCCCCTCGACCGCATATTTCCTCCCCGTGTCGTCACCGTGTAAATATTCTTAATGATAAGACGATGTAGTGATTGGACGAGACTCGAGGCGGGAAG.

[0026] The sequence of the internal standard RNase P is:

[0027] ATGGGACTTCAGCATGGCGGTGTTTGCAGATTTGGACCTGCGAGCGGGTTCTGACCTGAAGGCTCTGCGCGGACTTGTGGAGACAGCCGCTCACCTTGGCTATTCAGTTGTTGCTATC.

[0028] The kit provided by the present invention needs to be stored at -20°C, and the number of repeated freezing and thawing should be reduced; the primer and probe mixture should be stored away from light.

[0029] Another object of the present invention is to provide the one-step multiplex fluorescence quantitative PCR detection kit for use in the nucleic acid detection of monkeypox virus, cowpox virus, varicella virus and internal standard RNase P, and in the determination of sample collection status and nucleic acid extraction status.

[0030] Method of using the kit of the present invention: positive control and negative control should be set in each fluorescence quantitative detection. The standard product is diluted to 1×10 2 -1×10 8 copies / mL.

[0031] Extraction of sample nucleic acid: 200uL serum sample was taken for extraction. The nucleic acid was extracted using Total Viral Nucleic Acid extraction Kit II from Geneaid Company. The extraction operation was performed according to the instructions in the kit, and 10uL of the final product sample nucleic acid was taken as the subsequent template.

[0032] Detection of nucleic acid: Take 10uL of the extracted nucleic acid of the sample to be tested as a template. The total reaction volume is 20uL, of which the fluorescent quantitative PCR reaction solution and Taq enzyme mixture are 10μL, the primer and probe mixture (20μmol / L, including four sets of primers and fluorescent probes) is 3μL, the template is 5μL, and the remaining water is added to the final volume of 20μL. Detection is performed on the ABI QuantStudio 5system fluorescent quantitative PCR instrument. The reaction procedure is: pre-denaturation at 95℃, 5min; then denaturation at 95℃ for 10s, annealing and extension at 58℃ for 30s, multiple fluorescence detection at 58℃, and a total of 45 cycles.

[0033] Experimental result judgment: ① The CT values ​​of MPXV, CPXV and VARV detections correspond to the corresponding fluorescently labeled probes, and the internal standard RNase P amplification curve is good, the sample collection is qualified and the nucleic acid extraction is successful, C T If the value is <37, the result is positive; the rest of the test samples C T When the value is ≥40 or unterminated, the report is negative. ② Test the C of MPXV, CPXV and VARV in the sample T When the value is ≤40 and the amplification curve is good, it is reported as positive. ③ Test sample C T Value 37 ≤ C T For samples with a value <40, it is recommended to retest, and the retest result is 37≤C T If the value is <40 and the amplification curve is good, it is reported as positive for the corresponding virus according to the judgment criteria of ②. According to the obtained standard curve, the virus copy number (copies / mL) of MPXV, CPXV and VARV in the test specimen is calculated.

[0034] This study designed specific primers and probes for MPXV, CPXV, and VARV; and used RNase P as an internal standard to evaluate the amplification system. The single-tube one-step multiplex real-time fluorescence quantitative PCR can detect MPXV, CPXV, and VARV viruses simultaneously in a single tube, which not only significantly reduces the detection cost, but also obtains rich detection information. The introduction of the internal standard can determine the efficiency of the amplification system and assist in the judgment of the test results. In addition, the multiplex real-time fluorescence quantitative PCR also has extremely high sensitivity and specificity.

[0035] The invention is beneficial in that it adopts a one-step real-time fluorescence quantitative PCR technology with high specificity and high sensitivity, designs highly specific primers and fluorescent labeled probes for monkeypox virus, cowpox virus and varicella virus, introduces a conservative internal standard gene RNase P, and develops a multiple fluorescence quantitative PCR detection kit for detecting monkeypox virus, cowpox virus and varicella virus and determining sample collection and nucleic acid extraction. The invention can simultaneously detect the presence of monkeypox virus, cowpox virus and varicella virus in samples such as blood, follicle fluid and rash swabs through a PCR reaction. It is simpler, faster, more cost-effective, and has better sensitivity, specificity and repeatability than the single fluorescence quantitative PCR method. The virus to be tested is fully enclosed for detection and single-tube amplification for real-time quantification, and blood-borne infectious viruses can be effectively and quickly screened according to the number of copies of the virus infection. This technology can be applied to the rapid screening and identification of monkeypox virus, cowpox virus and varicella virus and their epidemiological research. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of the structure of this kit, where 1 is a mixed tube of fluorescent quantitative PCR reaction solution and Taq enzyme, 2 is a mixed tube of primers and probes, 3 is a negative control tube, 4 is a standard tube (4-1 monkeypox virus, 4-2 cowpox virus, 4-3 varicella, 4-4 RNase P, a total of 4 tubes), and 5 is a positive control tube (5-1 monkeypox virus, 5-2 cowpox virus, 5-3 varicella virus, 5-4 RNase P, a total of 4 tubes).

[0037] Figure 2 This is an example of a positive plasmid used in this kit to detect monkeypox virus, cowpox virus and varicella virus.

[0038] Figure 3 This is an example of using this kit to detect monkeypox virus positive plasmid.

[0039] Figure 4 This is an example of using this kit to detect vaccinia virus positive plasmid.

[0040] Figure 5 This is an example of using this kit to detect varicella virus positive plasmid.

[0041] Figure 6 The sensitivity of this kit for detecting monkeypox virus is 10 from left to right (1-7). 8 , 10 7 , 10 6 , 10 5 ,

[0042] 10 4 , 10 3 , 10 2 copies / mL.

[0043] Figure 7 This is the real-time fluorescence quantitative PCR standard curve of the monkeypox virus standard in this kit.

[0044] Figure 8 The sensitivity of this kit for detecting vaccinia virus is 10 from left to right (1-7). 8 , 10 7 , 10 6 , 10 5 ,

[0045] 10 4 , 10 3 , 10 2 copies / mL.

[0046] Fig. 9 This is the standard curve of real-time fluorescence quantitative PCR of vaccinia virus standard in this kit.

[0047] Fig.10 The sensitivity of this kit for detecting varicella virus is 10 from left to right (1-7). 8 , 10 7 , 10 6 , 10 5 ,

[0048] 10 4 , 10 3 , 10 2 copies / mL.

[0049] Fig.11 This is the standard curve of real-time fluorescence quantitative PCR of varicella virus standard in this kit.

[0050] Fig.12 This is the sensitivity of this kit to detect RNase P, from left to right (1-7) is 10 8 , 10 7 , 10 6 , 10 5 ,

[0051] 10 4 , 103 , 10 2 copies / mL.

[0052] Fig.13 This is the standard curve of real-time fluorescence quantitative PCR for the RNase P standard of this kit. DETAILED DESCRIPTION

[0053] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments. The following embodiments are only intended to illustrate the present invention but not to limit the scope of the present invention.

[0054] Example 1

[0055] A multiplex fluorescent quantitative PCR kit for detecting and distinguishing poxviruses in one step, the kit comprises a quantitative PCR reaction solution and an enzyme mixture, a primer and a probe mixture, a standard substance (monkeypox virus, cowpox virus, varicella virus, RNase P), a positive control substance (monkeypox virus, cowpox virus, varicella virus, RNase P), and a negative control substance. The box body is provided with container holes, which are respectively placed with a quantitative PCR reaction solution tube, an enzyme mixture tube, a primer and a probe mixture tube, a standard substance tube (monkeypox virus, cowpox virus, varicella virus, RNase P), a positive control substance tube (monkeypox virus, cowpox virus, varicella virus, RNase P), and a negative control substance tube.

[0056] See also Figure 1 , This kit package is provided with container holes for placing the corresponding kit components: quantitative PCR reaction solution tube and enzyme mixture tube (label 1), primer and probe mixture tube (label 2), negative control tube (label 3), standard tube (label 4) (including 4-1 monkeypox virus, 4-2 cowpox virus, 4-3 varicella virus, 4-4 RNase P standard, a total of 4 tubes), positive control tube (label 5) (including 5-1 monkeypox virus, 5-2 cowpox virus, 5-3 varicella virus, 5-4 RNase P positive control, a total of 4 tubes). The kit contains: quantitative PCR reaction solution and enzyme mixture, primer and probe mixture, standard (monkeypox virus, cowpox virus, varicella virus, RNase P), positive control (monkeypox virus, cowpox virus, varicella virus, RNase P), negative control.

[0057] Example 2

[0058] 1 Materials and methods

[0059] 1.1 Plasmid samples:

[0060] The positive plasmids of monkeypox virus, cowpox virus and varicella virus were synthesized by our company (Zhuhai Huirui Biotechnology Co., Ltd.).

[0061] In addition, nucleic acids of other herpes virus-positive specimens such as enterovirus 71 (EV71), coxsackievirus A16 (COXV16), hepatitis B virus nucleic acid (HBV-DNA), Epstein-Barr virus (EBV), and cytomegalovirus (CMV) were provided by the State Key Laboratory of Diagnosis and Treatment of Infectious Diseases and our company.

[0062] 1.2 Primers and probes

[0063] Multiple gene sequences of monkeypox virus, vaccinia virus and varicella virus from home and abroad were downloaded from NCBI gene bank. DNAman software was used to compare homology and determine the conserved regions of the above viral genomes. PrimerExpress 3.0 software was used to design highly specific primers and TaqMan probes in their conserved regions. Both primer and probe sequences were verified by Blast and had good specificity.

[0064] The primer and probe sequences are as follows:

[0065] Upstream primer MPXV-F: 5'-GTCAGCAGTGGCGATTTTCT-3'

[0066] Downstream primer MPXV-R: 5'-TGAACCAGATGGTCCTCTCAATA-3'

[0067] Specific probe MPXV-P: 5'-FAM-TAATAAACACCCACGTAAATACAAAACAGA-BHQ1-3'

[0068] Upstream primer CPXV-F: 5'-CAGCATTAATTATATTGTCGGC-3'

[0069] Downstream primer CPXV-R: 5-TGAACCAGATGGTCCGCTCAATA-3'

[0070] Specific probe CPXV-P: 5'-ROX-TAATAAACGTTCACGTAAATACAAAACAGA-BHQ2-3'

[0071] Upstream primer VARV-F: 5'-GGTGAGGGAGTTCCAACAGTAC-3'

[0072] Downstream primer VARV-R: 5'-TCTCGTCCAATCACTACATCGT-3'

[0073] Specific probe VARV-P: 5'-CY5-CCGTGTCGTCACCGTGTAAATATTC-BHQ3-3'

[0074] Upstream primer RNase PF: 5'-AGATTTGGACCTGCGAGCG-3'

[0075] Downstream primer RNase PR: 5'-GAGCGGCTGTCTCCACAAGT-3'

[0076] Specific probe RNase PP: 5'-VIC-TTCTGACCTGAAGGCTCTGCGCG-BHQ1-3'

[0077] The primer and probe sequences of RNase P were cited from J Clin Microbiol. 2005Apr; 43(4): 1851–1857. The above primers and probes were synthesized by our company (Zhuhai Huirui Biotechnology Co., Ltd.).

[0078] 1.3 Extraction of viral nucleic acid and quantitative standards of standard products:

[0079] Extraction of sample nucleic acid: 200uL serum sample was drawn into EP tube for nucleic acid extraction. Nucleic acid extraction was performed using Viral Nucleic Acid extraction Kit II from Geneaid Company according to the instructions of the kit, and 10uL of the extracted nucleic acid of the sample to be tested was taken as a template.

[0080] Synthesize each gene standard fragment and connect it to the plasmid vector pMDTM19-T Simple Vector (TaKaRa). Culture after transformation. Extract plasmid DNA after identification, measure the plasmid DNA concentration using NanoDrop ND-2000 Spectrophotometer, determine the DNA copy number, and use it as the standard quantitative mother solution. According to the experimental needs, dilute the standard quantitative mother solution to the required maximum concentration, and dilute it 10 times to the minimum concentration, and store it at -20℃ for later use.

[0081] 1.4 Optimization of multiplex real-time fluorescence quantitative PCR reaction system and conditions:

[0082] Detection of nucleic acid: Take 5uL of the extracted nucleic acid of the sample to be tested as a template. The total reaction volume is 20μL, of which the fluorescent quantitative PCR reaction solution and Taq enzyme mixture are 10μL, the primer and probe mixture (20μmol / L, including four sets of primers and fluorescent probes) is 3μL, the template is 5μL, and the remaining water is added to the final volume of 20μL. Detection is performed on the ABI 7500 fluorescent quantitative PCR instrument. The reaction procedure is: pre-denaturation at 95℃, 5min; then denaturation at 95℃ for 10s, annealing and extension at 58℃ for 30s, multiple fluorescence detection at 58℃, and a total of 45 cycles.

[0083] Result judgment: Select the fluorescence detection channels FAM, ROX, CY5, and VIC, select the average value of the fluorescence signal of 3-15 cycles for the fluorescence baseline, and set the threshold so that the threshold line just exceeds the highest point of the negative control. ① Sample collection qualified monkeypox virus, cowpox virus, and varicella virus detection C T The value corresponds to the corresponding fluorescently labeled probe. If the sample collection is qualified and the nucleic acid extraction is successful, the RNase P test is positive; when the sample C T When the value is ≥40, 0 or no value, it is reported as negative. ② When detecting C of monkeypox virus, cowpox virus, varicella virus positive plasmid / sample T When the value is <37, it is reported as positive. T For samples with a value ≥ 37 and less than 40, retesting is recommended. The retest result is C T If the value is ≥37 and less than 40, it is reported as positive for the corresponding virus according to the judgment criteria of ②. In the optimization test of the system, in the reaction system with the same concentration of positive nucleic acid as the template, the matrix method is used to screen the most suitable concentrations of primers and probes. The primer concentration ranges from 1 to 20 μM, and the probe concentration ranges from 1 to 20 μM. The most suitable primer and probe concentrations are selected according to the lowest Ct value and the highest fluorescence intensity increase value (ΔRn).

[0084] 1.5 Multiplex real-time fluorescence quantitative PCR specificity, sensitivity and repeatability test

[0085] Monkeypox virus, cowpox virus, varicella virus positive specimens (all from monkeypox virus, monkeypox-West African strain, monkeypox-Congo Basin strain positive plasmids) and other herpes viruses such as EV71, COXVA16, HBV, EBV and CMV positive clinical specimens were selected. Unfortunately, there were no monkeypox virus, cowpox virus and varicella virus positive clinical specimens in this study. The specificity of the method was verified by multiplex real-time fluorescence quantitative PCR. The monkeypox virus plasmid with a calibrated copy number (copies / mL) (10 8 copies / ml), vaccinia virus plasmid (10 8 copies / ml), varicella virus plasmid (10 8 copies / ml) and RNase P plasmid (10 8 After diluting the samples at 1000 copies / ml, the fluorescence quantitative PCR reaction was performed in parallel to verify the sensitivity of the method. In addition, the positive standard sample of each specified concentration was tested three times, and the C T The standard deviation and coefficient of variation were calculated to verify the repeatability of the method.

[0086] 2 Results

[0087] 2.1 Multiplex real-time fluorescence quantitative PCR reaction system and conditions

[0088] Detection of nucleic acid: Take 5uL of the extracted nucleic acid of the sample to be tested as a template. The total reaction volume is 20μl, including 10μL of quantitative PCR reaction solution and enzyme mixture, 3μL of primer and probe mixture (20μmol / L, including four sets of specific primers and corresponding four fluorescent probes), 5μL of template, and add water to make up to 20μL. Detection is performed on an ABI QuantStudio 5system fluorescent quantitative PCR instrument (or other PCR instruments with four-color fluorescence and above), and the reaction parameters are: The reaction program is: pre-denaturation at 95℃, 5min; then denaturation at 95℃ for 10s, annealing and extension at 58℃ for 30s, multiple fluorescence detection at 58℃, and a total of 45 cycles.

[0089] 2.2 Specificity test

[0090] The one-step multiplex fluorescence quantitative PCR method established by the present invention has good specificity for monkeypox virus, cowpox virus and varicella virus, and can completely detect positive plasmid specimens. Unfortunately, there are no positive clinical samples in China for the time being. The multiplex primers and probes in the present invention have no cross-reaction with other and other herpes viruses such as EV71, COXVA16, HBV, EBV and CMV positive specimens. This method can specifically detect monkeypox virus, cowpox virus and varicella virus in plasmid specimens, and the internal standard also shows a good amplification effect. The results are shown in Figure 2 , Figure 3 , Figure 4 and Figure 5 .

[0091] 2.3 Sensitivity test

[0092] The sensitivity of monkeypox virus, cowpox virus and varicella virus to RNase P was tested. The monkeypox virus plasmid (10 8 copies / mL), vaccinia virus plasmid (10 8 copies / mL), varicella virus plasmid (10 8 copies / mL) and RNase P plasmid (10 8 After 10-fold gradient dilution, the kit was used for detection. The test results showed that the detection sensitivity of this method reached 10 2 , 10 2 , 10 2 and 10 2 copies / mL. Results are shown in Figure 6 , Figure 8 , Fig.10 , Fig.12For mixed detection of monkeypox virus, vaccinia virus and varicella virus positive plasmids, the results of virus and internal standard detection showed that it is possible to detect and distinguish the above viruses simultaneously in a single tube (see Figure 2 ).

[0093] 2.4 Repeatability test

[0094] Take monkeypox virus plasmid (final concentration 2×10 6 copies / mL), vaccinia virus (2×10 6 copies / mL), varicella virus plasmid (2×10 6 copies / mL) and RNase P plasmid (2×10 6 copies / mL), and diluted 10-fold to 2×10 5 With 2×10 4 , for 2×10 6 , 2×10 5 , 2×10 4 The samples were tested three times and their coefficient of variation and standard deviation were calculated. T The standard deviation of the values ​​was between 0.34 and 0.67, and the coefficient of variation was less than 2.50%, which showed good repeatability (the results are shown in Table 1).

[0095] Table 1 Repeatability test of multiplex real-time fluorescence quantitative PCR detection of synthetic nucleic acids

[0096]

[0097] Example 3

[0098] The clinical samples collected by this kit for testing were mainly 45 discarded samples of pathogen detection specimens from the fever clinic between March 2022 and July 2021. The collected specimens were tested by multiple real-time fluorescence quantitative PCR in this method, and the results are as follows: A total of 45 specimens were tested in the fever clinic, and the test results of monkeypox virus, cowpox virus and varicella virus were all negative, and the negative control, positive control and internal standard all showed good amplification effects (C T The positive results of the test kit are 100% consistent with the positive results of the commercial test kit (monkeypox virus and varicella virus) (Zhijiang Biology).

Claims

1. A one-step multiplex fluorescence quantitative PCR kit for detecting and distinguishing poxviruses, characterized in that: The PCR kit contains a quantitative PCR reaction solution, an enzyme mixture, a primer and probe mixture, a standard, a positive control, and a negative control; wherein the quantitative PCR reaction solution contains a PCR reaction buffer and an enzyme mixture, and the primer and probe mixture contains four sets of primers and corresponding four different fluorescently labeled probes; the upstream / downstream primers and corresponding specific probe sequences of monkeypox virus, cowpox virus, varicella virus and ribonuclease for fluorescent quantitative PCR detection are as follows: Upstream primer MPXV-F: 5'- GTCAGCAGTGGCGATTTTCT-3' Downstream primer MPXV-R: 5'-TGAACCAGATGGTCCTCTCAATA-3' Specific probe MPXV-P: 5'-FAM-TAATAAACACCCACGTAAATACAAAACAGA-BHQ1-3' Upstream primer CPXV-F: 5'- CAGCATTAATTATATTGTCGGC-3' Downstream primer CPXV-R: 5- TGAACCAGATGGTCCGCTCAATA-3' Specific probe CPXV-P: 5'-ROX-TAATAAACGTTCACGTAAATACAAAACAGA-BHQ2-3' Upstream primer VZV-F: 5'- GGTGAGGGAGTTCCAACAGTAC-3' Downstream primer VZV-R: 5'-TCTCGTCCAATCACTACATCGT-3' Specific probe VZV-P: 5'-CY5-CCGTGTCGTCACCGTGTAAATATTC-BHQ3-3' Upstream primer RNase PF: 5'-AGATTTGGACCTGCGAGCG-3' Downstream primer RNase PR: 5'-GAGCGGCTGTCTCCACAAGT-3' Specific probe RNase PP: 5'-VIC-TTCTGACCTGAAGGCTCTGCGCG-BHQ1-3'.

2. The multiplex fluorescence quantitative PCR detection kit according to claim 1, characterized in that: The standard substances include MPXV, CPXV, VZV and RNase P, and the gene sequences of the conserved regions are as follows: The sequence of the standard sample of monkeypox virus is: ATATTTGGTATTACCACATTAATTATATTGTCAGCAGTGGCGATTTTCTGTATTACGTATTATATATGTAATAAACACCCACGTAAATACAAACAGAGAACAAAGTCTAGATTTTGACTTACATAAATATCTGGGATAATAAAATCTATCATATTGAGAGGACCATCTGGTTCAGGAAAGACAGCCATAACCAAAAGA; The standard sequence of vaccinia virus is: AGACTATGTCGAAGTATTTGGTATTGCAGCATTAATTATATTGTCGGCCGTGGCAGTTTTCTGTATCACATATTATATATGTAATAAACGTTCACGTAAATACAAAACAGAAAACAAAGTCTAGATTTTGACTTACATAAATGTCTGGGATAGTAAATCTATCATATTGAGCGGACCATCTGGTTCAGGAAAGACAGCTATAGTCA; The standard sequence of varicella virus is: TTCAAAGGATTGCGATTGCGGTTGGTGAGGGAGTTCCAACAGTACTTAAAACGTGTTGTGCCCCCCCCTCGACCGCATATTTCCTCCCCGTGTCGTCACCGTGTAAATATTCTTAATGATAAGACGATGTAGTGATTGGACGAGACTCGAGGCGGGAAG; The standard sequence of RNase P is: ATGGGACTTCAGCATGGCGGTGTTTGCAGATTTGGACCTGCGAGCGGGTTCTGACCTGAAGGCTCTGCGCGGACTTGTGGAGACAGCCGCTCACCTTGGCTATTCAGTTGTTGCTATC.

3. The multiplex fluorescence quantitative PCR detection kit according to claim 1, characterized in that: The negative control was high temperature and high pressure sterilized diethyl pyrocarbonate treated water, and the positive control was positive plasmid samples of monkeypox virus, cowpox virus, varicella virus and internal standard RNaseP.

4. The multiplex fluorescence quantitative PCR detection kit according to claim 1, characterized in that: The PCR reaction buffer contains magnesium chloride and a mixture of deoxyribonucleotide triphosphates, and the enzyme mixture contains thermostable Taq DNA polymerase and thermostable RNaseH.

5. The multiplex fluorescence quantitative PCR detection kit according to claim 1, characterized in that: The primer and probe mixture is in a brown tube for easy storage away from light.

6. The multiplex fluorescence quantitative PCR detection kit according to claim 1, characterized in that: The kit was stored at -20°C.

Images