A molecular marker method for identifying different peach blossom colors and its application

Abstract

The present invention discloses a molecular marker method for identifying different peach flower colors and its application, including any of the following applications: (1) regulating peach flower color; (2) cultivating peach plants with different flower colors; (3) promoting the accumulation of peach anthocyanin, or preparing a product that promotes the accumulation of peach anthocyanin; the nucleotide sequence of the R site distinguishing gene is shown in SEQ ID NO: 1, and the nucleotide sequence of the r site distinguishing gene is shown in SEQ ID NO: 2. The method of the present invention is fast and effective, has good repeatability, and can accurately identify the red and pink flower color peach types determined by the R / r allele combination.

Description

Technical Field

[0001] The invention relates to a molecular marker method for identifying different peach blossom colors and application thereof, belonging to the technical field of genetic engineering. Background Art

[0002] Peach (Prunus persica) has strong adaptability and is one of the most widely distributed deciduous fruit trees. It is cultivated on all five continents. Peach trees usually bloom and bear fruit in spring, and peach blossoms are ornamental. The most common color of peach petals is pink, while a few peach varieties have red, white or intermediate colors (two or more colors at the same time).

[0003] The difference in peach flower color is determined by the content of flavonoid metabolites and derivatives (especially anthocyanins) in the petals. The content of anthocyanins in red peach petals is significantly higher than that in pink peach petals, and there is almost no accumulation of anthocyanins in white peach petals, so different flower colors are formed. It has been found that the GST gene mutation on the third chromosome of peach causes peach flowers and peach peels to not accumulate anthocyanins, thus forming white peach flowers and pure white peach fruits (flower / fruit peel color "defective" expression), and its genetic control locus is the W / w locus. Summary of the invention

[0004] Based on the genome-wide association analysis of 20 red peaches and 159 pink peaches, a new insertion-deletion sequence variation on the first chromosome of peach was found to be highly correlated with the red and pink flower color trait. This site has a 9bp repetitive insertion in all red peaches and is considered to be r. Its allele (no 9bp insertion) site is considered to be R. The survey results of 179 peach varieties all meet the judgment that rr is red flower, RR or Rr is pink flower. Based on this, the present invention has developed a molecular marker method for R / r site distinction, which is suitable for the identification of red and pink flower colors of peach germplasm and its offspring. The specific technical scheme is as follows:

[0005] The application of the R / r site distinguishing gene on the first chromosome of peach includes any of the following applications: (1) regulating the color of peach flowers; (2) cultivating peach plants with different flower colors; (3) promoting the accumulation of peach anthocyanins, or preparing products that promote the accumulation of peach anthocyanins; the nucleotide sequence of the R site distinguishing gene is shown in SEQ ID NO: 1, and the nucleotide sequence of the r site distinguishing gene is shown in SEQ ID NO: 2.

[0006] The present invention is a molecular marker method for identifying different peach flower colors. By identifying the R / r site distinguishing gene on the first peach chromosome, the identification of peach plants with different flower colors is obtained. rr is red flower peach; RR or Rr is pink flower peach.

[0007] The above method comprises the following steps:

[0008] Step 1: Extract genomic DNA from the leaves to be tested.

[0009] Step 2: Two-step PCR amplification bands,

[0010] The PCR amplification primer Rr-F: GGAAGCTAATGAGGAGTATGCTAAGCATATGC,

[0011] Rr-R:GGATCAACATGGCACTCGCCAACACATAC,

[0012] PCR reaction cycle conditions: 98℃20s, 65℃60s, 30 cycles,

[0013] Step 3: Purify the PCR amplified bands, digest with restriction endonuclease Sfi I at 50°C overnight, and detect the digestion results by agarose electrophoresis.

[0014] Step 4: Identification: Determine the target band of the R / r site distinguishing gene based on the electrophoresis results.

[0015] The locus with only the 760 bp band was RR;

[0016] The locus with 500 and 269 bp bands is rr;

[0017] The sites with 760bp, 500bp and 269bp at the same time are Rr,

[0018] rr stands for red flower peach; RR or Rr stands for pink flower peach.

[0019] Furthermore, different peach blossom colors include red or pink.

[0020] Beneficial effects: The method of the invention is rapid and effective, has good repeatability and high accuracy, and can accurately identify the red and pink peach types determined by the R / r allele combination and the genetics. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is a graph showing the electrophoresis results of R / r site identification of 10 peach varieties according to the embodiment of the present invention. DETAILED DESCRIPTION

[0022] The present invention is further explained below in conjunction with the accompanying drawings and specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention. After reading the present invention, various equivalent forms of modifications to the present invention by those skilled in the art all fall within the scope defined by the claims attached to this application.

[0023] Studies have shown that white / non-white (red, pink) and red / pink peach petals are controlled by independent genetic loci, and red flowers are allelically recessive to pink flowers. The locus that determines red / pink flower color is the R / r locus, where the pink flower peach genotype is RR or Rr, and the red flower peach genotype is rr. However, the flower color determining locus R / r has not been cracked so far, which has affected the breeding of peach varieties with specific flower colors.

[0024] Example

[0025] Leaves of 10 peach varieties were collected and their flower color traits were determined by molecular identification. Among them, Okubo, Hakuho, Taiwan Crunchy Peach, Muyang Water Peach, Pink Flowered Eagle Beak Peach, and Yingchun were pink flowered peaches, while Yuanchun, Mantianhong, Feitao, and Honghua Yingzui Peach were red flowered peaches.

[0026] Step 1: Extract genomic DNA from leaves of 10 peach varieties to be tested.

[0027] Step 2: Two-step PCR amplification bands,

[0028] The PCR amplification primers Rr-F: GGAAGCTAATGAGGAGTATGCTAAGCATATGC, Rr-R: GGATCAACATGGCACTCGCCAACACATAC,

[0029] PCR reaction cycle conditions: Use 50 μL reaction system for PCR amplification, and refer to the DNA polymerase instructions for the ratio of each reactant. Two-step reaction: After 98°C pre-denaturation, 98°C for 20s, 65°C for 60s, and cycle for 30 rounds.

[0030] Step 3: Purify and recover the target band of about 760 bp. Digest the recovered band with Sfi I endonuclease (Takara, Code No. 1244S). The enzyme digestion system contains 1x Buffer M, 10 U Sfi I endonuclease and 1 μg of the purified recovered band. Digest at 50°C overnight and take 20 μL of the digestion product for agarose gel electrophoresis.

[0031] Step 4: Identification: Determine the target band of the R / r site distinguishing gene based on the electrophoresis results.

[0032] The test results showed that only 760bp fragments were detected after enzyme digestion of the amplified bands of Dajiubao, Baifeng, Taiwan Crunchy Peach, and Muyang Water Peach, indicating that these four varieties are RR sites; 500bp and 269bp fragments were detected after enzyme digestion of the amplified bands of Yuanchun, Mantianhong, Feitao, and Honghuayingzui Peach, indicating that they are rr sites; 760bp, 500bp, and 269bp fragments were produced after enzyme digestion of the amplified bands of Fenhuayingzui Peach and Yingchun, indicating that these two varieties are Rr sites. Figure 1As shown. Based on this, it was determined that Dajiubao, Baifeng, Taiwan Cuitao, and Muyang Shuimitao at the RR site were pink flowers; Yuanchun, Mantianhong, Feitao, and Honghua Yingzuitao at the rr site were red flowers; and Fenhua Yingzuitao and Yingchun at the Rr site were pink flowers. The molecular identification results were completely consistent with the flower color traits of the 10 peach varieties. Figure 1 M in the middle is a DNA marker, and lanes 1-10 are in order: Okubo, Hakuho, Taiwan Peach, Muyang Peach, Yuanchun, Mantianhong, Feitao, Honghua Yingzui Peach, Fenhua Yingzui Peach, Yingchun. After enzyme digestion, 760bp fragments can be seen in lanes 1-4; 500 and 269bp fragments can be seen in lanes 5-8; 760, 500 and 269bp fragments can be seen in lanes 9-10.

[0033] PCR amplified sequence (length 769 bp)

[0034]

[0035] [GGCCTCCA↓GGGCC]Sfi I recognition site

[0036]

[0037] Note: The underline indicates the design position of PCR primers, and the bold CAGGGCCTC indicates a 9bp insertion-deletion sequence variation. There is a 9bp CAGGGCCTC insertion at site r, but not at site R. The insertion of CAGGGCCTC forms a Sfi I endonuclease recognition site between the preceding and following sequences.

[0038] R site distinguishing gene nucleotide sequence: SEQ ID NO: 1

[0039]

[0040]

[0041] r site distinguishing gene nucleotide sequence: SEQ ID NO: 2

[0042]

[0043] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

[0044] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A molecular marker method for identifying different peach blossom colors, characterized in that: By identifying the R / r site distinguishing gene on the first chromosome of peach, the identification of peach plants with different flower colors is obtained, rr is red flower peach; RR or Rr is pink flower peach, the nucleotide sequence of the R site distinguishing gene is shown in SEQ ID NO: 1, and the nucleotide sequence of the r site distinguishing gene is shown in SEQ ID NO:

2. The specific operation steps are as follows: Step 1: Extract genomic DNA from the leaves to be tested. Step 2: Two-step PCR amplification bands, The PCR amplification primer Rr-F: GGAAGCTAATGAGGAGTATGCTAAGCATATGC, Rr-R:GGATCAACATGGCACTCGCCAACACATAC, PCR reaction cycle conditions: 98°C 20s, 65°C 60s, 30 cycles, Step 3: Purify the PCR amplified band, digest with restriction endonuclease Sfi I at 50°C overnight, and detect the digestion results by agarose electrophoresis. Step 4: Identification: Determine the target band of the R / r site distinguishing gene based on the electrophoresis results. The locus with only the 760 bp band was RR; The locus where the 500- and 269-bp bands were present was rr; The sites with 760 bp, 500 bp, and 269 bp at the same time are Rr. rr stands for red flower peach; RR or Rr stands for pink flower peach.

2. A molecular marker method for identifying different peach blossom colors as claimed in claim 1, characterized in that: Different peach blossom colors include red or pink.

Images