Method for generating nucleic acid sequence not existing in nature and nucleic acid sequence generated by the method

Abstract

The present application relates to a method for generating a nucleic acid sequence that does not exist in nature and the nucleic acid sequence generated therefrom. The generated nucleic acid sequence is used as an exogenous internal reference sequence for detecting a target nucleic acid by polymerase chain reaction (PCR), and the method includes the following steps performed by a computer: generating a first number of nucleic acid sequences, each of which includes N base pairs, where N is a positive integer; based on the expected characteristics of the nucleic acid sequence, the generated nucleic acid sequence is screened to obtain a screened nucleic acid sequence; the screened nucleic acid sequence is assembled into an exogenous internal reference sequence, the exogenous internal reference sequence includes a connected nucleic acid sequence obtained by connecting a primer and a probe, the primer includes a forward primer and a reverse primer, and at least one of the forward primer, the reverse primer and the probe is from the screened nucleic acid sequence; and based on the comparison of the connected nucleic acid sequence with a known nucleic acid sequence in nature, a nucleic acid sequence that does not exist in nature is obtained.

Description

Technical Field

[0001] The present application relates to the generation of nucleic acid sequences, and more specifically, to methods for generating nucleic acid sequences that do not exist in nature and the generated nucleic acid sequences. Background Art

[0002] In recent years, the demand for pathogen detection or molecular typing methods based on polymerase chain reaction (PCR) has continued to increase. In order to evaluate the effectiveness of the detection process, it is usually necessary to add standard quality control samples to help interpret the results and determine possible adverse factors such as contamination, inhibition of amplification reactions, or problems in the nucleic acid extraction process. However, quality control samples that are completely derived from the test object may introduce potential contamination and interference with the interpretation of results. Therefore, in order to avoid this problem, some measures can be taken to reduce the potential impact on the detection reaction, such as using synthetic nucleic acid controls or specifically designed quality control samples. This exogenous internal reference quality control product (i.e., exogenous internal reference quality control product) is an important tool for laboratory quality control, usually containing a sequence other than the detection target. It can be a simulated pseudovirus, bacteria, etc. used for quality control of nucleic acid extraction and amplification detection processes, which can be used for quality control of laboratory tests and reduce experimental quality control failures caused by factors such as clinical sample inhibition / interference.

[0003] At present, the quality control samples used in molecular diagnostic kits are mainly infectious virus serum, such as the standard quality control of hepatitis C virus prepared by Wang Doudounan et al.: the positive plasma is diluted with HCV RNA negative plasma to a content of about 300,000 copies / mL and then vacuum freeze-dried. However, the standard quality control samples prepared by this method are infectious and easily lead to the spread and transmission of the virus. The quality control samples prepared by Satoshi Inoue et al. for molecular diagnosis of Bacillus thuringiensis introduced two restriction sites, Eco RV and BamH I, into the quality control DNA to identify whether false positive amplification is caused by the contamination of the quality control. The preparation method mentioned in the paper published by Laetitia Ninove in 2011: the use of artificially synthesized quality control DNA (RNA) sequences containing T7 promoter primers, Not I restriction sites, detection primer (probe) sequences and viral gene sequences is used for exogenous quality control of various molecular detection methods (Laetitia Ninove, 2011). The common point between the latter two is that the prepared quality control samples are non-infectious, but they are mainly embedded with the nucleic acid sequence of the test object itself (or similar) and 1 to 2 common enzyme cleavage sites to distinguish false positives from true positives in the test results. Summary of the invention

[0004] Based on the above, the present application provides a method for generating a nucleic acid sequence that does not exist in nature, an electronic device, an electronic apparatus, a computer-readable storage medium and a computer program product, a nucleic acid sequence generated using the method, and a method for detecting a target nucleic acid in a sample by PCR.

[0005] According to one aspect of the present application, the present application provides a method for generating a nucleic acid sequence that does not exist in nature, wherein the generated nucleic acid sequence is used as an exogenous internal reference sequence for detecting a target nucleic acid by polymerase chain reaction (PCR), and the method includes the following steps performed by a computer: generating a first number of nucleic acid sequences, each of the nucleic acid sequences includes N base pairs, and N is a positive integer; based on the expected characteristics of the nucleic acid sequence, the generated nucleic acid sequence is screened to obtain the screened nucleic acid sequence; the screened nucleic acid sequence is assembled into an exogenous internal reference sequence, the exogenous internal reference sequence includes a connected nucleic acid sequence obtained by connecting a primer and a probe, the primer includes a forward primer and a reverse primer, and at least one of the forward primer, the reverse primer and the probe is from the screened nucleic acid sequence; and based on the comparison of the connected nucleic acid sequence with a known nucleic acid sequence in nature, the nucleic acid sequence that does not exist in nature is obtained, wherein the expected characteristics include one or more expected characteristics related to the melting temperature (Tm) of the nucleic acid sequence, the hairpin structure, the free energy deltaG required to form the nucleic acid sequence, the number of self-dimers, cross-dimers and specific bases.

[0006] According to another aspect of the present application, the present application provides an electronic device for generating a nucleic acid sequence that does not exist in nature, wherein the generated nucleic acid sequence is used as an exogenous internal reference sequence for detecting a target nucleic acid by polymerase chain reaction (PCR), the electronic device includes a memory, a processor, and a computer program stored on the memory, the processor executes the computer program to implement the steps of the method according to an embodiment of the present application.

[0007] According to another aspect of the present application, the present application provides an electronic device for generating a nucleic acid sequence that does not exist in nature, wherein the generated nucleic acid sequence is used as an exogenous internal reference sequence for detecting a target nucleic acid by polymerase chain reaction (PCR), and the electronic device comprises: a component for generating a first number of nucleic acid sequences, each of the nucleic acid sequences comprising N base pairs, where N is a positive integer; a component for screening the generated nucleic acid sequences based on the desired characteristics of the nucleic acid sequences to obtain the screened nucleic acid sequences; a component for assembling the screened nucleic acid sequences into an exogenous internal reference sequence, where the exogenous internal reference sequence The sequence comprises a ligated nucleic acid sequence obtained by ligating primers and probes, the primers comprising a forward primer and a reverse primer, and at least one of the forward primer, the reverse primer and the probe is from the screened nucleic acid sequence; and a component for obtaining the nucleic acid sequence that does not exist in nature based on comparison between the ligated nucleic acid sequence and a known nucleic acid sequence in nature, wherein the expected property comprises one or more expected properties related to the melting temperature (Tm) of the nucleic acid sequence, the hairpin structure, the free energy deltaG required to form the nucleic acid sequence, the number of self-dimers, cross-dimers and specific bases.

[0008] According to another aspect of the present application, the present application provides a computer-readable storage medium having computer instructions stored thereon, and the computer instructions, when executed by a processor, implement the steps of the method according to an embodiment of the present application.

[0009] According to another aspect of the present application, the present application provides a computer program product, including computer instructions, which implement the steps of the method according to the embodiment of the present application when executed by a processor.

[0010] According to yet another aspect of the present application, the present application provides a nucleic acid sequence generated by a method according to an embodiment of the present application.

[0011] According to another aspect of the present application, the present application provides a method for detecting a target nucleic acid in a sample by polymerase chain reaction (PCR), the method comprising using a nucleic acid sequence generated by a method according to an embodiment of the present application as an exogenous internal reference sequence.

[0012] The method for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application has at least the following advantages. In one aspect, since the nucleic acid sequence generated is not present in nature, the generated nucleic acid sequence can avoid cross contamination with other species sources, and can be quantitatively used as a quantitative standard. In another aspect, it is a data-driven design, so a large amount of nucleic acid sequence group data and experimental results can be used for analysis, so as to better guide the design of the exogenous internal reference sequence (i.e., the internal reference amplicon) for pathogen detection. For example, the method according to the embodiment of the present application can learn patterns and rules from massive data to help determine the design scheme of the exogenous internal reference sequence most suitable for pathogen detection. In another aspect, it has high accuracy and efficiency: the method according to the embodiment of the present application can analyze the specificity, stability and sensitivity of the designed exogenous internal reference sequence through algorithms and models, thereby improving the accuracy and efficiency of the design. For example, the method according to the embodiment of the present application can quickly perform large-scale data analysis and simulation to help screen the best design scheme. In another aspect, the method according to the embodiment of the present application can provide personalized design: it can be personalized according to factors such as experimental purpose, sample type, experimental conditions, etc., to provide customized exogenous internal reference sequence design schemes for pathogen detection for different experiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] The above and other purposes, features and advantages of the present application will become more apparent by describing the embodiments of the present application in more detail in conjunction with the accompanying drawings. The accompanying drawings are used to provide a further understanding of the embodiments of the present application and constitute a part of the specification. The accompanying drawings are used together with the embodiments of the present application to explain the present application, but do not constitute a limitation of the present application. In the accompanying drawings, unless otherwise explicitly indicated, the same reference numerals represent the same parts, steps or elements. In the accompanying drawings,

[0014] Figure 1 is a flow chart of a method for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application;

[0015] Figure 2 is a diagram showing the amplification results of different internal reference combinations and different concentrations of FAM (FluA), ROX (RSV) and HEX (FluB) targets according to the embodiments of the present application;

[0016] Figure 3 is a diagram showing an example electronic device for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application;

[0017] Figure 4 is a diagram showing an example electronic device for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application. DETAILED DESCRIPTION

[0018] The technical solution of the present application will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are part of the embodiments of the present application, rather than all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work belong to the protection scope of the present application.

[0019] In the description of the present application, it should be noted that the terms "center", "up", "down", "left", "right", "vertical", "horizontal", "inside", "outside" and the like indicate positions or positional relationships based on the positions or positional relationships shown in the accompanying drawings, which are only for the convenience of describing the present application and simplifying the description, and do not indicate or imply that the electronic device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as a limitation on the present application. In addition, the terms "first", "second", and "third" are used for descriptive purposes only and cannot be understood as indicating or implying relative importance. Similarly, similar words such as "one", "an" or "the" do not indicate a quantitative limitation, but rather indicate the presence of at least one. Similar words such as "include" or "comprise" mean that the elements or objects appearing before the word include the elements or objects listed after the word and their equivalents, without excluding other elements or objects. Similar words such as "connect" or "connected" are not limited to physical or mechanical connections, but may include electrical connections, whether direct or indirect.

[0020] In the description of this application, it should be noted that, unless otherwise clearly specified and limited, the terms "installed", "connected", and "connected" should be understood in a broad sense. For example, it can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be a direct connection, or it can be an indirect connection through an intermediate medium, or it can be the internal communication of two components. For ordinary technicians in this field, the specific meanings of the above terms in this application can be understood according to specific circumstances.

[0021] In addition, the technical features involved in the different embodiments of the present application described below can be combined with each other as long as they do not conflict with each other.

[0022] As described in the background art, the existing exogenous internal reference sequences for pathogen detection are mainly nucleic acid sequences existing in nature and nucleic acid sequences obtained by chimerizing the nucleic acid sequence of the detection object itself (or similar) and 1 to 2 common restriction sites in the quality control nucleic acid sequence or the generated nucleic acid sequence. However, these existing exogenous internal reference sequences for pathogen detection and their generation methods may have some disadvantages.

[0023] For example, since nucleic acids are invisible to the naked eye, any sequenced nucleic acid that exists in nature may land on any link of the consumables and reagents used in the manufacturing laboratory, and there may also be nucleic acids in the detection system in the detection environment of the reagent laboratory, thus failing to achieve the purpose of quality control. Sequences that exist in nature usually exist as biologically active substances and are usually obtained through sequencing technology, so the sequence selection space is limited to a certain extent.

[0024] Traditional quality control product design methods rely more on the experience and intuition of experimental researchers, and lack systematic analysis and comprehensive consideration of large amounts of data. For exogenous internal reference quality control products, due to the huge design space, traditional methods may not be able to fully consider all possible design options. When faced with large-scale genomic data and complex designs, their design advantages may not be fully utilized.

[0025] In view of the above, the present application proposes a method for generating a nucleic acid sequence that does not exist in nature and a nucleic acid sequence generated thereby, which will be described in detail below.

[0026] Figure 1 It is a flowchart of a method 100 for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application, wherein each step of the method 100 can be performed by a computer. For example, the computer is executed by various programming languages ​​such as Python. Python has some libraries specifically used for bioinformatics, such as Biopython, which can easily operate and analyze DNA sequences. Of course, other programming languages ​​are also feasible, such as C or C++. In the present application, the nucleic acid sequence can be a deoxyribonucleic acid (DNA) sequence or a ribonucleic acid (RNA) sequence. The generated nucleic acid sequence that does not exist in nature can be used as an exogenous internal reference sequence for detecting the target nucleic acid by polymerase chain reaction. Exemplarily, the generated nucleic acid sequence can be used for PCR experiment quantification, quality control, assembly molecular diagnosis, detection kit and pathogenic microorganism metagenomic detection (mNGS) result confirmation quality control one or more. More specifically, in quality control applications, it can be used for quality control PCR / reverse transcription PCR detection reaction or identification of true positive amplification and false positive amplification. In assembling molecular diagnosis / detection kits, it can be used for qualitative molecular diagnosis kits or quantitative molecular diagnosis kits. In the present application, detecting a target nucleic acid can be used to detect a target pathogen. Accordingly, the present application provides a method for detecting a target nucleic acid in a sample by polymerase chain reaction, the method comprising using a nucleic acid sequence generated according to an embodiment of the present application as an exogenous internal reference sequence. Exemplarily, the method can be used to detect a target pathogen in a sample.

[0027] like Figure 1As shown, the method 100 for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application can start from step S110. At step S110, a first number of nucleic acid sequences is generated, each of which includes N base pairs, where N is a positive integer. For example, N can be any number between 20-26. Of course, other numbers are also feasible, and the present application does not limit this. In one embodiment, the first number of nucleic acid sequences can be randomly generated, for example, using the Biopython library to randomly generate 100,000,000 24 base pair deoxyribonucleic acid sequences. In another embodiment, the first number of nucleic acid sequences may not be randomly generated, but generated based on predetermined rules. For example, a predetermined rule may be a predetermined percentage of the content of a specific base (e.g., base G) in a nucleic acid sequence. Of course, all possible combinations of N base pairs can also be generated, that is, the first number can be 4 N .

[0028] At step S120, the nucleic acid sequence generated at step S110 can be screened based on the desired characteristics of the nucleic acid sequence to obtain the screened nucleic acid sequence. Exemplarily, the desired characteristics may include one or more desired characteristics related to the melting temperature (Tm) of the nucleic acid sequence, the hairpin structure, the free energy deltaG required to form the nucleic acid sequence, the self-dimer, the cross-dimer, and the number of specific bases. Of course, other desired characteristics for screening the nucleic acid sequence generated at step S110 can also be set as needed, and this is not limited to this by the present invention.

[0029] In one embodiment, screening the generated nucleic acid sequences based on the desired properties of the nucleic acid sequences may include the following steps:

[0030] (a) calculating the Tm of each nucleic acid sequence and performing at least one of the following:

[0031] Screen out nucleic acid sequences with Tm in the first temperature range as primer nucleic acid sequences, or

[0032] Screen out nucleic acid sequences with Tm in the second temperature range as probe nucleic acid sequences,

[0033] The first temperature range is 50°C-65°C, including 50°C and 65°C, and the second temperature range is (50+X)°C-(65+Y)°C, including (50+X)°C and (65+Y)°C, wherein X and Y are each independently any number between 8 and 12, including 8 and 12. In one embodiment, the first temperature range is 57°C-58°C, including 57°C and 58°C; the second temperature range is 67°C-70°C, including 67°C and 70°C.

[0034] (b) Screen out nucleic acid sequences that do not have hairpin structures.

[0035] (c) Calculate the deltaG of each nucleic acid sequence and select nucleic acid sequences with deltaG>2 kj / mol.

[0036] (d) Screening out nucleic acid sequences that do not have self-dimers.

[0037] (e) screening out nucleic acid sequences whose GC content is within a predetermined GC range and whose number of Gs ≤ number of Cs, wherein the predetermined GC range is 40%-60%. In one embodiment, the predetermined GC range is 45%-56%, including 45% and 56%.

[0038] (f) selecting at least one nucleic acid sequence group, wherein each nucleic acid sequence group in the at least one nucleic acid sequence group includes a predetermined number of nucleic acid sequences that do not form cross-dimers with each other.

[0039] In one embodiment, the predetermined number can be 2 or 3. When the predetermined number is 2, each nucleic acid sequence group in the at least one nucleic acid sequence group includes 2 primer nucleic acid sequences, one of which is used as a forward primer and the other as a reverse primer. When the predetermined number is 3, each nucleic acid sequence group in the at least one nucleic acid sequence group includes 2 primer nucleic acid sequences and 1 probe nucleic acid sequence, one of which is used as a forward primer and the other as a reverse primer. In this example (i.e., screening out the example of at least one nucleic acid sequence group in which each nucleic acid sequence group includes 3 nucleic acid sequences), screening out at least one nucleic acid sequence group may include: performing three-by-three pairs of nucleic acid sequences, filtering out the combination of cross dimers, obtaining a second number of nucleic acid sequences; and screening out the at least one nucleic acid sequence group from the second number of nucleic acid sequences. Screening a nucleic acid sequence group including 3 nucleic acid sequences in this way can quickly screen out a nucleic acid sequence group including 3 nucleic acid sequences that do not form cross dimers with each other, thereby improving the screening speed.

[0040] It should be understood that, although the predetermined number is 2 or 3 in the above step (f), this is only an example, not a limitation. In the present application, the predetermined number may also be other values, such as 5. In this case, each nucleic acid sequence group in at least one nucleic acid sequence group includes 2 primer nucleic acid sequences and 3 probe nucleic acid sequences. In addition, please note that although the above steps use sequence numbers (a)-(f), the present application does not limit the execution order of steps (a)-(f). However, although the present application does not limit the execution order of steps (a)-(f), it is found through experiments that sequential screening according to the above steps (a)-(f) can be faster than screening in other orders. In addition, the parameters involved in the above steps (for example, the screening parameter 2kj / mol involved in screening out the nucleic acid sequence of deltaG>2kj / mol) are only examples, not limitations. These parameters can be appropriately set according to practical needs, and the present application does not limit this.

[0041] return Figure 1 , at step S130, the screened nucleic acid sequence is assembled into an exogenous internal reference sequence, which includes the connected nucleic acid sequence obtained by connecting the primer and the probe. In the present application, the primer may include a forward primer and a reverse primer. In one embodiment, the connection may be a direct connection, that is, directly connected in the order of forward primer-probe-reverse primer. In another embodiment, the connection may be connected in the order of forward primer-first random nucleic acid sequence-probe-second random nucleic acid sequence-reverse primer. It should be understood that in the above connection, the reverse primer nucleic acid sequence (or predetermined reverse primer nucleic acid sequence) obtained by the above step S120 needs to be first subjected to base complementary pairing, and then connected, which is well known to those skilled in the art, and will not be repeated here for the sake of brevity.

[0042] In the present application, the first random nucleic acid sequence and the second random nucleic acid sequence can be the same or different random nucleic acid sequences. The first random nucleic acid sequence can include M1 base pairs, and the second random nucleic acid sequence can include M2 ​​base pairs. M1 and M2 can be any number in 1-20 independently of each other. More specifically, M1 and M2 can be any number in 1-10 independently of each other. M1 and M2 can be the same or different. Compared with directly connecting primers and probes, connecting by filling random nucleic acid sequences between primers and probes can form random flanking sequences on both sides of the amplicon.

[0043] In the present application, at least one of the forward primer, reverse primer and probe is from the nucleic acid sequence after screening in the above-mentioned step S120, and the rest of the forward primer, reverse primer and probe can be a predetermined nucleic acid sequence. The predetermined nucleic acid sequence can be a nucleic acid sequence generated by an existing or future method, and the present application is not limited to this. Exemplarily, at least one of the forward primer, reverse primer and probe can be from the nucleic acid sequence after screening in the above-mentioned steps (a)-(f). In one embodiment, both the forward primer and the reverse primer can be from the nucleic acid sequence after screening in the above-mentioned step S120. For example, the forward primer and the reverse primer can correspond to each group in at least one nucleic acid sequence group after screening in the above-mentioned steps (a)-(f) (i.e., the case where the predetermined number in the above-mentioned step (f) is 2). In this case, for each group in at least one nucleic acid sequence group after screening by the above steps (a)-(f), the sequence of forward primer-first random nucleic acid sequence-probe-second random nucleic acid sequence-reverse primer is connected to obtain the nucleic acid sequence after connection, wherein the probe is a predetermined probe nucleic acid sequence and the forward primer, the predetermined probe and the reverse primer do not form cross dimers with each other. In another embodiment, the forward primer, the probe and the reverse primer can all be from the nucleic acid sequence after screening by the above step S120. For example, the forward primer, the probe and the reverse primer can correspond to each group in at least one nucleic acid sequence group after screening by the above steps (a)-(f) (that is, the case where the predetermined number in the above step (f) is 3). In this case, similar to the above, for each group in at least one nucleic acid sequence group after screening by the above steps (a)-(f), the sequence of forward primer-first random nucleic acid sequence-probe-second random nucleic acid sequence-reverse primer is connected to obtain the nucleic acid sequence after connection. The first random nucleic acid sequence and the second random nucleic acid sequence have been described in detail above, and will not be repeated here for brevity.

[0044] It should be understood that, although the above-mentioned embodiment is described with the nucleic acid sequence after screening as forward primer and reverse primer (that is, the situation that the predetermined number in the above-mentioned step (f) is 2), or as forward primer, probe and reverse primer (that is, the situation that the predetermined number in the above-mentioned step (f) is 3), this is merely an example, not a limitation. In practice, it can be determined as needed which one or more of the forward primer, probe and reverse primer need to be generated and screened by the above-mentioned steps S110 and S120. For example, it can be that one of the forward primer, probe and reverse primer (for example, forward primer, or probe, or reverse primer) is the nucleic acid sequence after being generated and screened by the above-mentioned steps S110 and S120. In addition, although in the above-mentioned embodiment, it is described with 1 probe, this is merely an example, not a limitation. In the present application, the number of probes can include more than one situation. In this case, the connection can be performed in the following manner: forward primer—first random sequence—probe 1—second random sequence—probe 2—…—N-1th random sequence—probe N—Nth random sequence—reverse primer, and in this example, the forward primer, reverse primer, and one or more of the multiple probes (for example, part or all of the probes) used for the connection can be nucleic acid sequences generated and screened by the above-mentioned steps S110 and S120.

[0045] Return again Figure 1At step S140, based on the comparison of the nucleic acid sequence connected at step S130 with the known nucleic acid sequence in nature, a nucleic acid sequence that does not exist in nature is obtained. Sequences existing in nature are generally derived from organisms and are usually obtained through sequencing technology. These sequences are stored in some international databases, for example, the nr / nt library, Genome library, reseq and other nucleic acid sequence libraries searched on the website of the "National Center for Biotechnology Information". Exemplarily, the nucleic acid sequence existing in nature can be obtained by searching the disclosed nucleic acid sequence library using a search tool based on the local alignment algorithm (BLAST). Then, the connected nucleic acid sequence can be searched in these disclosed nucleic acid sequence libraries using the k-mer search algorithm to obtain the nucleic acid sequence that does not exist in nature. In one embodiment, a nucleic acid sequence that is different from the known nucleic acid sequence in nature can be used as the obtained nucleic acid sequence that does not exist in nature. In this case, one or more nucleic acid sequences that do not exist in nature can be obtained. In another embodiment, the nucleic acid sequence with the lowest similarity to the known nucleic acid sequence in nature can be used as the obtained nucleic acid sequence that does not exist in nature. In this case, a nucleic acid sequence with the lowest similarity to a nucleic acid sequence in nature among the nucleic acid sequences obtained in the above step S130 can be obtained. Since the obtained nucleic acid sequence is the nucleic acid sequence with the lowest similarity to a known nucleic acid sequence in nature among at least one nucleic acid sequence obtained in the above step S130, the above-mentioned shortcomings related to nucleic acid sequences existing in nature can be overcome to the greatest extent (for example, nucleic acids may fall into any link of consumables and reagents used in the manufacturing laboratory, and nucleic acids may also fall into the detection system in the detection environment of the reagent laboratory, thereby failing to achieve the purpose of quality control).

[0046] In the above, this application combines Figure 1A method for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application is described. Further, in the present application, the method according to an embodiment of the present application can also be optimized based on experimental data and feedback information related to generating a nucleic acid sequence that does not exist in nature and applying the generated nucleic acid sequence (for example, using the generated nucleic acid sequence for PCR experimental quantification, etc.). Exemplarily, optimizing the method according to an embodiment of the present application may include at least one of the following: adjusting the first quantity in the above step S110 and / or adjusting the parameters involved in the steps included in the method according to an embodiment of the present application. Exemplarily, the first temperature range for screening the primer nucleic acid sequence and / or the second temperature range for screening the probe nucleic acid sequence in the above step (a) can be adjusted based on the Tm temperature of the primers and / or probes used to form the obtained nucleic acid sequence that does not exist in nature.

[0047] So far, this application has been combined with Figure 1 The method for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application is described. The method for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application has at least the following advantages. In one aspect, since the nucleic acid sequence that does not exist in nature is generated, the generated nucleic acid sequence can avoid cross contamination with other species sources, and can be quantitatively used as a quantitative standard. In another aspect, it is a data-driven design, so a large amount of nucleic acid sequence group data and experimental results can be used for analysis, so as to better guide the design of the exogenous internal reference sequence (i.e., the internal reference amplicon) for pathogen detection. For example, the method according to the embodiment of the present application can learn patterns and rules from massive data to help determine the design scheme of the exogenous internal reference sequence most suitable for pathogen detection. In another aspect, it has high accuracy and efficiency: the method according to the embodiment of the present application can analyze the specificity, stability and sensitivity of the designed exogenous internal reference sequence through algorithms and models, thereby improving the accuracy and efficiency of the design. For example, the method according to the embodiment of the present application can quickly perform large-scale data analysis and simulation to help screen the best design scheme. In another aspect, the method according to the embodiment of the present application can provide a personalized design: it can be personalized according to factors such as the purpose of the experiment, the type of sample, and the experimental conditions (for example, the desired characteristics of the nucleic acid sequence randomly generated by the computer can be designed to screen the sequence), and customized exogenous internal reference sequence design schemes for pathogen detection can be provided for different experiments. In another aspect, automated optimization can be achieved, and the method according to the embodiment of the present application can be combined with experimental data and feedback information to automatically optimize the exogenous internal reference sequence design scheme. Through continuous learning and adjustment, a design scheme that better meets actual needs can be provided.

[0048] In the above, this application combines Figure 1The method and use thereof of generating a nucleotide sequence that does not exist in nature according to an embodiment of the present application are described. Hereinafter, the present application will provide a specific example of a reagent experiment for generating a nucleotide sequence that does not exist in nature according to an embodiment of the present application and using the nucleotide sequence generated according to an embodiment of the present application. It should be understood that the specific example of the generating nucleotide sequence and the related reagent experiment is only for those skilled in the art to better understand the present application, rather than a limitation of the present application.

[0049] Example 1: Preparation of exogenous internal reference sequence nucleic acid quality control

[0050] Generate random primers and their probe sequences:

[0051] Generate using python code: Path: PUBLIC / primer random.

[0052] Divided into two codes:

[0053] Step 1: Generate random nucleic acid sequences and filter 1 billion times, filtering criteria;

[0054] (i) There are 4 to 6 AGCTs each;

[0055] (ii) filtering hairpin structures or self-dimers, deltaG>2 kJ / mol;

[0056] (iii) screening out sequences with primer Tm between 57°C and 58°C and probe Tm between 67°C and 70°C;

[0057] Step 2: Pair the sequences obtained in step 1 in groups of three, and filter out the combinations of cross-dimers. From the sequences that have filtered out the combinations of cross-dimers, select the sequences with a GC content between 45 and 56 and the number of Gs ≤ the number of Cs. One group is:

[0058] Forward primer F: ACAACCCTCACTACGCGATTATC (SEQ ID NO: 1);

[0059] Random spacer sequence 1: actcggcgcc (SEQ ID NO: 2)

[0060] Reverse primer R: ACCAGAACAGGAGAGGCAATATCC (SEQ ID NO: 3);

[0061] Random interval sequence 2: cgc

[0062] Probe P: CCACACTCTCACAACACTCGCAGCA (SEQ ID NO: 4)

[0063] Generate a random template sequence: connect in the manner of forward primer F-random spacer sequence 2-probe-random spacer sequence 1-reverse primer R, thereby forming the following connected nucleic acid sequence:

[0064] ACAACCCTCACTACGCGATTATCcgcCCACACTCTCACAACACTCGC AGCAactcggcgccGGATATTGCCTCTCCTGTTCTGGT(SEQ ID NO:5)

[0065] The connected nucleic acid sequence is compared with a known nucleic acid sequence in nature to obtain a nucleic acid sequence that does not exist in nature. In this example, the above-mentioned connected nucleic acid sequence is different from the known nucleic acid sequence in nature, and therefore is a nucleic acid sequence that does not exist in nature obtained according to the method for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application.

[0066] It should be understood that although in the above Example 1, the screened primer nucleic acid sequences ACAACCCTCACTACGCGATTATC (SEQ ID NO: 1) and ACCAGAACAGGAGAGGCAATATCC (SEQ ID NO: 3) are used as forward primers and reverse primers, respectively, this is merely an example and not a limitation, and ACAACCCTCACTACGCGATTATC (SEQ ID NO: 1) and ACCAGAACAGGAGAGGCAATATCC (SEQ ID NO: 3) may also be used as reverse primers and forward primers, respectively.

[0067] Example 2: Using the generated exogenous internal reference sequence for detection

[0068] This experiment is to verify that the generated exogenous internal reference sequence (i.e., primer probe) and its quality control gap sequence are the best combination. In this experiment, the nucleic acid sequence obtained by the above example 1 is named IC, and 2 sets of internal reference primer probes are randomly selected from the randomly generated nucleic acid sequence (i.e., the random nucleic acid sequence generated in the above step 1), named IC-1 and IC-2, as shown below.

[0069] IC:ACAACCCTCACTACGCGATTATCcgcCCACACTCTCACAACACTC GCAGCAactcggcgccGGATATTGCCTCTCCTGTTCTGGT (SEQ ID NO: 5)

[0070] IC-1:

[0071] TCGAATAGGGATAACAAGGATCTcgcCTCACTGTAGCCGTAGTGGT CCCGAactcggcgccAATCATGACCGGTCCCAGTGGGT (SEQ ID NO: 6)

[0072] IC-2:

[0073] TTCTCCCGGACTAGTCGGAAACGcgcAAGGCGATGTTACGTAGAAT AGCGGactcggcgccGATGGGTCTTGAACGCCGCTCTT(SEQ ID NO:7)

[0074] At the same time, FAM (FluA), ROX (RSV) and HEX (FluB) primer probes were added to verify the performance of the designed exogenous internal reference sequence in the PCR amplification experiment. The specific verification steps are as follows:

[0075] 1. Reagent preparation

[0076] By synthesizing IC / IC-1 / IC-2, the final concentration of all primers and probes is 0.5 μM. In order to reduce the differences between different internal reference primers, the reagents other than the internal reference primers, probes and quality control products are first configured into a mix, and then the corresponding internal reference primers and probes are added respectively, mixed and packaged.

[0077] (1) The PCR reaction system is as follows:

[0078]

[0079] *Refers to IC, IC-1, IC-2

[0080] 2. Sample addition and settings:

[0081] In order to fully verify the differences in amplification of different targets by internal reference primers, three targets of common respiratory pathogens, FluA, FluB and RSV, were added for amplification verification. The copy number of all quality control products was set to 1×10 3 copies / mL.

[0082] 1) Set up a no template control (NTC) to verify whether the internal reference primer probe has non-specific amplification in a target-free system.

[0083] 2) Set a low concentration of 1×10 3 The target is amplified at 100 copies / mL to verify whether the internal reference primer probe has competitive interference with the low concentration target detection target.

[0084] 3) Higher and high concentrations of 1×10 4 copies / mL, 1×10 5 The target was amplified at 100 copies / mL of the target to verify whether the internal reference target would be interfered by the target in the high concentration sample.

[0085] 3. Setting of reaction program

[0086] The following reaction program was set up in Bio-rad CFX96

[0087]

[0088] The amplification results of different internal reference combinations and different concentrations of FAM (FluA), ROX (RSV) and HEX (FluB) targets are shown in Figure 2. Figure 2 shown.

[0089] 4. Verification conclusion:

[0090] 1) By Figure 2 The results of sequence numbers 1, 2, 3, 4, and 5 show that the IC group has a smaller Ct value and a higher fluorescence value at the same copy number compared with the IC-1 / IC-2 group, and has a smaller effect on other targets FAM (FluA), ROX (RSV), and its HEX (FluB);

[0091] 2) By Figure 2 The data in sequence number 1 show that the NTC results verify that the three sets of internal reference primer probes screened have no non-specific amplification in the target-free system;

[0092] 3) Pass Figure 2 The data in sequence number 2 show that the Ct values ​​and fluorescence values ​​of the amplified targets FAM (FluA), ROX (RSV) and HEX (FluB) were not affected by the low concentration of 1×103 copies / mL target, verifying that the primer probe of the internal reference has no competitive interference with the low concentration target detection target;

[0093] 4) Pass Figure 2 The data of sequence numbers 3 and 4 show that the Ct value and fluorescence value of the internal reference target were not affected in the amplification targets of the higher and high concentrations of 1×104 copies / mL and 1×105 copies / mL target, verifying that the internal reference target will not be interfered by the competition of the target in the high concentration samples.

[0094] In the above, this application combines Figure 1 and Figure 2Described is a method for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application, a specific example of using the method to generate a nucleic acid sequence that does not exist in nature, and a specific example of a related reagent experiment. It can be seen from the above disclosure that the nucleic acid sequence generated by the method according to an embodiment of the present application (for example, the nucleic acid sequence IC in the above example 2) is compared to the nucleic acid sequence formed by using any sequence selected from the computer-generated nucleic acid sequence as a primer and a probe (for example, the nucleic acid sequences IC-1 and IC-2 in the above example 2), and has better performance in the reagent experiment (for example, at the same copy number, the Ct value is smaller, the fluorescence value is higher, and the impact on other targets FAM (FluA), ROX (RSV) and its HEX (FluB) is smaller, etc.).

[0095] In the following, this application will be combined with Figure 3 and Figure 4 An electronic device and an electronic apparatus for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application are described.

[0096] Figure 3 is a diagram showing an example electronic device 300 for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application. Figure 3 As shown, the electronic device for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application may include a memory 310 and a processor 320. The processor 320 may be communicatively connected to the memory 310 and may be configured to execute the method for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application (e.g., Figure 1 Method 100 shown).

[0097] Figure 4 4 is a diagram showing an example electronic device 400 for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application. Figure 4 As shown, the electronic device 400 for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application can be expressed in the form of a general-purpose computing device, which may include but is not limited to: one or more processors or processing units 411, a memory 412, and a bus 413 connecting different system components (including the processor 411 and the memory 412).

[0098] Bus 413 represents one or more of several types of bus structures, including a memory bus or memory controller, a peripheral bus, an accelerated graphics port, a processor, or a local bus using any of a variety of bus structures. For example, these architectures include but are not limited to Industry Standard Architecture (ISA) bus, Micro Channel Architecture (MAC) bus, Enhanced ISA bus, Video Electronics Standards Association (VESA) local bus, and Peripheral Component Interconnect (PCI) bus.

[0099] The electronic device 400 for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application may typically include a variety of computer system readable media. These media may be any available media that can be accessed by the electronic device 400 for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application, including volatile and non-volatile media, removable and non-removable media.

[0100] The memory 412 may include a computer system readable medium in the form of a volatile memory, such as a random access memory (RAM) 412_1 and / or a cache memory 412_2. The electronic device 400 for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application may further include other removable / non-removable, volatile / non-volatile computer system storage media. By way of example only, the storage system 412_3 may be used to read and write non-removable, non-volatile magnetic media ( Figure 4 not shown, commonly referred to as a "hard drive"). Although Figure 4 413. Although not shown, a disk drive for reading and writing to a removable non-volatile disk (e.g., a "floppy disk") and an optical disk drive for reading and writing to a removable non-volatile optical disk (e.g., a CD-ROM, a DVD-ROM, or other optical media) may be provided. In these cases, each drive may be connected to bus 413 via one or more data medium interfaces. Memory 412 may include at least one program product having a set (e.g., at least one) of program modules that are configured to perform the functions of various embodiments of the present invention.

[0101] A program / utility 412_4 having a set (at least one) of program modules 412_4_1 may be stored, for example, in a memory 412, such program modules 412_4_1 including but not limited to an operating system, one or more application programs, other program modules, and program data, each of which or some combination may include an implementation of a network environment. The program modules 412_4_1 typically perform the functions and / or methods of the embodiments described herein.

[0102] The electronic device 400 for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application may also communicate with one or more external devices 430 (e.g., keyboard, pointing device, display 420, etc.), and may also communicate with one or more devices that enable a user to interact with the electronic device 400 for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application, and / or communicate with any device (e.g., network card, modem, etc.) that enables the electronic device 400 for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application to communicate with one or more other computing devices. Such communication may be performed through an input / output (I / O) interface 414. In addition, the electronic device 400 for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application may also communicate with one or more networks (e.g., local area network (LAN), wide area network (WAN) and / or public network, such as the Internet) through a network adapter 415. As shown in the figure, the network adapter 415 communicates with other modules of the electronic device 400 for generating a nucleic acid sequence that does not exist in nature according to an embodiment of the present application through a bus 413. It should be understood that although not shown in the figures, other hardware and / or software modules may be used in conjunction with the electronic device 400 for generating nucleic acid sequences that do not exist in nature according to an embodiment of the present application, including but not limited to: microcode, device drivers, redundant processing units, external disk drive arrays, RAID systems, tape drives, and data backup storage systems, etc.

[0103] It should be understood that Figure 4 The electronic device 400 for generating a nucleic acid sequence that does not exist in nature is merely an example and should not impose any limitation on the functions and scope of use of the embodiments of the present invention.

[0104] In addition, the present application also provides an electronic device for generating a nucleic acid sequence that does not exist in nature, wherein the generated nucleic acid sequence is used as an exogenous internal reference sequence for detecting a target nucleic acid by polymerase chain reaction, and the electronic device includes: a component for generating a first number of nucleic acid sequences, each of the nucleic acid sequences includes N base pairs, and N is a positive integer; a component for screening the generated nucleic acid sequences based on the expected characteristics of the nucleic acid sequences to obtain the screened nucleic acid sequences; a component for assembling the screened nucleic acid sequences into an exogenous internal reference sequence, wherein the exogenous internal reference sequence includes a connected nucleic acid sequence obtained by connecting primers and probes, the primers include forward primers and reverse primers, and at least one of the forward primer, the reverse primer and the probe is from the screened nucleic acid sequence; and a component for obtaining the nucleic acid sequence that does not exist in nature based on comparing the connected nucleic acid sequence with a known nucleic acid sequence in nature, wherein the expected characteristics include one or more expected characteristics related to the melting temperature (Tm) of the nucleic acid sequence, the hairpin structure, the free energy deltaG required to form the nucleic acid sequence, self-dimers, cross-dimers, and the number of specific bases. In addition, the electronic device can also be used to implement the method according to the embodiment of the present application (for example, Figure 1 Method 100 shown).

[0105] In addition, the present application also provides a computer-readable storage medium on which computer instructions are stored. When the computer instructions are executed by a processor, the method according to the embodiment of the present application (for example, Figure 1 Method 100 shown).

[0106] In addition, the present application also provides a computer program product, including computer instructions, which, when executed by a processor, implement the method according to the embodiment of the present application (for example, Figure 1 Method 100 shown).

[0107] So far, the present application has described in conjunction with the accompanying drawings a method for generating a nucleic acid sequence that does not exist in nature, an electronic device, an electronic apparatus, a non-transitory computer-readable storage medium, and a computer program according to an embodiment of the present application, as well as a nucleic acid sequence generated according to the method and a method for using the generated nucleic acid sequence as an exogenous internal reference sequence to detect a target nucleic acid in a sample by polymerase chain reaction.

[0108] It should be noted that the above description is only some embodiments of the present application and an explanation of the technical principles used. Those skilled in the art should understand that the scope of disclosure involved in the present application is not limited to the technical solutions formed by a specific combination of the above technical features, but should also cover other technical solutions formed by any combination of the above technical features or their equivalent features without departing from the above disclosed concept. For example, the above features are replaced with the technical features with similar functions disclosed in this application (but not limited to) by each other.

[0109] In addition, although each operation is described in a specific order, this should not be construed as requiring these operations to be performed in the specific order shown or to be performed in a sequential order. Under certain circumstances, multitasking and parallel processing may be advantageous. Similarly, although some specific implementation details are included in the above discussion, these should not be construed as limiting the scope of the application. Some features described in the context of a separate embodiment can also be implemented in a single embodiment in combination. On the contrary, the various features described in the context of a single embodiment can also be implemented in multiple embodiments individually or in any suitable sub-combination mode.

[0110] Although the subject matter has been described in language specific to structural features and / or methodological logical actions, it should be understood that the subject matter defined in the appended claims is not necessarily limited to the specific features or actions described above. On the contrary, the specific features and actions described above are merely example forms of implementing the claims.

Claims

1. A method for generating a nucleic acid sequence that does not exist in nature, wherein the generated nucleic acid sequence is used to detect an exogenous internal reference sequence of a target nucleic acid by polymerase chain reaction (PCR), the method comprising the following steps performed by a computer: Generate a first number of nucleic acid sequences, each of the nucleic acid sequences comprising N base pairs, where N is a positive integer; Screening the generated nucleic acid sequence to obtain a screened nucleic acid sequence; Assembling the screened nucleic acid sequence into an exogenous internal reference sequence, wherein the exogenous internal reference sequence comprises a connected nucleic acid sequence obtained by connecting a primer and a probe, wherein the primer comprises a forward primer and a reverse primer, and at least one of the forward primer, the reverse primer and the probe comprises the screened nucleic acid sequence; and Based on the comparison between the connected nucleic acid sequence and the known nucleic acid sequence in nature, the nucleic acid sequence that does not exist in nature is obtained, The screening of the generated nucleic acid sequence comprises: (a) calculating the Tm of each nucleic acid sequence and performing at least one of the following: Screen out nucleic acid sequences with Tm in the first temperature range as primer nucleic acid sequences, or Screen out nucleic acid sequences with Tm in the second temperature range as probe nucleic acid sequences, wherein the first temperature range is 50°C-65°C, including 50°C and 65°C, and the second temperature range is (50+X)°C-(65+Y)°C, including (50+X)°C and (65+Y)°C, wherein X and Y are each independently any number between 8 and 12, including 8 and 12; (b) screening out nucleic acid sequences without hairpin structures in the nucleic acid sequences; (c) Calculate the deltaG of each nucleic acid sequence and select nucleic acid sequences with deltaG>2 kj / mol; (d) screening out nucleic acid sequences without self-dimers among the nucleic acid sequences; (e) screening out nucleic acid sequences whose GC content is within a predetermined GC range and whose number of Gs is ≤ number of Cs, wherein the predetermined GC range is 40%-60%; (f) selecting at least one nucleic acid sequence group, each of the at least one nucleic acid sequence group comprising a predetermined number of nucleic acid sequences that do not form cross-dimers with each other; There is no restriction on the order in which steps (a)-(f) are performed.

2. The method according to claim 1, wherein the detection target nucleic acid is used to detect a target pathogen. 3 . The method according to claim 1 , wherein at least two or all three of the forward primer, the reverse primer and the probe comprise the screened nucleic acid sequence.

4. The method according to any one of claims 1 to 3, wherein the predetermined number is 2 or 3, and wherein connecting the primer and the probe to obtain a connected nucleic acid sequence comprises: When the predetermined number is 2, each nucleic acid sequence group in the at least one nucleic acid sequence group includes 2 primer nucleic acid sequences, one of which is used as a forward primer and the other is used as a reverse primer, and for each nucleic acid sequence group in the at least one nucleic acid sequence group: connection is performed in the order of a forward primer, a first random nucleic acid sequence, a probe, a second random nucleic acid sequence, and a reverse primer, wherein the first random nucleic acid sequence includes M1 base pairs, the second random nucleic acid sequence includes M2 base pairs, and the probe is a predetermined probe; as well as When the predetermined number is 3, each nucleic acid sequence group in the at least one nucleic acid sequence group includes 2 primer nucleic acid sequences and 1 probe nucleic acid sequence, wherein one of the 2 primer nucleic acid sequences serves as a forward primer and the other serves as a reverse primer; and for each nucleic acid sequence group in the at least one nucleic acid sequence group: connecting in the order of a forward primer, a first random nucleic acid sequence, a probe, a second random nucleic acid sequence, and a reverse primer, wherein the first random nucleic acid sequence includes M1 base pairs, and the second random nucleic acid sequence includes M2 base pairs, Wherein M1 and M2 are each independently any number from 1 to 20.

5. The method according to claim 4, wherein the predetermined number is 3, and wherein step (f): screening out at least one nucleic acid sequence group comprises: pairing the nucleic acid sequences in groups of three and filtering out combinations of cross-dimers to obtain a second number of nucleic acid sequences; as well as The at least one nucleic acid sequence group is selected from the second number of nucleic acid sequences.

6. The method according to claim 4, wherein the first temperature range is 57°C-58°C, including 57°C and 58°C; the second temperature range is 67°C-70°C, including 67°C and 70°C; the predetermined GC range is 45%-56%, including 45% and 56%; and M1 and M2 are each independently any number from 1 to 10.

7. The method according to claim 1, wherein all steps are executed by the computer through the programming language Python, the first number of nucleic acid sequences are randomly generated, N is any number between 20-26, and the nucleic acid sequence is a deoxyribonucleic acid (DNA) sequence or a ribonucleic acid (RNA) sequence.

8. The method according to claim 1, wherein the generated nucleic acid sequence is used for one or more of PCR experiment quantification, quality control, assembly of molecular diagnosis, detection kit and pathogenic microorganism metagenomic detection (mNGS) result confirmation quality control.

9. The method of claim 1, wherein at least one of the following is adjusted based on experimental data and feedback information related to generating the non-natural nucleic acid sequence and applying the generated nucleic acid sequence: the first quantity, and The method comprises steps involving parameters.

10. A nucleic acid sequence generated by the method according to any one of claims 1 to 9.

11. The nucleic acid sequence according to claim 10, wherein the nucleic acid sequence after screening comprises one or both of the following primer nucleic acid sequences: ACAACCCTCACTACGCGATTATC(SEQ ID NO:1), or ACCAGAACAGGAGAGGCAATATCC (SEQ ID NO: 3), or The nucleic acid sequence after the screening comprises the following probe nucleic acid sequence: CCACACTCTCACAACACTCGCAGCA (SEQ ID NO: 4).

12. The nucleic acid sequence according to claim 11, wherein the nucleic acid sequence comprises the following nucleic acid sequence: ACAACCCTCACTACGCGATTATCcgcCCACACTCTCACAACACTCGC AGCAactcggcgccGGATATTGCCTCTCCTGTTCTGGT (SEQ ID NO: 5).

13. A method for detecting a target nucleic acid in a sample by polymerase chain reaction (PCR), the method comprising using the nucleic acid sequence according to any one of claims 10 to 12 as an exogenous internal reference sequence. The method according to claim 13 , wherein the method is used to detect a target pathogen in a sample.

15. An electronic device for generating a nucleic acid sequence that does not exist in nature, wherein the generated nucleic acid sequence is used as an exogenous internal reference sequence for detecting a target nucleic acid by polymerase chain reaction (PCR), the electronic device comprising: a memory, a processor and a computer program stored in the memory, The processor executes the computer program to implement the steps of the method of any one of claims 1-9.

16. An electronic device for generating a nucleic acid sequence that does not exist in nature, wherein the generated nucleic acid sequence is used to detect an exogenous internal reference sequence of a target nucleic acid by polymerase chain reaction (PCR), the electronic device comprising: means for generating a first number of nucleic acid sequences, each of the nucleic acid sequences comprising N base pairs, wherein N is a positive integer; A component for screening the generated nucleic acid sequence to obtain the screened nucleic acid sequence; A component for assembling the screened nucleic acid sequence into an exogenous internal reference sequence, wherein the exogenous internal reference sequence comprises a connected nucleic acid sequence obtained by connecting a primer and a probe, wherein the primer comprises a forward primer and a reverse primer, and at least one of the forward primer, the reverse primer and the probe comprises the screened nucleic acid sequence; and A component for obtaining the nucleic acid sequence that does not exist in nature based on the comparison of the connected nucleic acid sequence with a known nucleic acid sequence in nature, The component for screening the generated nucleic acid sequence and obtaining the screened nucleic acid sequence performs the following steps to screen the generated nucleic acid sequence: (a) calculating the Tm of each nucleic acid sequence and performing at least one of the following: Screen out nucleic acid sequences with Tm in the first temperature range as primer nucleic acid sequences, or Screen out nucleic acid sequences with Tm in the second temperature range as probe nucleic acid sequences, wherein the first temperature range is 50°C-65°C, including 50°C and 65°C, and the second temperature range is (50+X)°C-(65+Y)°C, including (50+X)°C and (65+Y)°C, wherein X and Y are each independently any number between 8 and 12, including 8 and 12; (b) screening out nucleic acid sequences without hairpin structures in the nucleic acid sequences; (c) Calculate the deltaG of each nucleic acid sequence and select nucleic acid sequences with deltaG>2 kj / mol; (d) screening out nucleic acid sequences without self-dimers among the nucleic acid sequences; (e) screening out nucleic acid sequences whose GC content is within a predetermined GC range and whose number of Gs is ≤ number of Cs, wherein the predetermined GC range is 40%-60%; (f) selecting at least one nucleic acid sequence group, each of the at least one nucleic acid sequence group comprising a predetermined number of nucleic acid sequences that do not form cross-dimers with each other; There is no restriction on the order in which steps (a)-(f) are performed.

17. A computer-readable storage medium having computer instructions stored thereon, wherein the computer instructions, when executed by a processor, implement the steps of the method according to any one of claims 1 to 9.

18. A computer program product, comprising computer instructions, which, when executed by a processor, implement the steps of the method according to any one of claims 1 to 9.

Images