A high specific activity alkaline xylanase mutant and its application

Abstract

The present invention relates to the field of genetic engineering and protein modification technology, and in particular to a high specific activity alkaline xylanase mutant and its application. The present invention is based on wild-type xylanase H1, and provides a mutant comprising at least one mutation site among Y46F, L77I, Y128F, S131T, T178S, and V207N. Compared with wild-type xylanase H1, the specific activity of the xylanase mutant provided by the present invention is generally increased by 9.7%-34.7%; among them, the specific activity of the xylanase mutant containing the T178S single point mutation is the highest, reaching 1632.45 U / mg, which is conducive to reducing the production cost of the enzyme and promoting its wide application in the industrial field.

Description

Technical Field

[0001] The present invention relates to the technical field of gene engineering and protein engineering, and in particular to a high-specific-activity alkaline xylanase mutant and application thereof. Background Art

[0002] Xylan is a type of hemicellulose (the second most abundant renewable resource on Earth), primarily found in plants. It connects lignin and cellulose, playing a crucial role in stabilizing plant tissue structure. Xylan is also the most abundant polysaccharide in nature besides cellulose, boasting a highly complex structure. Its monomer is D-xylose, with substituent groups of varying sizes attached to both the main chain and side chains. In a world characterized by increasing fossil energy scarcity and increasingly severe environmental pollution, researchers are focusing on the rational utilization of renewable resources. Consequently, the full utilization of xylan has attracted considerable attention. However, due to the complexity of xylan's chemical structure, its complete degradation requires the use of a complex system of hydrolytic enzymes with diverse functions and modes of action. This loaded xylan-degrading enzyme system primarily includes β-1,4-endo-xylanase (β-1,4-D-xylanohydrolase: EC3.1.2.8), β-1,4-xylosidase (β-1,4-Dxylanxlylohydrolase: EC3.2.1.37), α-L-arabinofuranosidase (α-L-arabinofuranosidase: EC3.2.1.55), α-glucuronidase, and acetylxylan esterase. Studies have shown that this complete enzyme system is widely present in microorganisms. β-1,4-endo-xylanase is the most important enzyme in the xylan hydrolysis process, specifically targeting the glycosidic bonds of the β-1,4-D-xylosidic bonds on the xylan backbone, completely hydrolyzing xylan into xylose, xylobiose, and xylo-oligosaccharides higher than xylobiose.

[0003] Xylanase, a catalytic enzyme that hydrolyzes xylan, is widely used in the chemical, feed, detergent, papermaking, and food industries. In the chemical industry, xylanase hydrolyzes xylan into monosaccharides and oligosaccharides, preparing the substrate for subsequent ethanol fermentation and furfural production. In the feed industry, xylanase reduces the viscosity of grain digesta in the animal's intestines, improving feed digestibility. In the detergent industry, xylanase can be used as a laundry detergent or clothing care ingredient. In the papermaking industry, xylanase plays a vital role in pulping and bleaching, benefiting both processes while also reducing chemical usage. In the food industry, xylanase can be used to produce functional oligosaccharides, reduce juice turbidity, and clarify juice, improving the quality of whole-wheat bread and making it softer.

[0004] In order to expand the application scope of alkaline xylanase in production and application, many scholars have used cloning technology and genetic engineering technology in recent years to express, purify and expand the culture of alkaline xylanase genes isolated from nature, and great progress has been made. Long et al. used the double plasmid co-expression method to express alkaline xylanase from Aspergillus niger ( Aspergillus niger ) xylanase gene was transferred into Pichia pastoris ( Pichia pastoris ) was expressed in the culture medium, increasing its expression capacity by 33%. By optimizing the culture conditions, the expression capacity was increased by 2.4 times compared with the shake flask culture, providing a new method for increasing the yield of xylanase in production. Caulobacter crescentus ) was isolated and amplified by polymerase chain reaction, and cloned into the pTrcHisA vector. E. coli The xylanase was highly expressed in BL21 (DE3) and purified after culturing for 24 h under alkaline conditions of pH 8.0. It showed high stability and was able to effectively hydrolyze treated corn straw, releasing a large amount of reducing sugars and oligoxylose. This study provides ideas and methods for the production of high-yield oligosaccharides using cheap raw materials. Yu et al. Marinimicrobium sp A multi-domain high molecular weight endo-β-1,4-glucanase gene xylM18 was cloned from LS-A18 and expressed in E. coli Heterologously expressed in BL21 (DE3) cells, XylM18 is the first multidomain, high-molecular-weight xylanase discovered to date. It exhibits salt- and alkali-tolerant stability and can be used for xylan biodegradation under high-salt and alkaline conditions. Li et al. constructed a gene fragment library and identified 12 different xylanase fragment sequences from the GH11 family. Among them, xyn22 was cloned and exhibited excellent alkali tolerance. Furthermore, by introducing an aromatic interaction between the Y48 and F53 sites, the thermostability of Xyn22 was significantly improved without compromising alkali tolerance.

[0005] Error-prone PCR is a commonly used technology for directed evolution screening of protein molecular modification and has been widely used to improve the properties of various enzyme molecules. Liu Jun et al. established a random mutation library of xylanase gene by error-prone PCR and double enzyme digestion vector reconstruction method, from which four mutants with relative enzyme activity in the pH range of 8.0-9.5 were screened out, and the relative enzyme activity was about 15% higher than that of the starting strain. The four mutation sites were then combined and mutated. The affinity and catalytic efficiency of each combined mutant enzyme with the substrate were higher than those of the wild-type starting strain enzyme, and the pH stability was significantly higher than that of the wild-type enzyme. This provides a feasible method for modifying the alkaline resistance of GH11 family xylanase Xyn11A-LC, and also provides some help for the study of alkaline resistance of xylanase. Lai et al. obtained a xylanase from alkaliphilic Bacillus ( Bacillus sp. ) isolated a new thermostable and alkali-resistant xylanase gene, xyn30Y5, from a 200-kDa xylanase. Forty-seven mutants were engineered, 21 of which showed improved activity. Combined mutagenesis doubled the catalytic efficiency (kcat / Km) and RA 601 / 2h value of the best mutant, while also increasing its optimal pH from 7.0 to 8.0. This not only provides a new thermostable and alkali-resistant xylanase with potential for industrial application, but also offers an effective mutagenesis strategy for improving xylanase activity. Chen et al. randomly mutagenized the xylanase Xyn-CDWT and screened for the most alkali-resistant mutant. Comparison revealed that mutations G214V, S128F, and E24V increased the hydrophobicity of the xylanase, while mutation N164D increased the enzyme's negative charge. K168N, by replacing a positively charged L-lysine, indirectly increased the enzyme's negative charge, improving its alkali resistance.

[0006] Wang Junqing et al. cloned a strain from Aspergillus usamii ( Aspergillus usamii ) and the gene sequence of xylanase in P. pastoris GS115 and E. coliHeterologous expression was performed in BL21 (DE3) cells. Computer-aided design was then performed to modify the thermostability of the enzyme through N / C-terminal segment replacement, disulfide bond addition, and point mutations. Four thermostability-enhancing mutants were obtained, with their optimal temperatures approximately 2.0°C higher than the original xylanase, indicating improved thermostability. Li et al. modified a xylanase from Streptomyces by N-terminal region replacement and site-directed mutagenesis. The results showed that the specific enzymatic activities of the three mutants were 2.1-fold, 3.2-fold, and 5.3-fold higher than the original xylanase, respectively. The substrate affinity and kcat / Kmax of the mutants were also improved compared to the original xylanase. Bai et al. constructed a random mutation library of approximately 10,000 clones for the xylanase Xyn11A-LC using error-prone PCR and screened for alkali-resistant mutants from the library. Mutant E135V increased the optimal pH of wild-type xylanase from 7.5 to 8.0, and the relative enzyme activities at pH 8.5, 9.0, 9.5, and 10.0 increased by 17.5%, 18.9%, 14.3%, and 9.5%, respectively. Mutant E135R increased the optimal pH of wild-type xylanase from 7.5 to 8.5, and mutations E135V and E135R increased the catalytic efficiency (kcat / Km) by 57% and 37%, respectively. Cao Yufan et al. established a random mutation library based on the GH11 family xylanase xyn11A-LC and screened for three mutants that significantly improved the alkaliphilicity of the wild-type. Using protein molecular modeling, they conducted site-directed mutagenesis at key sites identified, ultimately generating three mutants with significantly improved alkaliphilicity compared to the wild-type.

[0007] Currently used xylanases suffer from low specific activity, instability, high cost, and inability to meet production needs, necessitating molecular modification to optimize their properties. The present invention provides an alkaline xylanase with high specific activity, making it more suitable for practical applications in industrial fields. Summary of the Invention

[0008] The purpose of the present invention is to provide an alkaline xylanase mutant and its application. The mutant has a significantly improved specific activity compared to the wild type, which is conducive to its wide application in the industrial field.

[0009] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0010] The present invention provides a xylanase mutant comprising an amino acid sequence having at least 90% identity to SEQ ID NO: 1, and comprising an amino acid substitution at at least one position selected from the group consisting of 46, 77, 128, 131, 178, and 207 compared to SEQ ID NO: 1.

[0011] In some embodiments of the invention, the amino acid sequence of the mutant is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to SEQ ID NO: 1.

[0012] In some more specific embodiments, the amino acid sequence of the mutant is at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identical to SEQ ID NO:1.

[0013] In some embodiments of the present invention, the mutant comprises substitution of at least one amino acid selected from the group consisting of Y46F, L77I, Y128F, S131T, T178S, and V207N.

[0014] The present invention also provides a DNA molecule encoding the above xylanase mutant.

[0015] The present invention also provides a recombinant expression vector comprising the above DNA molecule.

[0016] The present invention also provides a host cell comprising the above-mentioned recombinant expression vector.

[0017] When the above plasmid is transferred into host cells, the specific activity of the recombinantly expressed xylanase mutant is significantly improved.

[0018] In some embodiments of the present invention, the host cell is Pichia pastoris ( Pichia pastoris ).

[0019] The present invention also provides application of the xylanase mutant in the field of papermaking.

[0020] Based on wild-type xylanase H1, the present invention provides mutants containing at least one of the following mutations: Y46F, L77I, Y128F, S131T, T178S, and V207N. Compared to wild-type xylanase H1, the xylanase mutants provided by the present invention generally exhibited 9.7%-34.7% higher specific activity. Among them, the xylanase mutant containing the T178S single-point mutation had the highest specific activity, reaching 1632.45 U / mg, achieving unexpected technical benefits.

[0021] In summary, the specific activity of the xylanase mutant provided by the present invention is significantly improved, which is beneficial to reducing the production cost of xylanase and promoting its wide application in the industrial field. DETAILED DESCRIPTION

[0022] The present invention discloses an alkaline xylanase mutant, its preparation method and application, a DNA molecule encoding the alkaline xylanase mutant, a vector, and a host cell. Those skilled in the art can refer to the contents herein and appropriately modify the process parameters to achieve the desired results. The methods and applications of the present invention have been described through preferred embodiments. It is apparent that those skilled in the art can modify, alter, and combine the methods and applications described herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.

[0023] The present invention has used the conventional techniques and methods used in genetic engineering and molecular biology fields, for example the method of putting down in writing in MOLECMLAR CLONING:A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECMLAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. But those skilled in the art can, on the basis of the technical solutions put down in writing in the present invention, adopt other conventional methods, experimental schemes and reagents in this area, and are not limited to the limitation of the specific embodiments of the present invention. For example, the present invention can select the following experimental materials and reagents:

[0024] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vectors pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0025] Enzymes and kits: PCR enzyme and ligase were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.

[0026] Culture medium formula:

[0027] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0028] Yeast culture medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

[0029] Yeast screening medium (MD medium): 2% peptone, 2% agarose;

[0030] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol;

[0031] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol;

[0032] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0033] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;

[0034] Upper culture medium: 0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose;

[0035] Lower culture medium: 2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar.

[0036] The present invention will be further described below in conjunction with the embodiments:

[0037] Example 1 Construction of recombinant plasmid

[0038] from Paecilomyces spp. Paecilomyces. sp The xylanase gene (GeneBank ACS26244.1) from Pichia pastoris was optimized based on the codon preference of Pichia pastoris. Six bases, GAATTC (an EcoRI restriction site), were added before the start codon ATG, and GCGGCCGC (a Not I restriction site) was added after the stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Bioengineering Co., Ltd. This xylanase was named H1. Its amino acid sequence is shown in SEQ ID NO: 1, and its encoding nucleotide sequence is shown in SEQ ID NO: 2.

[0039] The xylanase gene was digested with restriction enzymes EcoRI and NotI (Fermentas). Simultaneously, the plasmid pPIC9K was digested with restriction enzymes EcoRI and NotI. The digestion products were purified using a gel purification kit and ligated using T4 DNA ligase (Fermentas). The ligated products were transformed into DH5α Escherichia coli (Invitrogen) and selected with ampicillin. Several clones were sequenced (Invitrogen) to ensure accuracy.

[0040] Plasmids were purified from E. coli clones with correct sequencing results using a plasmid miniprep kit (Omega) to obtain a recombinant plasmid, which was named pPIC9K-H1.

[0041] Example 2 Screening of high specific activity xylanase mutants

[0042] To further enhance the enzymatic activity of xylanase H1, the applicants conducted protein structural analysis. This protein, a GH11 family xylanase, has a β-jellyroll structure. Using directed evolution, the applicants screened a large number of mutations in the enzyme.

[0043] 1.1 Design PCR primers H1-F1 and H1-R1:

[0044] H1-F1: GGC GAATTC ATGATGATTGGTATCACTTCTTTTGC (underlined is the restriction endonuclease EcoRI recognition site);

[0045] H1-R1:ATA GCGGCCGC TTAACCGACGTCTGCAACGGTAATTC (the underline indicates the restriction endonuclease NotI recognition site).

[0046] PCR amplification was performed using the H1 gene (SEQ ID NO: 1) as a template using the aforementioned primers using the GeneMorph II Random Mutation PCR Kit (Bomais). The PCR product was recovered from a gel, digested with EcoRI and NotI, and ligated with the pET21a vector digested with the same enzymes. The product was then transformed into Escherichia coli BL21 (DE3), plated on LB+Amp plates, and incubated upside down at 37°C. After transformants appeared, they were picked individually with a toothpick into a 96-well plate. 150 μl of LB+Amp medium containing 0.1 mM IPTG was added to each well of the plate. The cells were incubated at 37°C and 220 rpm for approximately 6 h. The supernatant was discarded after centrifugation, and the cells were resuspended in buffer and repeatedly frozen and thawed to break the cell wall to obtain an E. coli cell lysate containing xylanase.

[0047] 30 μl of lysate was transferred to two new 96-well plates. 30 μl of substrate was added to one of the 96-well plates and the reaction was incubated at 37°C for 30 minutes. The resulting reducing sugars were then determined by the DNS method. 150 μl of Coomassie Brilliant Blue solution was added to the other plate and allowed to stand for 10 minutes. Protein content was then determined by the Coomassie Brilliant Blue (Bradford) binding method. The enzyme activity and protein content of the different mutants were then calculated. Ultimately, the applicant screened out over 20,000 transformants and identified single-point mutants Y46F, L77I, Y128F, S131T, T178S, and V207N that significantly improved the specific activity of xylanase.

[0048] Based on the above-mentioned wild-type xylanase H1, the present invention provides mutants containing single mutation sites of Y46F, L77I, Y128F, S131T, T178S, and V207N, respectively.

[0049] Example 3 Expression of xylanase in Pichia pastoris

[0050] 3.1 Construction of expression vector

[0051] The gene sequences of xylanase H1 and its mutants were optimized according to the codon preference of Pichia pastoris and synthesized by Shanghai Jierui Bioengineering Co., Ltd., and two restriction sites, EcoRI and NotI, were added to the 5' and 3' ends of the synthetic sequence, respectively.

[0052] According to the method described in Example 1, the gene sequences of the synthesized xylanase H1 and its mutants were double-digested with EcoRI and NotI, respectively, and then ligated with the pPIC-9K vector digested with the same enzymes overnight at 16°C. The resulting DNA was transformed into Escherichia coli DH5a, spread on LB+Amp plates, and inverted cultured at 37°C. After transformants appeared, colony PCR was performed (reaction system: template-picked single clone, rTaq DNA polymerase 0.5 μL, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5'AOX primer (10 mM): 0.5 μL, 3'AOX primer: 0.5 μL, ddH2O 14.5 μL, reaction procedure: pre-denaturation at 95°C for 5 min, 30 cycles of: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). The positive clones were verified by sequencing and the correct recombinant expression plasmid was obtained.

[0053] 3.2 Construction of Pichia pastoris engineered strains

[0054] 3.2.1 Preparation of competent yeast

[0055] The Pichia pastoris GS115 strain was activated on a YPD plate and cultured at 30°C for 48 h. The activated GS115 monoclonal was inoculated into 6 mL of YPD liquid medium. The culture was carried out at 30°C and 220 rpm for about 12 h. The bacterial solution was then transferred to a triangular flask containing 30 mL of YPD liquid medium and cultured at 30°C and 220 rpm for about 5 h. The bacterial density was detected by UV spectrophotometer. When the OD600 value was in the range of 1.1–1.3, 4 mL of the bacterial cells were collected into sterile EP tubes by centrifugation at 4°C and 9000 rpm for 2 min. The supernatant was gently discarded. The remaining supernatant was dried with sterile filter paper and resuspended in 1 mL of pre-cooled sterile water. The cells were centrifuged at 4°C and 9000 rpm for 2 min. The supernatant was gently discarded. The cells were washed with 1 mL of sterile water again. The cells were centrifuged at 4°C and 9000 rpm for 2 min. The supernatant was gently discarded. The cells were then washed with 1 mL of sterile water again. The cells were centrifuged at 4°C and 9000 rpm for 2 min. The supernatant was gently discarded. The cells were then washed with 1 mL of pre-cooled sorbitol (1 mL) mol / L) to resuspend the cells; centrifuge at 9000 rpm at 4°C for 2 min, gently discard the supernatant, and gently resuspend the cells in 100-150 μl of pre-cooled sorbitol (1 mol / L).

[0056] 3.2.2 Transformation and screening

[0057] The recombinant expression plasmids constructed in 3.1 were linearized with Sac I. The linearized fragments were purified and recovered and transformed into Pichia pastoris GS115 by electroporation. The recombinant Pichia pastoris strains were screened on MD plates, and then multi-copy transformants were screened on YPD plates containing different concentrations of geneticin (0.5 mg / mL-8 mg / mL).

[0058] The obtained transformants were transferred to BMGY medium and cultured with shaking at 30°C and 250 rpm for 1 day; then transferred to BMMY medium and cultured with shaking at 30°C and 250 rpm; 0.5% methanol was added every day to induce expression for 4 days; and the bacteria were removed by centrifugation at 9000 rpm for 10 minutes to obtain fermentation supernatants containing xylanase H1 and xylanase mutants, respectively.

[0059] 1. Xylanase activity determination method

[0060] (1) Definition of xylanase activity unit

[0061] Under the conditions of temperature of 50℃ and pH of 8.0, the amount of enzyme required to degrade and release 1 μmol of reducing sugar from a 5 mg / ml xylan solution per minute is one enzyme activity unit, expressed as U.

[0062] (2) Xylanase activity determination method

[0063] Pipette 10.0 ml of xylan solution and equilibrate at 50°C for 20 min.

[0064] Pipette 10.0 ml of appropriately diluted enzyme solution and equilibrate at 50°C for 5 min.

[0065] Blank sample determination: Pipette 2.00 ml of appropriately diluted enzyme solution (equilibrated at 50°C) into a graduated test tube. Add 5 ml of DNS reagent and shake in a magnetic field for 3 seconds. Then add 2.0 ml of xylan solution, equilibrate at 50°C for 30 minutes, and heat in a boiling water bath for 5 minutes. Cool to room temperature with tap water, add water to make up to 25 ml, and shake in a magnetic field for 3 to 5 seconds. Measure the absorbance A at 540 nm using a standard blank as a blank control. B .

[0066] Sample Assay: Pipette 2.00 ml of appropriately diluted enzyme solution (equilibrated at 50°C) into a graduated test tube. Add 2.0 ml of xylan solution (equilibrated at 50°C), shake in an electromagnetic field for 3 seconds, and maintain at 50°C for 30 minutes. Add 5.0 ml of DNS reagent and shake in an electromagnetic field for 3 seconds to terminate the enzymatic hydrolysis reaction. Heat in a boiling water bath for 5 minutes, cool to room temperature with tap water, dilute to 25 ml with water, and shake in an electromagnetic field for 3 seconds. Measure the absorbance A at 540 nm using a standard blank as a blank control. E

[0067] Where:

[0068] XD—xylanase activity in the sample dilution, U / ml;

[0069] AE—absorbance of enzyme reaction solution;

[0070] AB—absorbance of enzyme blank sample;

[0071] K—slope of the standard curve;

[0072] CO—intercept of the standard curve;

[0073] M—molar mass of xylose M(C5XYN110O5) = 150.2 g / mol;

[0074] t—enzyme hydrolysis reaction time, min;

[0075] N—enzyme solution dilution multiple;

[0076] 1000—Conversion factor, 1 mmol = 1000 μmol.

[0077] (3) Measurement results

[0078] Enzyme activity was detected according to the above method, and the results showed that the enzyme activity of the fermentation supernatant of the recombinant Pichia pastoris strain expressing xylanase H1 and its mutants constructed above was 419-749 U / mL.

[0079] 2. Protein content determination method

[0080] The Coomassie Brilliant Blue (Bradford) binding assay for protein content determination is a hybrid method combining colorimetry and pigmentation. Coomassie Brilliant Blue G-250 appears brownish-red in acidic solutions and turns blue upon binding to protein. Within a certain protein concentration range, it conforms to Beer's law and can be measured colorimetrically at 595 nm. Substantial absorption occurs within 3-5 minutes and remains stable for at least 1 hour. Within the range of 10-1000 μg / mL, absorbance is directly proportional to protein concentration.

[0081] The enzyme solution and Coomassie Brilliant Blue solution were mixed in a volume ratio of 1:5, and allowed to stand for 10 min. The protein content was determined by the Coomassie Brilliant Blue (Bradford) binding method.

[0082] The protein content was tested according to the above method. The results showed that the protein content of the fermentation supernatant of the recombinant Pichia pastoris strain expressing the recombinant xylanase H1 and its mutants was 0.33-0.51 mg / mL.

[0083] 3. Specific activity calculation

[0084] “Specific Activity” refers to the number of enzyme activity units per unit weight of protein, generally expressed as U / mg protein.

[0085] The formula for calculating specific activity is: specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

[0086] See Table 1 for specific results.

[0087] Table 1 Comparison of specific activities of alkaline xylanase mutants

[0088] Xylanases and their single-point mutants Specific activity (U / mg) Wild-type H1 1211.58 Y46F 1328.92 L77I 1523.28 Y128F 1349.47 S131T 1299.36 T178S 1632.45 V207N 1479.92

[0089] As can be seen from the results in Table 1, compared with the wild-type xylanase H1, the specific activity of the alkaline xylanase mutants provided by the present invention is generally increased by 9.7%-34.7%; among them, the alkaline xylanase mutant containing the T178S single point mutation has the highest specific activity, reaching 1632.45 U / mg, achieving unexpected technical effects.

[0090] In summary, the specific activity of the alkaline xylanase mutant provided by the present invention is significantly improved, which is beneficial to reducing the production cost of the enzyme and promoting its wide application in the industrial field, especially in the papermaking field.

Claims

1. A xylanase mutant, characterized in that: Compared with SEQ ID NO: 1, the mutant has only one amino acid substitution: L77I.

2. A DNA molecule encoding the xylanase mutant according to claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.