siRNA targeting and regulating PCSK9 gene expression and its application

Abstract

The present disclosure relates to siRNAs for targeting and regulating PCSK9 gene expression and their applications. Experimental results show that some oligonucleotide sequences modified with alternating modifications and specific templates can significantly inhibit PCSK9 expression and can be used to develop drugs for treating PCSK9-related diseases.

Description

Technical Field

[0001] This application is a divisional application of the invention patent application with Chinese patent application number CN202311463375.7, the application date of which is November 6, 2023, and the name of the invention is "siRNA targeting and regulating PCSK9 gene expression and its application".

[0002] The present disclosure relates to the field of nucleic acid modification technology, and in particular, to a small interfering ribonucleic acid (siRNA) modified by multiple chemical methods and its application in preparing drugs for diseases related to PCSK9 gene expression. Background Art

[0003] Nucleic acid drugs, especially oligonucleotide drugs, are widely used due to their simple synthesis and high activity. Oligonucleotide drugs usually include antisense oligonucleotides (ASO), small interfering RNA (siRNA), micro RNA (miRNA) and nucleic acid aptamers.

[0004] Oligonucleotides are a class of short DNA or RNA molecules, oligomers, that readily bind to their respective complementary oligonucleotides, DNA or RNA in a sequence-specific manner to form duplexes, or less commonly, higher-order hybrids. This fundamental property makes oligonucleotides widely used in genetic testing, research, and medicine. In nature, oligonucleotides are usually small RNA molecules that play a role in the regulation of gene expression, or intermediates derived from the degradation of larger nucleic acid molecules.

[0005] RNA interference (RNAi) is a natural defense mechanism against foreign genes. siRNA can knock out target genes by recognizing specific sequences and degrading target mRNA.

[0006] The effective molecules of classical RNAi are composed of the iconic 19 + 2 nucleotide polymer structure (a double helix consisting of a 21-nucleotide RNA molecule and a 19-nucleotide nucleotide molecule corresponding to the nucleobase, including a 2-nucleotide 3' end overhang). One strand of siRNA (the guide strand or antisense strand) is complementary to the target gene transcript mRNA, and the other strand is labeled as the passenger strand (or sense strand). siRNAs (antisense strand) guide Arguin (AGO2) to complement the target transcript and become part of the RNA-guided silencing complex (RISC). The complete complementarity between siRNA (antisense strand) and the target leads to the breakage of the target transcript at the opposite position of the guide strand (antisense strand) 10-11 under the catalysis of the AGO2 protein.

[0007] siRNA has a natural advantage over small molecules and antibody drugs because siRNA performs its function by completing Watson–Crick base pairing on mRNA, while small molecules and monoclonal antibody drugs need to recognize the complex spatial structure of specific proteins. Therefore, many diseases cannot be treated by small molecules and monoclonal antibodies because their target molecules are highly active and cannot recognize molecular structures with affinity and binding specificity. The mechanism of action of siRNA drugs enables them to regulate the expression of target proteins at the genetic level, and has targeting specificity compared to small molecules or antibody drugs. Its mechanism based on the principle of complementary base pairing also makes siRNA's treatment range wider, the design simpler, and the research and development cycle shorter.

[0008] Oligonucleotides can bind to complementary RNA chains in a sequence-specific manner and can induce RNase H to cleave target RNA after hybridization. In natural oligonucleotides, nucleotides are linked by phosphodiester bonds. Under physiological conditions, they are particularly sensitive to nucleases. Therefore, natural, unmodified, and unmodified oligonucleotide drugs are easily rapidly degraded by nucleases in vivo, have low activity, and poor drugability. Chemical modification of the oligonucleotide structure is an effective way to increase its activity, which can improve its stability to nucleases, its affinity to RNA, and better promote cellular endocytosis and tissue targeting, thereby effectively regulating the expression of the target gene.

[0009] Based on the basic structure of oligonucleotides, bases, sugar rings, phosphate backbones and ends, chemical modifications can be performed in four parts:

[0010] 1) Base modification: mainly divided into three forms: purine modification, pyrimidine modification and base substitution. Purine modification includes N6-methyladenosine, N1-methyladenosine, 7-methylguanylate modification; pyrimidine modification includes 3-methyluridine, 5-methyluridine, 5-methylcytosine, N4-acetylcytidine, pseudouridine, thiouridine, propyne uridine and dihydrouridine.

[0011] 2) Sugar ring modification: mainly divided into sugar ring modification and replacement. Sugar ring modification includes 2'-modification, 4'-modification, 5'-modification, isomeric modification, and combination of these modifications. The most common 2'-modifications of siRNA are 2'-OMe (2'-methoxy) and 2'-F (2'-fluoro) modifications. Compared with natural siRNA, siRNA modified with 2'-OMe and 2'-F has a higher Tm value, stronger serum stability and better activity.

[0012] 3) Modification of the phosphate backbone: The main modification methods include: modification of phosphorothioate; modification by methyl phosphate, selenophosphate, methylborylphosphate, dithiophosphate, and replacement of the bridging oxygen atom in the phosphodiester bond connection region with a sulfur atom; replacement of the entire phosphate group between nucleosides with a group that does not contain a phosphorus atom, such as replacing the P atom with a C, S, and N atom to form a guanidine group, S-methylthiourea, etc.

[0013] 4) Terminal modification: covalent conjugation of special groups at the 5' end and / or 3' end of the sense chain and phosphorylation modification of the 5' end of the antisense chain.

[0014] All oligonucleotide drugs that have been marketed have been chemically modified. Since the first nucleic acid drug Fomivirsen (Vitravene) was approved for marketing in 1998, the chemical modification technology of nucleic acid drugs has been continuously upgraded. So far, 18 nucleic acid drugs have been approved for marketing worldwide:

[0015] Table 1 Nucleic acid drugs approved for marketing worldwide

[0016]

[0017] The treatment strategy for hypercholesterolemia is mainly to reduce low-density lipoprotein cholesterol (LDL-C), which causes atherosclerosis, and to increase high-density lipoprotein cholesterol (HDL-C), which has a potential cardioprotective effect. Clinical studies from nearly 170,000 subjects have shown that for every 1.0 mmol / L reduction in LDL-C levels, the average annual incidence of major cardiovascular disease events can be reduced by about 20%. The drugs recommended in the 2019 version of the "Guidelines for Primary Diagnosis and Treatment of Dyslipidemia" to reduce LDL-C mainly include statins, cholesterol absorption inhibitors, Robutecol, PCSK9 inhibitors, etc., among which statins are the first choice. The 2018 version of the "Chinese Expert Consensus on Screening and Diagnosis and Treatment of Familial Hypercholesterolemia" recommends statins and combined treatment with ezetimibe and PCSK9 inhibitors.

[0018] PCSK9 is a serine protease encoded by the PCSK9 gene and is mainly produced by the liver. PCSK9 binds to the LDL receptor (LDL-R) on the surface of liver cells and degrades LDL-R. Since LDL-R has the function of binding to LDL-C in plasma and absorbing it into the liver (processing the blood lipids in it and excreting it through bile), the degradation of LDL-R will lead to an increase in the LDL-C level in plasma. PCSK9 inhibitors reduce the expression level of PCSK9, increase the level of LDL-R on the surface of liver cells, thereby reducing the level of LDL-C in plasma and achieving the purpose of lowering blood lipids.

[0019] In order to effectively treat hypercholesterolemia and dyslipidemia, there is a need in the art to further develop drugs that regulate PCSK9 gene expression. Summary of the invention

[0020] The present invention designs a series of unique siRNA sequences by targeting the PCSK9 mRNA sequence, and performs alternating modifications and specific template modifications on the sequences.

[0021] Typically, siRNA uses 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F) to modify the monomer. However, even if only the above two monomer modifications are considered, for siRNA, the sense strand and antisense strand have a total of 44 bases, that is, there are 2 44 Moreover, with different terminal thiolation configurations, the number of possible modification schemes becomes even larger.

[0022] The same siRNA sequence has very different activities when modified in different ways. Different siRNAs have very different activities when modified in the same way. Although there are some modification principles for siRNA modification design, existing studies have shown that its activity cannot be accurately inferred based on the modification method, that is, there is no definite relationship between the modification method and activity. Therefore, it is very difficult to screen out a modification scheme with high activity from countless possible modification combinations.

[0023] The present invention screens out some alternatively modified and specially modified sequences that have a significant inhibitory effect on PCSK9 gene expression by chemically modifying the designed siRNA sequences.

[0024] In one aspect, the present disclosure provides a double-stranded RNAi agent for reducing the expression of PCSK9, comprising any one oligonucleotide duplex selected from the following sense strand and antisense strand pairing.

[0025] (1) the sense strand has a sequence as shown in SEQ ID NO. 1 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 13 or a fragment thereof, or a modified sequence thereof;

[0026] (2) the sense strand has a sequence as shown in SEQ ID NO. 2 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 14 or a fragment thereof, or a modified sequence thereof;

[0027] (3) the sense strand has a sequence as shown in SEQ ID NO. 3 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 15 or a fragment thereof, or a modified sequence thereof;

[0028] (4) the sense strand has a sequence as shown in SEQ ID NO. 4 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 16 or a fragment thereof, or a modified sequence thereof;

[0029] (5) the sense strand has a sequence as shown in SEQ ID NO. 5 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 17 or a fragment thereof, or a modified sequence thereof;

[0030] (6) the sense strand has a sequence as shown in SEQ ID NO. 6 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 18 or a fragment thereof, or a modified sequence thereof;

[0031] (7) the sense strand has a sequence as shown in SEQ ID NO. 7 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 19 or a fragment thereof, or a modified sequence thereof;

[0032] (8) the sense strand has a sequence as shown in SEQ ID NO. 8 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 20 or a fragment thereof, or a modified sequence thereof;

[0033] (9) the sense strand has a sequence as shown in SEQ ID NO. 9 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 21 or a fragment thereof, or a modified sequence thereof;

[0034] (10) the sense strand has a sequence as shown in SEQ ID NO. 10 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 22 or a fragment thereof, or a modified sequence thereof;

[0035] (11) the sense strand has a sequence as shown in SEQ ID NO. 11 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 23 or a fragment thereof, or a modified sequence thereof;

[0036] (12) The sense strand has a sequence as shown in SEQ ID NO. 12 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 24 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof.

[0037] In another aspect, the present disclosure also provides a conjugate for reducing the expression of PCSK9, comprising the double-stranded RNAi agent and a ligand conjugated thereto.

[0038] In another aspect, the present disclosure also provides a pharmaceutical composition, which includes the double-stranded RNAi agent or conjugate, and a pharmaceutically acceptable carrier.

[0039] In another aspect, the present disclosure also provides use of the aforementioned double-stranded RNAi agent, conjugate or composition in the preparation of a drug for a disease associated with PCSK9.

[0040] In another aspect, the present disclosure also provides methods for treating or preventing diseases and conditions that can be modulated by downregulating PCSK9 gene expression.

[0041] The beneficial effects achieved by the present disclosure are at least as follows:

[0042] (1) Unmodified sequences, including basic sequences 5, 51, 81, 82, 84, 3, 8, 9, 21, 31, 73 and 83, all have significant inhibitory effects on PCSK9, with the highest inhibition rate exceeding 60%.

[0043] (2) Using multiple modified sequences, the inhibition rate can reach up to more than 90%. In addition, the modified sequence is conjugated with the GalNAc compound, which can be efficiently delivered to the animal liver and significantly inhibit PCSK9 gene expression, significantly reduce serum low-density lipoprotein cholesterol (LDL-C) levels, and significantly reduce serum total cholesterol (TC) levels.

[0044] (3) The sequences modified by alternating modification and modification templates disclosed in the present invention have significantly improved PCSK9 inhibitory activity by up to 40% compared with the unmodified sequences that are completely identical to or have very little difference with the sequences disclosed in the prior art.

[0045] (4) The present disclosure found that, whether it is an unmodified sequence or an alternately modified sequence, the activity of siRNAs with similar sequences varies greatly. For example, the inhibition rate of the unmodified basic sequence 5 is 51.2% higher than that of the basic sequence 4, and the inhibition rate of the alternately modified sequence P92-si5 is 61.8% higher than that of P92-si4, which is a significant improvement.

[0046] (5) The present disclosure also found that the effects on activity of different sequences after alternating modification were not consistent. Some of the inhibition rates were significantly improved, such as the basic sequence 5, where the inhibition rate of the alternating modification was 12.4% higher than that of the unmodified sequence; some were not obvious, such as the basic sequences 4, 22 and 52, where the inhibition rates of the alternating modified sequences and the unmodified sequences were basically unchanged. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] In order to more clearly illustrate the technical solutions of the embodiments of the present disclosure, the drawings of the embodiments are briefly introduced below. Obviously, the drawings in the following description only relate to some embodiments of the present disclosure, but are not limitations of the present disclosure.

[0048] Figure 1 The alternating modified sequences were shown to have a significant inhibitory effect on the PCSK9 gene, and the inhibition rates of these sequences were all higher than 50%.

[0049] Figure 2 The alternating modified sequences showed an inhibition rate of 30%-50% on the PCSK9 gene.

[0050] Figure 3 Alternate modified sequences showing inhibition of PCSK9 gene by less than 30%.

[0051] Figure 4 Alternate modified sequences showing inhibition of PCSK9 gene by less than 30%.

[0052] Figure 5 The unmodified sequences were shown to have a significant inhibitory effect on the PCSK9 gene, and the inhibition rates of these sequences were all higher than 50%.

[0053] Figure 6 Unmodified sequences showing inhibition of PCSK9 gene less than 40%.

[0054] Figure 7 It shows the inhibition rate of PCSK9 gene after basic sequence 5 is modified with different templates.

[0055] Figure 8 The inhibition rate of PCSK9 gene by basic sequences 5, 51, 81 and 84 using template modification, anti-off-target or / and 5'-E-VP modification sequence is shown.

[0056] Fig. 9 The inhibition rate of PCSK9 protein in animal serum is shown after basic sequences 5, 51, 81, 82 and 84 are modified with different schemes and conjugated with GalNAc compounds.

[0057] Fig.10 It shows that after the basic sequences 5, 51, 81, 82 and 84 were modified with different schemes and conjugated with GalNAc compounds, the level of low-density lipoprotein cholesterol (LDL-C) in animal serum was reduced.

[0058] Fig.11 It shows that after the basic sequences 5, 51, 81, 82 and 84 were modified with different schemes and conjugated with GalNAc compounds, the level of total cholesterol (TC) in animal serum was reduced. DETAILED DESCRIPTION

[0059] In order to make the present disclosure more easily understood, certain terms are first defined. In addition, it should be noted that whenever a value or a range of values ​​for a parameter is listed, it is intended to indicate that values ​​and ranges intermediate to these cited values ​​are also intended to be part of the present disclosure.

[0060] As used herein, the articles "a" and "an" refer to one or more than one (ie, at least one) of the grammatical object of the article. By way of example, "an element" refers to one element or more than one element, such as a plurality of elements.

[0061] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including, but not limited to."

[0062] The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless the context clearly dictates otherwise.

[0063] As used herein, the term "approximately" or "approximately" as applied to one or more target values ​​refers to a value similar to the reference value. In certain embodiments, unless otherwise specified or in addition apparent from the context, the term "approximately" or "approximately" refers to a range of values ​​falling into 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the reference value in either direction (greater than or less than) (unless such numerals will exceed 100% of possible values).

[0064] As used herein, "PCSK9" refers to the proprotein convertase subtilisin Kexin9 gene or protein.

[0065] "G", "C", "A" and "U" each generally represent nucleotides comprising guanine, cytosine, adenine and uracil as bases, respectively. "T" and "dT" are used interchangeably herein and refer to deoxyribonucleotides in which the nucleobase is thymine, such as deoxyribothymine, 2'-deoxythymidine or thymidine. However, it should be understood that the term "ribonucleotide" or "nucleotide" or "deoxyribonucleotide" may also refer to a modified nucleotide (as further described below) or an alternative replacement moiety. The skilled artisan will be well aware that guanine, cytosine, adenine and uracil may be replaced by other moieties without substantially changing the base pairing properties of an oligonucleotide (including a nucleotide having such a replacement moiety). For example, without limitation, a nucleotide comprising inosine as its base may base pair with a nucleotide containing adenine, cytosine or uracil. Thus, a nucleotide comprising uracil, guanine or adenine may be replaced in the nucleotide sequences of the present disclosure by a nucleotide comprising, for example, inosine. Sequences comprising such replacement moieties are embodiments of the present disclosure.

[0066] The terms "RNAi agent", "iRNA", "iRNA agent", "RNA interference agent" are used interchangeably herein to refer to RNA agents as defined herein and to mediate targeted cleavage of RNA transcripts through the RNA induced silencing complex (RISC) pathway. RNAi directs sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). RNAi regulates, e.g., inhibits, expression of PCSK9 in cells such as cells in a subject (e.g., a mammalian subject). RNAi molecules include single-stranded RNAi molecules and double-stranded siRNAs, as well as short hairpin RNAs (shRNAs).

[0067] The term "small interfering RNA" or "siRNA" refers to a small interfering RNA RNAi molecule. It is a class of double-stranded RNA molecules, also referred to in the art as short interfering RNA or silencing RNA. siRNAs typically comprise a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a leading strand), wherein each strand is 17 to 30 nucleotides in length, typically 19 to 25 nucleosides in length, wherein the antisense strand is complementary to the target nucleic acid (such as at least 95% complementary, such as fully complementary) (suitably a mature mRNA sequence), and the sense strand is complementary to the antisense strand, such that the sense strand and the antisense strand form a duplex or duplex region. The siRNA strand may form a blunt-ended duplex, or preferably, the 3' ends of the sense and antisense strands may form a 3' overhang, such as 1, 2 or 3 nucleosides, similar to the product produced by Dicer, which may form a RISC substrate in vivo. Effective extended forms of Dicer substrates have been described in US 8,349,809 and US 8,513,207, which are incorporated herein by reference. In some embodiments, both the sense and antisense strands have 2nt 3' overhangs. Thus, the length of the duplex region can be, for example, 17 to 25 nucleotides, such as 21 to 23 nucleotides in length.

[0068] The term "antisense strand" refers to a strand of RNAi (e.g., dsRNA) that includes a region that is substantially complementary to a target sequence. As used herein, the term "region of complementarity" refers to a region on the antisense strand that is substantially complementary to a sequence (e.g., a target sequence) as defined herein. When the region of complementarity is not completely complementary to the target sequence, mispairing can be in the interior or terminal regions of the molecule. Typically, the most tolerated mispairing is in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends.

[0069] The term "sense strand" as used herein refers to the strand of a RNAi that includes a region that is substantially complementary to a region of the antisense strand (as that term is defined herein).

[0070] As used herein, the term "inhibit" may be used interchangeably with "reduce," "silence," "downregulate," "suppress," and other similar terms, and includes any level of inhibition.

[0071] As used herein, the phrase "inhibiting the expression of PCSK9" includes inhibiting the expression of any PCSK9 gene (such as, for example, a mouse PCSK9 gene, a rat PCSK9 gene, a monkey PCSK9 gene, or a human PCSK9 gene) and a variant (such as a naturally occurring variant) or mutant of a PCSK9 gene. Thus, the PCSK9 gene can be a wild-type PCSK9 gene, a mutant PCSK9 gene, or a transgenic PCSK9 gene in the context of a genetically manipulated cell, cell group, or organism.

[0072] "Inhibiting PCSK9 gene expression" includes any level of inhibition of the PCSK9 gene, such as at least partial inhibition of the expression of the PCSK9 gene, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0073] Based on any variable level associated with PCSK9 gene expression, such as PCSK9 mRNA level, PCSK9 protein level, or serum lipid level, the expression of the PCSK9 gene can be assessed. Inhibition can be assessed by the reduction of one or more of these variables in absolute or relative levels compared to a control level. A control level can be any type of control level utilized in the art, such as a baseline level before administration or a level determined from a similar untreated or controlled subject, cell, or sample (e.g., only a buffer control or an inert agent control) treated subject.

[0074] As used herein, "patient" or "subject" is intended to include humans or non-human animals, preferably mammals, such as monkeys. Most preferably, the subject or patient is a human.

[0075] As used herein, "PCSK9-related diseases" are intended to include any disease associated with the PCSK9 gene or protein. Such diseases can be caused, for example, by overproduction of PCSK9 protein, by PCSK9 gene mutations, by abnormal cleavage of PCSK9 protein, by abnormal interactions between PCSK9 and other proteins or other endogenous or exogenous substances. Exemplary PCSK9-related diseases include lipidemias, such as hyperlipidemia, and other forms of lipid imbalances, such as hypercholesterolemia, hypertriglyceridemia, and pathological conditions associated with these disorders, such as heart and circulatory system diseases.

[0076] As used herein, "therapeutically effective amount" is intended to include an amount of RNAi agent sufficient to achieve treatment of a PCSK9-related disease (e.g., by attenuating, ameliorating, or maintaining the existing disease or one or more disease symptoms) when administered to a patient. The "therapeutically effective amount" may vary depending on the RNAi agent, how the agent is administered, the disease and its severity, and medical history, age, weight, family history, genetic makeup, the stage of the pathological process mediated by PCSK9 expression, the type of previous or concomitant therapy (if any), and other individual characteristics of the patient to be treated.

[0077] As used herein, a "prophylactically effective amount" is intended to include an amount of an RNAi agent sufficient to prevent or improve a disease or one or more symptoms of a PCSK9-related disease when administered to a subject who has not yet experienced or shown symptoms of the disease but may be susceptible to the disease. Improving a disease includes slowing the progression of the disease or reducing the severity of a subsequent disease. The "prophylactically effective amount" may vary depending on the RNAi agent, how the agent is administered, the degree of risk of the disease, and medical history, age, weight, family history, genetic makeup, type of prior or concomitant treatment (if any), and other individual characteristics of the patient to be treated.

[0078] "Therapeutically effective amount" or "prophylactically effective amount" also includes the amount of RNAi agent that produces a certain desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. The RNAi agent used in the method of the present disclosure can be administered in an amount sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.

[0079] As used herein, the term "sample" includes similar fluids, cells or tissues separated from a subject, and a collection of fluids, cells or tissues present in a subject. Examples of biological fluids include blood, serum and serosal fluid, plasma, cerebrospinal fluid, ocular fluid, lymph, urine, saliva, etc. Tissue samples may include samples from tissues, organs or local areas. For example, a sample may be derived from a fluid or cell in a specific organ, an organ part or these organs. In certain embodiments, a sample may be derived from liver (for example, some segments of the whole liver or liver, or some types of cells in the liver, for example, hepatocytes). In a preferred embodiment, "sample derived from a subject" refers to blood or plasma extracted from the subject. In other embodiments, "sample derived from a subject" refers to liver tissue (or its subcomponent) derived from the subject.

[0080] In one aspect, the present disclosure provides a double-stranded RNAi agent for reducing the expression of PCSK9, comprising any oligonucleotide duplex selected from the following sense strand and antisense strand pairings:

[0081] (1) the sense strand has a sequence as shown in SEQ ID NO. 1 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 13 or a fragment thereof, or a modified sequence thereof;

[0082] (2) the sense strand has a sequence as shown in SEQ ID NO. 2 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 14 or a fragment thereof, or a modified sequence thereof;

[0083] (3) the sense strand has a sequence as shown in SEQ ID NO. 3 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 15 or a fragment thereof, or a modified sequence thereof;

[0084] (4) the sense strand has a sequence as shown in SEQ ID NO. 4 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 16 or a fragment thereof, or a modified sequence thereof;

[0085] (5) the sense strand has a sequence as shown in SEQ ID NO. 5 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 17 or a fragment thereof, or a modified sequence thereof;

[0086] (6) the sense strand has a sequence as shown in SEQ ID NO. 6 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 18 or a fragment thereof, or a modified sequence thereof;

[0087] (7) the sense strand has a sequence as shown in SEQ ID NO. 7 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 19 or a fragment thereof, or a modified sequence thereof;

[0088] (8) the sense strand has a sequence as shown in SEQ ID NO. 8 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 20 or a fragment thereof, or a modified sequence thereof;

[0089] (9) the sense strand has a sequence as shown in SEQ ID NO. 9 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 21 or a fragment thereof, or a modified sequence thereof;

[0090] (10) the sense strand has a sequence as shown in SEQ ID NO. 10 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 22 or a fragment thereof, or a modified sequence thereof;

[0091] (11) the sense strand has a sequence as shown in SEQ ID NO. 11 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 23 or a fragment thereof, or a modified sequence thereof;

[0092] (12) The sense strand has a sequence as shown in SEQ ID NO. 12 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO. 24 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof.

[0093] In some embodiments, all nucleotides on the sense strand and the antisense strand are modified nucleotides.

[0094] In some embodiments, the double-stranded RNAi agent is a RNAi agent for inhibiting the expression of the PCSK9 gene.

[0095] In some embodiments, the sense strand differs from any one of SEQ ID NOs. 1-12 by 1-3 nucleotides.

[0096] In some embodiments, the antisense strand differs from any one of SEQ ID NOs. 13-24 by 1-3 nucleotides.

[0097] In some embodiments, at least one modified nucleotide is selected from the group consisting of deoxy-nucleotides, 3'-terminal deoxy-thymine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, non-locked nucleotides, conformationally restricted nucleotides, restricted ethyl nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides comprising non-natural bases, tetrahydropyran-modified nucleotides, 1,5-anhydrohexitol-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides comprising phosphorothioate groups, nucleotides comprising methylphosphonate groups, nucleotides comprising 5'-phosphates, and nucleotides comprising 5'-phosphate mimetics.

[0098] In some embodiments, at least one strand comprises a 3' overhang of at least 1 nucleotide.

[0099] In some embodiments, at least one strand comprises a 3' overhang of at least 2 nucleotides.

[0100] In some embodiments, the double-stranded region is 15-30 nucleotide pairs in length.

[0101] In some embodiments, the double-stranded region is 17-25 nucleotide pairs in length.

[0102] In some embodiments, the double-stranded region is 19-23 nucleotide pairs in length.

[0103] In some embodiments, the double-stranded region is 21 nucleotide pairs in length.

[0104] In some embodiments, each strand has 15-30 nucleotides.

[0105] In some embodiments, each strand has 19-25 nucleotides.

[0106] In some embodiments, the sense strand has 21 nucleotides and the antisense strand has 23 nucleotides.

[0107] In some embodiments, all nucleotide modifications on the sense strand and the antisense strand are chemical modifications of the 2' position of the ribose of the nucleotide.

[0108] In some embodiments, the chemical modification at the 2' position of the ribose of the nucleotide is selected from any one or a combination of 2'-methoxy, 2'-methoxyethyl, 2'-fluoro, 2'-benzyloxy, 2'-methylcarbonylamino and 2'-pyridylmethoxy.

[0109] In some embodiments, the chemical modification at the 2' position of the ribose of each nucleotide is selected from a combination of 2'-methoxy and 2'-fluoro.

[0110] In some embodiments, the chemical modification at the 2' position of the ribose of each nucleotide is selected from alternating combinations of 2'-methoxy and 2'-fluoro.

[0111] In some embodiments, the chemical modification of the 2' position of each nucleotide ribose is as follows: the odd-numbered positions of the sense strand are all 2'-fluoro modified, and the even-numbered positions are all 2'-methoxy modified; the odd-numbered positions of the antisense strand are all 2'-methoxy modified, and the even-numbered positions are all 2'-fluoro modified.

[0112] In some embodiments, the nucleotide monomers are linked by 3',5'-phosphodiester bonds.

[0113] In some embodiments, the 3',5'-phosphodiester bonds connecting the nucleotide monomers are thio-modified.

[0114] In some embodiments, the aforementioned oligonucleotides have the following modifications:

[0115]

[0116] In some embodiments, the antisense strand uses a modification group in the second to eighth positions from the 5' end, wherein the modification group is selected from UNA, GNA or DNA, wherein the structures of UNA and GNA are as follows:

[0117] ;

[0118] The base is selected from adenine, guanine, cytosine, thymine and uracil.

[0119] In some embodiments, the phosphorylation of the 5'-carbon atom of the 5'-terminal nucleotide glycoside of the modified antisense strand includes, but is not limited to, the following 5'-phosphorylation groups: 5'-vinyl phosphonate group (5'-E-VP); 5'-methyl phosphonate group (5'-MP); 5'-C-methyl phosphate group; 5'-thiophosphate group (5'-PS); 5'-phosphate group (5'-P), the structure of which is shown below:

[0120] ;

[0121] Wherein, R is hydrogen, hydroxyl, amine, C 1-4 Alkyl, aromatic, C 1-4 Alkoxy, C 1-4 Alkylcarbonylamino or halogen;

[0122] The base is selected from adenine, guanine, cytosine, thymine and uracil.

[0123] In some embodiments, the 3',5'-phosphodiester bonds connecting the nucleotide monomers at the ends of the sequences are thio-modified and form chirally pure 3',5'-thiophosphorothioate bonds, wherein the 5' ends of the sense strand and the antisense strand contain 1-3 thio linkages, and the 3' end of the antisense strand contains 1-3 thio linkages.

[0124] The double-stranded RNA (dsRNA) agents of the present disclosure may optionally be conjugated to one or more ligands. The ligand may be attached to the sense strand, antisense strand, or both strands at the 3' end, 5' end, or both ends. For example, the ligand may be conjugated to the sense strand. In a preferred embodiment, the ligand is bound to the 3' end of the sense strand. In a preferred embodiment, the ligand is a GalNAc ligand.

[0125] In another aspect, the present disclosure provides a conjugate for reducing the expression of PCSK9, comprising the double-stranded RNAi agent and a ligand conjugated thereto.

[0126] In some embodiments, the ligand is conjugated to the 3'-end or the 5'-end of the sense strand of the oligonucleotide.

[0127] In some embodiments, the ligand is one or more GalNAc derivatives attached using a divalent or trivalent branched linkage.

[0128] In some embodiments, the ligand is:

[0129] ,

[0130] wherein X is hydrogen or a hydroxyl protecting group or H, wherein the hydroxyl protecting group includes acetyl, benzoyl or isobutyryl; Y is an amine protecting group or H, wherein the amine protecting group is formyl, acetyl, propionyl, n-butyryl or isobutyryl; n is an integer between 0 and 20; and q, r and s are independently integers between 1 and 7.

[0131] In some embodiments, the ligand is:

[0132] .

[0133] In some embodiments, the ligand is:

[0134]

[0135] Wherein, X is oxygen, nitrogen or sulfur;

[0136] Y is an alkyl group or an aromatic group;

[0137] R1 is oxygen or sulfur;

[0138] R2 is hydrogen, amine, C 1-4 Alkyl, aromatic, C 1-4 Alkoxy or halogen;

[0139] A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d -, wherein a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5;

[0140] B is -(CH2) e -, where e is an integer from 0 to 7;

[0141] L is -CONH- or -NHCO-;

[0142] X1 is -(CH2) f -or-(CH2CH2O) f CH2-, f is an integer from 1 to 5;

[0143] X2 is -(CH2) g -, g is an integer from 1 to 6;

[0144] Y1 is 0 or 1;

[0145] Y2 is 0, 1 or 2;

[0146] Y3 is 1, 2 or 3;

[0147] m is an integer from 0 to 4;

[0148] n is an integer from 0 to 4.

[0149] In some embodiments, the ligand is G4, G5, G6, or G7:

[0150] ,

[0151] ,

[0152] ,

[0153] .

[0154] In some embodiments, the conjugate has the structure shown below:

[0155] ,

[0156] ,

[0157] ,

[0158] ,or

[0159] .

[0160] In some embodiments, the double-stranded RNAi agent comprises any one oligonucleotide duplex selected from the following sense and antisense strand pairs:

[0161] (1) the sense strand has the sequence shown in SEQ ID NO. 337; and the antisense strand has the sequence shown in SEQ ID NO. 427;

[0162] (2) the sense strand has the sequence shown in SEQ ID NO. 337; and the antisense strand has the sequence shown in SEQ ID NO. 428;

[0163] (3) the sense strand has the sequence shown in SEQ ID NO. 342; and the antisense strand has the sequence shown in SEQ ID NO. 381;

[0164] (4) the sense strand has the sequence shown in SEQ ID NO. 342; and the antisense strand has the sequence shown in SEQ ID NO. 430;

[0165] (5) the sense strand has the sequence shown in SEQ ID NO. 342; and the antisense strand has the sequence shown in SEQ ID NO. 431;

[0166] (6) the sense strand has the sequence shown in SEQ ID NO. 347; and the antisense strand has the sequence shown in SEQ ID NO. 384;

[0167] (7) the sense strand has the sequence shown in SEQ ID NO. 347; and the antisense strand has the sequence shown in SEQ ID NO. 437;

[0168] (8) the sense strand has the sequence shown in SEQ ID NO. 347; and the antisense strand has the sequence shown in SEQ ID NO. 438;

[0169] (9) the sense strand has the sequence shown in SEQ ID NO. 348; and the antisense strand has the sequence shown in SEQ ID NO. 385;

[0170] (10) the sense strand has the sequence shown in SEQ ID NO. 352; and the antisense strand has the sequence shown in SEQ ID NO. 448;

[0171] (11) the sense strand has the sequence shown in SEQ ID NO. 353; and the antisense strand has the sequence shown in SEQ ID NO. 390;

[0172] (12) the sense strand has the sequence shown in SEQ ID NO. 353; and the antisense strand has the sequence shown in SEQ ID NO. 448;

[0173] (14) the sense strand has the sequence shown in SEQ ID NO. 357; and the antisense strand has the sequence shown in SEQ ID NO. 393;

[0174] (15) the sense strand has the sequence shown in SEQ ID NO. 357; and the antisense strand has the sequence shown in SEQ ID NO. 446; and

[0175] (16) the sense strand has the sequence shown in SEQ ID NO. 357; and the antisense strand has the sequence shown in SEQ ID NO. 447;

[0176] Wherein, the oligonucleotide duplex is conjugated with ligand G4, G5, G6 or G7.

[0177] In some embodiments, the double-stranded RNAi agent comprises any one oligonucleotide duplex selected from the following sense and antisense strand pairs:

[0178] (1) the sense strand has the sequence shown in SEQ ID NO. 352; and the antisense strand has the sequence shown in SEQ ID NO. 448;

[0179] (2) the sense strand has the sequence shown in SEQ ID NO. 353; and the antisense strand has the sequence shown in SEQ ID NO. 390; and

[0180] (3) the sense strand has the sequence shown in SEQ ID NO. 353; and the antisense strand has the sequence shown in SEQ ID NO. 448;

[0181] Wherein, the oligonucleotide duplex is conjugated with ligand G4, G5, G6 or G7.

[0182] In some embodiments, the double-stranded RNAi agent comprises an oligonucleotide duplex consisting of a sense strand set forth in SEQ ID NO. 353 and an antisense strand set forth in SEQ ID NO. 448, and the oligonucleotide duplex is conjugated to a ligand G5.

[0183] In another aspect, the present disclosure also provides a pharmaceutical composition, which includes the double-stranded RNAi agent or conjugate, and a pharmaceutically acceptable carrier.

[0184] In certain embodiments, provided herein is a pharmaceutical composition containing RNAi as described herein and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing RNAi can be used to treat diseases or conditions associated with the expression or activity of PCSK9 genes, such as lipid disorders. Such pharmaceutical compositions are formulated based on delivery models. An example is a composition formulated so as to be delivered parenterally, such as by intravenous (IV) delivery for systemic administration. Another example is the following composition, which is formulated for direct delivery to the brain parenchyma, such as by infusion to the brain, such as by continuous pump infusion.

[0185] The pharmaceutical composition comprising the RNAi agent of the present disclosure can be, for example, a solution with or without a buffer or a composition containing a pharmaceutically acceptable carrier. Such compositions include, for example, aqueous or crystalline compositions, liposome formulations, micellar formulations, emulsions, and gene therapy vectors.

[0186] In the method of the present disclosure, the RNAi agent can be administered in a solution. A free RNAi agent can be administered in a non-buffered solution, for example, in physiological saline or in water. Alternatively, the free siRNA can also be administered in a suitable buffer solution. The buffer solution can include acetate, citrate, prolamin, carbonate or phosphate, or any combination thereof. In a preferred embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and volume molar osmotic pressure concentration of the buffer containing the RNAi agent can be adjusted so that it is suitable for administering to a subject.

[0187] In some embodiments, the buffer solution further comprises an agent for controlling the osmolality of the solution so that the osmolality is maintained at a desired value, such as the physiological value of human plasma. Solutes that can be added to the buffer solution to control the osmolality include, but are not limited to, proteins, peptides, amino acids, non-metabolizable polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the agent for controlling the osmolality of the solution is a salt. In certain embodiments, the agent for controlling the osmolality of the solution is sodium chloride or potassium chloride.

[0188] The pharmaceutical composition of the present invention can be administered at a dosage sufficient to inhibit the expression of the PCSK9 gene. Typically, the suitable dosage of the RNAi disclosed herein is within the range of about 0.001 to about 200.0 mg per kg of body weight of the recipient per day, typically within the range of about 1 to 50 mg per kg of body weight per day. For example, RNAi agents (e.g., dsRNA) can be administered at a dosage of about 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4. .4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6 , 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 1 48, 49, or about 50 mg / kg.

[0189] The pharmaceutical composition can be given once a day, or the RNAi can be given twice, three times or more subdoses at appropriate intervals in one day, or even can be given by continuous infusion or delivery through a controlled release formulation. In this case, the RNAi contained in each subdose must be correspondingly less, so as to achieve a daily total dose. The dosage unit can also be compounded for delivery in a few days, for example, using a conventional sustained release formulation that provides a lasting RNAi release within a few days time frame. Sustained release formulations are well known in the art and are particularly useful for delivering agents at specific sites, and can be used with agents of the present disclosure thus. In this embodiment, the dosage unit comprises a plurality of corresponding daily doses.

[0190] In other embodiments, a single dose of the pharmaceutical composition can be long-lasting, so that subsequent doses are administered at intervals of no more than 3, 4, or 5 days or at intervals of no more than 1, 2, 3, or 4 weeks. In some embodiments of the present disclosure, a single dose of the pharmaceutical composition of the present disclosure is administered once a week. In other embodiments of the present disclosure, a single dose of the pharmaceutical composition of the present disclosure is administered once every two months.

[0191] Those skilled in the art will appreciate that certain factors may affect the dosage and timing required to effectively treat a subject, including, but not limited to, the severity of the disease or condition, previous treatment, the subject's overall health and / or age, and other existing diseases. In addition, treating a subject with a therapeutically effective dose of a composition may include a single treatment or a series of treatments. As described elsewhere herein, the effective dose and in vivo half-life of each RNAi encompassed by the present disclosure may be estimated using conventional methods or based on in vivo testing using appropriate animal models.

[0192] The pharmaceutical compositions of the present disclosure may be administered in a number of ways, depending on whether local or systemic treatment is desired and on the area to be treated. Administration may be topical (e.g., by a skin patch); pulmonary; for example, by inhalation or insufflation of a powder or aerosol, including by a nebulizer; intratracheal; intranasal; epidermal, and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subdermal, for example, via an implant device; or intracranial, for example, intraparenchymal, intrathecal, or intraventricular administration.

[0193] RNAi used in the compositions and methods of the present disclosure can be formulated for delivery in a membrane molecular assembly such as liposomes or micelles. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer (e.g., one or more bilayers). Liposomes include unilayer or multilayer vesicles having a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the RNAi composition. The lipophilic material separates the aqueous interior from the aqueous exterior (although in some instances, it may include) that does not typically include the RNAi composition. Liposomes are useful for transferring active ingredients and delivering them to the site of action. Because the liposome membrane is structurally similar to a biological membrane, when the liposome is applied to a tissue, the liposome bilayer fuses with the bilayer of the cell membrane. As the fusion of the liposome and the cell proceeds, the internal aqueous content including the RNAi is delivered to the cell, wherein the RNAi can specifically bind to a target RNA and can mediate RNAi. In some cases, the liposomes are also specifically targeted, for example to direct the RNAi to a particular cell type.

[0194] Liposomes comprising RNAi agents can be prepared by a variety of methods. In one example, the lipid component of the liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or a lipid conjugate. The detergent can have a high critical micelle concentration and can be nonionic. Exemplary detergents include cholate, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. The RNAi agent preparation is then added to the micelle comprising the lipid component. The cationic group on the lipid interacts with the RNAi agent and condenses around the RNAi agent to form a liposome. After condensation, the detergent is removed, for example, by dialysis to obtain a liposome preparation of the RNAi agent.

[0195] RNAi, such as dsRNA of the present disclosure, can be fully encapsulated in a lipid formulation (eg, LNP or other nucleic acid-lipid particle).

[0196] As used herein, the term "LNP" refers to a stable nucleic acid-lipid particle. LNP contains a cationic lipid, a non-cationic lipid and a lipid (e.g., a PEG-lipid conjugate) that prevents the particle from gathering. LNP is extremely useful for synthetic applications because they demonstrate a prolonged circulation life after intravenous (iv) injection and accumulate at distal sites (e.g., at a site physically separated from the site of administration).

[0197] In one embodiment, the ratio of lipid to drug (mass / mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1.

[0198] In some preferred embodiments, the lipid nanoparticles include cationic lipids, neutral lipids, structural lipids, and polymer-conjugated lipids.

[0199] In some preferred embodiments, the cationic lipid is a compound of formula (I), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein G1 is C 1～6 Alkylene; G2 is C 2～8 Alkylene; G3 is C 1～3 Alkylene; L1 is C 6～15 Straight chain alkyl; L2 is C 12～25 Branched alkyl. For example, YK-009 of formula (II) (see patent CN114044741B).

[0200] (I)

[0201] (II)

[0202] In some preferred embodiments, the cationic lipid is a compound of formula (II), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein: G1 is C 2~8 Alkylene; G2 is C 2~8 Alkylene; L1 is -C(O)O- or -OC(O)-; L2 is -C(O)O- or -OC(O)-; R1 is C 6~25 Straight or branched alkyl; R2 is C 6~25 Straight or branched alkyl; G3 is HO(CH2)2- or HO(CH2)3-; G4 is HO(CH2)2- or HO(CH2)3-; L is (CH2)2- or -(CH2)3- or -(CH2)4-. For example, YK-401 with the structure of formula (II-I) and YK-402 with the structure of formula (II-II) (see patent CN115784921B).

[0203] (II)

[0204] (II-I)

[0205] (II-II)

[0206] In some preferred embodiments, the cationic lipid is a compound of formula (III), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein: G1 is C 1~6 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~20 Straight or branched alkyl; R2 is C 12~25 Branched alkyl; G3 is: HO(CH2)2N(CH3)(CH2)2-, HO(CH2)2N(CH2CH3)(CH2)2-, (HO(CH2)2)2N(CH2)2-, CH3O(CH2)2N(CH3)(CH2)2-, (CH3)2N(CH2)3SC(O)O(CH2)2-, (CH3)2N(CH2)3SC(O)-, CH3NH(CH2)2N(CH3)(CH2)2- or CH3CH2NH(CH2)2-. For example, YK-201 with the structure of formula (III-I) and YK-202 with the structure of formula (III-II) (see patent CN115677518B).

[0207] (III)

[0208] (III-I)

[0209] (III-II)

[0210] In some preferred embodiments, the cationic lipid is a compound of formula (IV), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein G1 is C 1~8 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~25 Straight or branched alkyl; R2 is C 12~25 Straight or branched alkyl; G3 is: HO(CH2)2N(R3)CH2CH(OH)CH2-, wherein R3 is -CH3 or -CH2CH3 or -CH2CH2OH For example, YK-305 of formula (IV-I) and YK-310 of formula (IV-II) (see patent CN115745820B).

[0211] (IV)

[0212] (IV-I)

[0213] (IV-II)

[0214] In some preferred embodiments, the cationic lipid is a compound of formula (V), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein G 1 and G 2 Each independently is an unsubstituted C6-C 10 Alkylene; G 3 For unsubstituted C1-C 12 Alkylene; R 1 and R 2 Each independently is C6-C 24 Alkyl or C6-C 24 Alkenyl; R 3 OR 5 、N、-C(=O)OR 4 、-OC(=O)R 4 or -NR 5 C(=O)R 4 ; R 4 C1-C 12 A hydrocarbon group; and R 5 is H or C1-C6 hydrocarbon group; for example, ALC0315 of formula (VI) (see patent CN108368028B);

[0215] (V)

[0216] (VI)

[0217] In some preferred embodiments, the cationic lipid is a compound of formula (VI), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein R4 is selected from -(CH2) n Q and -(CH2) n CHQR; Q is selected from the group consisting of: -OR, -OH, -O(CH2) nR8 and heterocycle; n is 1, 2 or 3; each R is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl, (CH2)qOR* and H, and each q is independently selected from 1, 2 and 3, and each R* is independently selected from the group consisting of C1-12 alkyl, C2-3 alkenyl, (CH2)qOR* and H; The group consisting of alkyl and C 2-12 alkenyl; each X is independently selected from the group consisting of F, Cl, Br and I; for example, SM102 of the formula (VI-I) (see patent CN110520409A).

[0218] (VI)

[0219] (VI-I)

[0220] In some preferred embodiments, the cationic lipid is a compound of formula (VII), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof (see CN102625696B, DLIN-MC3-DMA),

[0221] (VII).

[0222] In some more preferred embodiments, the cationic lipids include YK-009, YK-401, YK-305, ALC0315, SM102, and DLIN-MC3-DMA.

[0223] In some preferred embodiments, the molar ratio of the cationic lipid to the neutral lipid is 1:1 to 10:1.

[0224] In some preferred embodiments, the molar ratio of the cationic lipid to the structural lipid is 1:1 to 5:1.

[0225] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer conjugated lipid is (25-65):(5-25):(25-70):(0.5-5).

[0226] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer conjugated lipid is (25-65):(5-25):(25-45):(0.5-5).

[0227] In some more preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is 50:10:38.5:1.5 or 49:10:39.5:1.5.

[0228] In some preferred embodiments, the neutral lipids include one or more of phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, sterol and derivatives thereof.

[0229] In some more preferred embodiments, the neutral lipid is selected from one or more of the following: 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diondecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dialinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl phosphatidylethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE) and mixtures thereof.

[0230] In some more preferred embodiments, the neutral lipid is DOPE and / or DSPC.

[0231] In some preferred embodiments, the structured lipid is selected from one or more of the following: cholesterol, non-sterols, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol, and corticosteroids.

[0232] In some more preferred embodiments, the structured lipid is cholesterol.

[0233] In some preferred embodiments, the polymer-conjugated lipid is selected from one or more of the following: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol.

[0234] In some more preferred embodiments, the polymer conjugated lipid is selected from one or more of the following: distearoylphosphatidylethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristoylglycerol-3-methoxy polyethylene glycol 2000 (DMG-PEG2000) and methoxy polyethylene glycol ditetradecanoyl acetamide (ALC-0159).

[0235] Pharmaceutical compositions of the present disclosure include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be produced from a variety of components, including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semisolids. Particularly preferred are formulations that target the liver when treating liver disorders (e.g., liver cancer).

[0236] The pharmaceutical formulations of the present disclosure, which may conveniently be in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the steps of combining the active ingredients with the pharmaceutical carrier(s) or excipient(s). Generally speaking, the formulations are prepared by uniformly and finely combining the active ingredients with liquid carriers or finely dispersed solid carriers or both, and, if desired, shaping the product.

[0237] Compositions of the present disclosure can be formulated into any one of many possible dosage forms, such as but not limited to tablets, capsules, gel capsules, liquid syrups, soft capsules, suppositories and enemas. Compositions of the present disclosure can also be formulated into suspensions in aqueous, non-aqueous media or mixed media. Aqueous suspensions can further include materials that increase the viscosity of the suspension, such materials include, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension can also include a stabilizer.

[0238] Certain compositions of the present disclosure also incorporate carrier compounds into the formulation. As used herein, a "carrier compound" or "carrier" may refer to a nucleic acid or its analog, which is inert (i.e., not biologically active per se), but is considered to be a nucleic acid in an in vivo process, such as by degrading biologically active nucleic acids or promoting their removal from circulation to reduce the bioavailability of biologically active nucleic acids. Co-administration of nucleic acids and carrier compounds (generally an excess of the latter substance) can result in a significant reduction in the amount of nucleic acids recovered in the liver, kidneys, or other external circulation reservoirs, assuming that competition for common receptors between the carrier compound and the nucleic acid is due. For example, when co-administered with polyinosinic acid, dextran sulfate, polycytidylic acid, or 4-acetamido-4'stilbene isothiocyanate-2,2'-disulfonic acid, the recovery of partially phosphorothioated dsRNA in liver tissue can be reduced.

[0239] In contrast to carrier compounds, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmaceutically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid, and when combined with the nucleic acid and other components of a particular pharmaceutical composition, the excipient is selected to provide the desired volume, consistency, etc., with reference to the intended mode of administration. Typical pharmaceutical carriers include, but are not limited to, binders (e.g., pregelatinized corn starch, polyvinyl pyrrolidone, or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates, or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silicon dioxide, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulfate, etc.).

[0240] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration, which do not react toxically with nucleic acids, can also be used to prepare the compositions of the present disclosure. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, straight-chain starch, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinyl pyrrolidone, etc.

[0241] The preparation that is used for local administration of nucleic acid can comprise the aseptic or non-aseptic aqueous solution, non-aqueous solution in common solvent such as alcohol, or the nucleic acid solution in liquid or solid oil matrix.These solutions can also comprise buffer, diluent and other suitable additives.Can use be suitable for non-parenteral administration and do not have toxic reaction with nucleic acid, pharmaceutically acceptable organic or inorganic excipient.

[0242] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinyl pyrrolidone, and the like.

[0243] The dosage form, carrier compound, drug carrier, excipient, etc. of the above-mentioned composition are described in U.S. Pat. No. 10,125,369 B2, which is incorporated herein by reference.

[0244] The present disclosure also provides methods for treating or preventing diseases and conditions that can be regulated by down-regulating PCSK9 gene expression. For example, the RNAi agents described herein can be used to treat lipidemia, such as hyperlipidemia, and other forms of lipid imbalance, such as hypercholesterolemia, hypertriglyceridemia, and pathological conditions associated with these disorders, such as heart and circulatory system diseases. Other diseases and conditions that can be regulated by down-regulating PCSK9 gene expression include lysosomal storage diseases, including but not limited to Niemann-Pick disease, Tay-Sachs disease, lysosomal acid lipase deficiency, and Gaucher disease. The RNAi agents described herein can be used to treat cardiovascular diseases such as coronary heart disease (CHD), cerebrovascular disease (CVD), aortic valve stenosis, peripheral vascular disease, atherosclerosis, arteriosclerosis, myocardial infarction (heart attack), cerebrovascular disease (stroke), transient ischemic attack (TIA), angina (stable and unstable), atrial fibrillation, arrhythmia, valvular disease and / or congestive heart failure or any other trait. The methods include administering to the subject a therapeutically effective amount or a prophylactically effective amount of a RNAi agent, conjugate or composition of the disclosure. In some embodiments, the method includes administering a therapeutic amount of PCSK9 siRNA to a patient having a heterozygous LDLR genotype.

[0245] The RNAi agents of the present disclosure can be administered to a subject using any mode of administration known in the art, including, but not limited to, subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any combination thereof. In a preferred embodiment, these agents are administered subcutaneously.

[0246] In other embodiments, the siRNA is administered in combination with an additional therapeutic agent. The siRNA and the additional therapeutic agent can be administered in combination in the same composition, e.g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or by another method described herein.

[0247] Examples of additional therapeutic agents include drugs known to treat lipid disorders such as hypercholesterolemia, atherosclerosis, dyslipidemia or cardiovascular and cerebrovascular diseases. For example, additional drugs for treating hyperlipidemia are selected from fibrates, statins, bile acid sequestering agents and nicotinic acids. Additional drugs for treating cardiovascular and cerebrovascular diseases are selected from angiotensin converting enzyme inhibitors (e.g., captopril, enalapril, benazepril, perindopril, etc.), angiotensin II receptor antagonists (e.g., losartan, losartan hydrochlorothiazide, valsartan, valsartan hydrochlorothiazide, telmisartan, telmisartan hydrochlorothiazide, olmesartan medoxomil, etc.), beta-blockers (e.g., propranolol, bisoprolol, metoprolol tartrate, metoprolol succinate, etc.).

[0248] In some embodiments, the RNAi agent is administered to a patient and subsequently an additional therapeutic agent is administered to the patient (or vice versa). In other embodiments, the RNAi agent and the additional therapeutic agent are administered simultaneously.

[0249] In another aspect, the present disclosure provides use of the aforementioned double-stranded RNAi agent, conjugate or composition in the preparation of a drug for a disease associated with PCSK9.

[0250] In another aspect, the present disclosure provides use of the aforementioned double-stranded RNAi agent, conjugate or composition in the preparation of a drug for treating hypercholesterolemia, atherosclerosis, dyslipidemia or cardiovascular and cerebrovascular diseases.

[0251] In some embodiments, the PCSK9-related disease is selected from hypercholesterolemia, atherosclerosis, dyslipidemia or cardiovascular and cerebrovascular diseases.

[0252] The following examples are used to illustrate the present disclosure, but are not intended to limit the scope of the present disclosure. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0253] The nucleotide abbreviations herein are as follows:

[0254] A = Adenosine-3'-phosphate

[0255] Am=2'-O-methoxyadenosine-3'-phosphate

[0256] Ams = 2'-O-methoxyadenosine-3'-phosphorothioate

[0257] Af = 2'-fluoroadenosine-3'-phosphate

[0258] Afs = 2'-fluoroadenosine-3'-phosphorothioate

[0259] G = Guanosine-3'-phosphate

[0260] Gm = 2'-O-methoxyguanosine-3'-phosphate

[0261] Gms = 2'-O-methoxyguanosine-3'-phosphorothioate

[0262] Gf = 2'-fluoroguanosine-3'-phosphate

[0263] Gfs = 2'-fluoroguanosine-3'-phosphorothioate

[0264] C = Cytidine-3'-phosphate

[0265] Cm = 2'-O-methoxycytidine-3'-phosphate

[0266] Cms = 2'-O-methoxycytidine-3'-phosphorothioate

[0267] Cf = 2'-fluorocytidine-3'-phosphate

[0268] Cfs = 2'-fluorocytidine-3'-phosphorothioate

[0269] U = Uridine-3'-phosphate

[0270] Um = 2'-O-methoxyuridine-3'-phosphate

[0271] Ums = 2'-O-methoxyuridine-3'-phosphorothioate

[0272] Uf = 2'-fluorouridine-3'-phosphate

[0273] Ufs = 2'-fluorouridine-3'-phosphorothioate

[0274] AmsEVP = 5'-vinyl-(E)-phosphonate-2'-methoxyadenosine-3'-phosphorothioate

[0275] UmsEVP = 5'-vinyl-(E)-phosphonate-2'-methoxyuridine-3'-phosphorothioate

[0276] Agna = adenosine diol nucleic acid

[0277] Cgna = cytidine-diol nucleic acid

[0278] Ggna = guanosine diol nucleic acid

[0279] Tgna = thymidine diol nucleic acid

[0280] Ugna = uridine diol nucleic acid

[0281] Example

[0282] Example 1: Synthesis of alternatively modified small interfering oligonucleotides

[0283] 84 siRNA basic sequences were designed based on the PCSK9 mRNA sequence. To improve the inhibition efficiency and stability of the sequence, the basic sequence was modified with 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F) alternately, and the ends were thiolated. The odd-numbered positions of the sense chain were all modified with 2'-F, and the even-numbered positions were all modified with 2'-OMe; the odd-numbered positions of the antisense chain were all modified with 2'-OMe, and the even-numbered positions were all modified with 2'-F. In addition, there were two thiolated modifications at the 5' end of the sense chain; and there were two thiolated modifications at the 5' and 3' ends of the antisense chain. The alternating modified siRNA sequences are shown in Table 2.

[0284] 1. Synthesis of the alternatively modified sequence P92-si5

[0285] The basic sequence of the small interfering RNA with sequence number P92-si5 in Table 2 is:

[0286] Sense strand: 5'- AAGAUCCUGCAUGUCUUCCAU-3' (SEQ ID NO. 1)

[0287] Antisense strand: 5'- AUGGAAGACAUGCAGGAUCUUGG-3' (SEQ ID NO. 13)

[0288] The odd-numbered sites of the sense strand and the even-numbered sites of the antisense strand are modified with 2'-F, and the other sites are modified with 2'-OMe. In addition, there are two thio-modifications at the 5' end of the sense strand, and two thio-modifications at the 5' and 3' ends of the antisense strand.

[0289] Instruments and reagents: Qingke 192 P model DNA / RNA automatic synthesizer, whose solid phase carrier is a universal carrier of cross-linked polystyrene beads, model Primer support 5G Unylinker 350 (cytiva manufacturer).

[0290] Preparation method:

[0291] According to the monomer concentration of 0.15 M, the following nucleotide monomer solutions were prepared with acetonitrile: DMT-A-OMe phosphoramidite monomer (Formula 1), DMT-C-OMe phosphoramidite monomer (Formula 2), DMT-G-OMe phosphoramidite monomer (Formula 3), DMT-U-OMe phosphoramidite monomer (Formula 4), DMT-AF phosphoramidite monomer (Formula 5), ​​DMT-CF phosphoramidite monomer (Formula 6), DMT-GF phosphoramidite monomer (Formula 7), and DMT-UF phosphoramidite monomer (Formula 8).

[0292]

[0293]

[0294]

[0295] Prepared by the following steps:

[0296] (1) Deprotection

[0297] 3% dichloroacetic acid toluene solution was used as a deprotection agent to remove the DMT protecting group, followed by washing with acetonitrile.

[0298] (2) Coupling

[0299] Each nucleotide monomer was coupled in acetonitrile using 0.25 M 5-ethylthiotetrazolyl as an activating agent, followed by rinsing with acetonitrile.

[0300] (3) Oxidation / sulfurization

[0301] Oxidation: Oxidation was performed using a 0.05 M iodine solution in pyridine / water (90 / 10) as the oxidant, followed by rinsing with acetonitrile.

[0302] Sulfurization: Use 3% hydrogenated xanthan gum in pyridine as the sulfurizing agent for sulfurization, and then use acetonitrile for washing.

[0303] (4) Hydroxyl protection

[0304] Hydroxyl protection was performed using 10% acetic anhydride tetrahydrofuran solution (CAP A) and tetrahydrofuran / pyridine / nitromethylimidazole 74 / 10 / 16 (v / v / v) (CAP B) as hydroxyl protecting reagents, followed by rinsing with acetonitrile.

[0305] Repeat the above steps and cycle according to the set sequence to obtain a fully protected product.

[0306] (5) Use 3% dichloroacetic acid toluene solution as a deprotection reagent to remove the DMT protecting group of the last nucleotide, and then use acetonitrile for washing.

[0307] (6) Aminolysis and purification

[0308] The solid phase carrier is transferred to the reactor, concentrated ammonia water (25-28%) is added, and after maintaining the aminolysis at 60°C for 12 hours, the system is cooled to room temperature and the mixture is transferred to a filter press, eluted with a mixed solution of purified water and ethanol, the filtrate is combined, passed through a chromatography column, concentrated, and freeze-dried to obtain the product.

[0309] (7) Annealing

[0310] The purified sense strand and antisense strand were mixed in a 1:1 ratio, heated to 95°C and maintained for 3 min, and then slowly cooled to room temperature to form a double strand.

[0311] P92-si5 purity 97.4%; measured molecular weight: 14493.52

[0312] 2. Synthesis of other sequences

[0313] The other sequences listed in Table 2 were synthesized according to the above method.

[0314]

[0315]

[0316]

[0317]

[0318]

[0319] Example 2: Inhibitory effect of alternating modified sequences on the PCSK9 gene

[0320] After the 2'-OMe and 2'-F alternating modified siRNA sequences synthesized in Example 1 were transfected into HELA cells via lipid nanoparticles (LNP), the inhibitory effect of each sequence on the PCSK9 gene was detected using qPCR technology.

[0321] 1. Experimental Materials

[0322] Test sample: the alternatively modified small interfering RNA sequence P92-si1-84 listed in Table 2 (synthesized in Example 1).

[0323] Cell type: HeLa cell line HELA cells

[0324] Drug solvent: sterile enzyme-free water, Gibco Opti-MEM.

[0325] 2. Experimental methods

[0326] qRT-PCR was used to detect the inhibitory effect of the samples on the expression of PCSK9 gene mRNA in HELA cell lines.

[0327] 2.1 Cell culture

[0328] Take the subcultured HELA cell line, and culture the logarithmically growing cells with 10% fetal bovine serum RPMI 1640 culture medium (supplemented with 100× penicillin and streptomycin 10 μL / mL), place them in a cell culture incubator at 37°C with 5% CO2, and change the medium once a day. Digest and subculture with 0.25% trypsin, centrifuge at 1000 r / min for 5 min, discard the supernatant, and add fresh culture medium for subculture.

[0329] 2.2 Cell transfection

[0330] Preparation of transfection mixture: Mix Lipofectamine RNAiMAX and Opti-MEM in a ratio of 1.5:98.5 and vortex to mix.

[0331] Preparation of transfection reagent: Add 60 μL of siRNA solution diluted in Opti-MEM to 60 μL of transfection mixture at a ratio of 1:1 (v / v), vortex and let stand at room temperature for 15 min to obtain lipid nanoparticles (LNP). Take 12.5 μL for encapsulation efficiency detection.

[0332] Transfection reagent for blank control group: Add 60 μL of prepared transfection mixture to 60 μL of Opti-MEM. Vortex to mix well and let stand at room temperature for 15 min.

[0333] Add the prepared transfection reagent to a 24-well cell culture plate (100 μL per well) to make the final siRNA concentration in each well 1 nM. Add 500 μL of cell suspension (6×10 cells per ml) 4 After mixing using the cross method, the cells were placed in a 37°C, 5% CO2 cell culture incubator for 40 h.

[0334] 2.3 PCSK9 mRNA detection

[0335] 1) RNA extraction

[0336] a. Aspirate the culture medium in the 12-well plate, add 0.5 mL 1 × PBS to each well to wash the cells, and aspirate the PBS. Add 0.5 mL TRIzol reagent to the wells, blow the cells with the pipette tip to fully lyse, transfer to a 1.5 mL RNase-free EP tube, and let stand at room temperature for 5 min.

[0337] b. Add 0.1 mL of chloroform to each tube, shake vigorously for 15 seconds, and let stand at room temperature for 5 minutes. Centrifuge at 4°C, 12,000 × g for 15 minutes, and take 200 μL of the supernatant into a new EP tube.

[0338] c. Add an equal volume of isopropanol, gently mix the liquid in the tube by inverting it upside down, let it stand at -20℃ for 10 min, centrifuge at 4℃, 12,000 × g for 15 min, and discard the supernatant.

[0339] d. Add 0.5 mL of 75% ethanol, gently wash the RNA precipitate, centrifuge at 4°C 12,000 × g for 5 min, and remove the supernatant. Repeat the rinse once, centrifuge at 4°C 12,000 × g for 1 min, and remove the residual ethanol with a micropipette tip.

[0340] e. Dry the residual ethanol at room temperature for 2-3 min, then add 40 μL RNase-free ddH2O to dissolve.

[0341] 2) RNA concentration detection

[0342] The RNA concentration was tested using nanodrop. 2 μL RNase-free ddH2O was used as a blank control, and 2 μL RNA sample was used for each test. The sample concentration was recorded.

[0343] 3) PCSK9 mRNA quantitative detection

[0344] In a 15 mL centrifuge tube, add the remaining components except primers and template in 7.5 × 84 = 630 portions, marked as A.

[0345] Label 84 1.5 mL EP tubes, add 77 μL of A and 420 ng of total RNA to each tube, mix well and set aside (labeled as B).

[0346] The upstream and downstream primers of the internal reference gene GAPDH and the target gene PCSK9 were mixed and set aside (marked as C).

[0347] Add 11 μL of B + 1 μL of C to each well of the PCR plate, cover with sealing film, centrifuge at 3000 rpm for 1 min, and put into the machine.

[0348] *This step is performed on ice to maintain low temperature conditions.

[0349] Place the plate into the qPCR instrument and run the following program:

[0350] Reverse transcription: 55°C, 15 min;

[0351] Pre-denaturation: 95°C, 30 sec;

[0352] Cyclic reaction: 95°C, 10 sec; 60°C, 35 sec; 40 cycles;

[0353] Melting curve: 95℃, 15 sec; 60℃, 60 sec; 95℃, 15 sec.

[0354] The running time is about 2 h. Analyze the experimental results and calculate 2-ΔΔCt.

[0355] 2.4 Data Processing

[0356] The PCSK9 mRNA expression rate (%) was calculated as follows:

[0357] Expression rate = (PCSK9 mRNA expression level / PCSK9 mRNA expression level in blank control group) × 100%;

[0358] PCSK9 gene expression inhibition rate = 1-expression rate (%).

[0359] 3. Experimental results

[0360] The inhibition rate in this example is the average value of 4 experiments. The inhibition rate of each sequence on the expression of PCSK9 mRNA in HELA cells is shown in Tables 4-6.

[0361] The experimental results showed that some sequences modified with 2'-OMe and 2'-F alternately, including P92-si5, P92-si51, P92-si81, P92-si82, P92-si84, P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si73 and P92-si83 (specific sequences are shown in Table 3), had a significant inhibitory effect on the expression of PCSK9 mRNA in HELA cells, with inhibition rates exceeding 50%. Among them, the inhibition rates of P92-si5, P92-si81, P92-si82, P92-si3, P92-si8 and P92-si31 exceeded 70%.

[0362] The other sequences had poor inhibitory effects on PCSK9 mRNA expression, with inhibition rates lower than 50%.

[0363]

[0364] The inhibition rate of each sequence on PCSK9 mRNA expression in HELA cells is shown in Tables 4-6.

[0365] (1) Among the 84 designed sequences, 12 sequences had significant inhibitory effects on the PCSK9 gene, with inhibition rates exceeding 50%, including P92-si5, P92-si51, P92-si81, P92-si82, P92-si84, P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si73 and P92-si83. Among them, the inhibition rates of P92-si5, P92-si81, P92-si82, P92-si3, P92-si8 and P92-si31 exceeded 70%.

[0366] Table 4 Alternative modified sequences with significant inhibitory effect on PCSK9 gene (inhibition rate higher than 50%)

[0367]

[0368] As can be seen from Table 4, the alternating modified sequences P92-si5, P92-si51, P92-si81, P92-si82, P92-si84, P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si73 and P92-si83 (specific sequences are shown in Table 3), a total of 12 sequences, have a significant inhibitory effect on the expression of PCSK9 mRNA, and the inhibition rate is more than 50%, among which the inhibition rates of P92-si5, P92-si81, P92-si82, P92-si3, P92-si8 and P92-si31 exceed 70% ( Figure 1 ). These 12 sequences can be used as candidate sequences.

[0369] (2) The inhibition rates of the 26 sequences on the PCSK9 gene ranged from 30% to 50%. For example, the inhibition rates of P92-si6 and P92-si7 were 38.3% and 35.7%, respectively.

[0370]

[0371] The 26 sequences listed in Table 5 had poor inhibitory effects on the PCSK9 gene, with inhibition rates below 50%, ranging from 30% to 50%. For example, the inhibition rates of P92-si6 and P92-si7 were 38.3% and 35.7%, respectively ( Figure 2 ).

[0372] (3) The inhibition rates of 46 sequences on the PCSK9 gene were below 30%. For example, the inhibition rates of P92-si1 and P92-si20 were only 9.2% and 6.0%, respectively.

[0373] Table 6 Alternative modification sequences with inhibition rates of PCSK9 gene below 30%

[0374]

[0375]

[0376] The 46 sequences listed in Table 6 had poor inhibitory effects on PCSK9 mRNA expression, with inhibition rates all below 30%. For example, the inhibition rates of P92-si1 and P92-si20 were only 9.2% and 6.0%, respectively ( Figure 3 and Figure 4 ).

[0377] (4) The activities of siRNAs with similar sequences vary greatly. For example, the inhibition rate of P92-si5 is 61.8% higher than that of P92-si4, which is a significant improvement.

[0378] The comparison of the inhibitory effects of some siRNAs with similar sequences on PCSK9 mRNA is shown in Table 7.

[0379]

[0380] As can be seen from Table 7, some siRNAs with similar sequences have very different inhibitory effects on PCSK9 mRNA expression.

[0381] Compared with basic sequence 5, basic sequence 4 has only one base at the end. Forward chain: there is one more C at the 5' end of basic sequence 4, one more U at the 3' end of basic sequence 5, and the other sequences are exactly the same; Antisense chain: there is one more U at the 3' end of basic sequence 4, one more A at the 5' end of basic sequence 5, and the other sequences are exactly the same. However, the inhibition rate of the alternating modified sequence P92-si5 increased by 61.8% compared with P92-si4, which was significantly improved.

[0382] Compared with basic sequence 51, basic sequence 50 differs only in the terminal 6 bases. For the sense strand, the 5' end of basic sequence 50 is GAUUAA, the 3' end of sequence 51 is CUGGAU, and the other sequences are exactly the same; for the antisense strand, the 3' end of basic sequence 50 is AAUCAG, the 5' end of basic sequence 51 is AUCCAG, and the other sequences are exactly the same. However, the inhibition rate of the alternating modified sequence P92-si51 is significantly increased by 46.8% compared with P92-si50.

[0383] Compared with basic sequence 3, basic sequence 2 only differs in the terminal 6 bases. Forward chain: the 5' end of basic sequence 2 is AUACCU, the 3' end of basic sequence 3 is UGUCUU, and the other sequences are exactly the same; antisense chain: the 3' end of basic sequence 2 is GUAUCC, the 5' end of basic sequence 3 is AAGACA, and the other sequences are exactly the same. However, the inhibition rate of the alternating modified sequence P92-si3 is 45.9% higher than that of P92-si2, which is significantly improved.

[0384] Compared with basic sequence 10, basic sequence 9 only differs in the two terminal bases. Forward chain: the 5' end of basic sequence 9 is GG, the 3' end of basic sequence 10 is AG, and the other sequences are exactly the same; antisense chain: the 3' end of basic sequence 9 is UA, the 5' end of basic sequence 10 is CU, and the other sequences are exactly the same. However, the inhibition rate of the alternating sequence P92-si9 is 53.1% higher than that of the sequence P92-si10, which is significantly improved.

[0385] Compared with sequence base 22, base sequence 21 differs only in the two terminal bases. Forward chain: the 5' end of base sequence 21 is CA, the 3' end of base sequence 22 is GA, and the other sequences are exactly the same; antisense chain: the 3' end of base sequence 21 is CA, the 5' end of base sequence 22 is UC, and the other sequences are exactly the same. However, the inhibition rate of the alternating modified sequence P92-si21 was significantly increased by 65.6% compared with P92-si22.

[0386] Compared with basic sequence 31, basic sequence 30 has only one base at the end. Forward chain: the 5' end of basic sequence 30 is A, the 3' end of basic sequence 31 is G, and the other sequences are exactly the same; antisense chain: the 3' end of basic sequence 30 is G, the 5' end of basic sequence 31 is C, and the other sequences are exactly the same. However, the inhibition rate of the alternating modified sequence P92-si31 is 39.4% higher than that of P92-si30, which is significantly improved.

[0387] Compared with basic sequence 74, basic sequence 73 has only one base at the end. Forward chain: the 5' end of basic sequence 73 is G, the 3' end of basic sequence 74 is G, and the other sequences are exactly the same; antisense chain: the 3' end of basic sequence 73 is A, the 5' end of basic sequence 74 is C, and the other sequences are exactly the same. However, the inhibition rate of the alternating modified sequence P92-si73 is 62.2% higher than that of P92-si74, which is significantly improved.

[0388] Therefore, it is not easy to screen out sequences with significant inhibitory activity from a very large number of oligonucleotide sequences designed for PCSK9 mRNA sequences, and this requires a lot of creative work.

[0389] Summarize:

[0390] (1) Among the 84 designed sequences, 12 sequences had significant inhibitory effects on the PCSK9 gene, with inhibition rates exceeding 50%, including P92-si5, P92-si51, P92-si81, P92-si82, P92-si84, P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si73 and P92-si83. Among them, the inhibition rates of P92-si5, P92-si81, P92-si82, P92-si3, P92-si8 and P92-si31 exceeded 70%.

[0391] (2) The inhibition rates of the 26 sequences on the PCSK9 gene ranged from 30% to 50%. For example, the inhibition rates of P92-si6 and P92-si7 were 38.3% and 35.7%, respectively.

[0392] (3) The inhibition rates of 46 sequences on the PCSK9 gene were below 30%. For example, the inhibition rates of P92-si1 and P92-si20 were only 9.2% and 6.0%, respectively.

[0393] (4) The activities of siRNAs with similar sequences vary greatly. For example, the inhibition rate of P92-si5 was 61.8% higher than that of P92-si4, which was significantly higher. Therefore, it is not easy to screen out sequences with significant inhibitory activity from a large number of oligonucleotide sequences designed for PCSK9 mRNA sequences, and a lot of creative work is required.

[0394] Example 3: Inhibitory effect of unmodified sequence on PCSK9 gene

[0395] In this example, some unmodified sequences corresponding to the modified sequences in Example 2 were synthesized and transfected into HELA cells via lipid nanoparticles (LNPs). The inhibitory effect of each unmodified sequence on the PCSK9 gene was detected using qPCR technology, and unmodified siRNA sequences with better inhibitory effects were screened out.

[0396] 1. Experimental Materials

[0397] Test samples:

[0398] The unmodified siRNA sequences are listed in Table 8. All sequences were synthesized according to the method in Example 1.

[0399]

[0400]

[0401]

[0402] Cell type: HeLa cell line HELA cells

[0403] Drug solvent: sterile enzyme-free water, Gibco Opti-MEM.

[0404] 2. Experimental methods

[0405] Refer to Example 2.

[0406] 3. Experimental results

[0407] The inhibition rates of PCSK9 mRNA expression by each unmodified sequence are shown in Tables 9 and 10.

[0408] The unmodified sequences si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73 and si83 had a significant inhibitory effect on the expression of PCSK9 mRNA in HELA cells, with inhibition rates all above 50%, among which the inhibition rates of si5, si81, si82, si3 and si8 exceeded 60%.

[0409] (1) 12 unmodified sequences had significant inhibitory effects on the PCSK9 gene, with inhibition rates exceeding 50%, including si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73 and si83. Among them, si5, si81, si82, si3 and si8 had inhibition rates exceeding 60%.

[0410] Table 9 Unmodified sequences with significant inhibitory effect on PCSK9 gene (inhibition rate higher than 50%)

[0411]

[0412] The unmodified sequences listed in Table 9, including si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73 and si83, had a significant inhibitory effect on the expression of PCSK9 mRNA, with inhibition rates of more than 50%. Among them, si5, si81, si82, si3 and si8 inhibited more than 60% ( Figure 5 ). These 12 sequences can be used as candidate sequences.

[0413] (2) The inhibition rates of other unmodified sequences on the PCSK9 gene were all lower than 40%. For example, the inhibition rates of si52 and si74 were only 0.5% and 2.2% respectively.

[0414] Table 10 Unmodified sequences with inhibition rates of less than 40% for PCSK9 gene

[0415]

[0416] The sequences in Table 10 had a very poor inhibitory effect on PCSK9 mRNA expression, with inhibition rates all below 40%. For example, the inhibition rates of si52 and si74 were only 0.5% and 2.2% ( Figure 6 ).

[0417] (3) The activities of siRNAs with similar sequences vary greatly. For example, the inhibition rate of base sequence 5 is 51.2% higher than that of base sequence 4, which is a significant improvement.

[0418] The comparison of the inhibitory effects of some siRNAs with similar sequences on PCSK9 mRNA is shown in Table 11.

[0419]

[0420] As can be seen from Table 11, some siRNAs with similar sequences have very different inhibitory effects on PCSK9 mRNA expression.

[0421] Compared with basic sequence 5, basic sequence 4 has only one base at the end. Forward chain: basic sequence 4 has one more C at the 5' end, basic sequence 5 has one more U at the 3' end, and the other sequences are exactly the same; antisense chain: basic sequence 4 has one more U at the 3' end, basic sequence 5 has one more A at the 5' end, and the other sequences are exactly the same. However, the inhibition rate of basic sequence 5 is significantly increased by 51.2% compared with basic sequence 4.

[0422] Compared with basic sequence 51, basic sequence 50 differs only in the 6 terminal bases. For the sense strand, the 5' end of basic sequence 50 is GAUUAA, the 3' end of basic sequence 51 is CUGGAU, and the other sequences are exactly the same; for the antisense strand, the 3' end of basic sequence 50 is AAUCAG, the 5' end of basic sequence 51 is AUCCAG, and the other sequences are exactly the same. However, the inhibition rate of basic sequence 51 is significantly increased by 42.6% compared with basic sequence 50.

[0423] Compared with basic sequence 3, basic sequence 2 only differs in the terminal 6 bases. Forward chain: the 5' end of basic sequence 2 is AUACCU, the 3' end of basic sequence 3 is UGUCUU, and the other sequences are exactly the same; antisense chain: the 3' end of basic sequence 2 is GUAUCC, the 5' end of basic sequence 3 is AAGACA, and the other sequences are exactly the same. However, the inhibition rate of basic sequence 3 is significantly increased by 42.7% compared with basic sequence 2.

[0424] Compared with basic sequence 10, basic sequence 9 only differs in the two terminal bases. Forward chain: the 5' end of basic sequence 9 is GG, the 3' end of basic sequence 10 is AG, and the other sequences are exactly the same; antisense chain: the 3' end of basic sequence 9 is UA, the 5' end of basic sequence 10 is CU, and the other sequences are exactly the same. However, the inhibition rate of basic sequence 9 is significantly increased by 41.2% compared with basic sequence 10.

[0425] Compared with basic sequence 22, basic sequence 21 only differs in the two terminal bases. Forward chain: the 5' end of basic sequence 21 is CA, the 3' end of basic sequence 22 is GA, and the other sequences are exactly the same; antisense chain: the 3' end of basic sequence 21 is CA, the 5' end of basic sequence 22 is UC, and the other sequences are exactly the same. However, the inhibition rate of basic sequence 21 is 53.2% higher than that of basic sequence 22, which is significantly improved.

[0426] Compared with basic sequence 31, basic sequence 30 has only one base at the end. Forward chain: the 5' end of basic sequence 30 is A, the 3' end of basic sequence 31 is G, and the other sequences are exactly the same; antisense chain: the 3' end of basic sequence 30 is G, the 5' end of basic sequence 31 is C, and the other sequences are exactly the same. However, the inhibition rate of basic sequence 31 is 32.5% higher than that of basic sequence 30, which is a significant improvement.

[0427] Compared with basic sequence 74, basic sequence 73 has only one base at the end. Forward chain: the 5' end of basic sequence 73 is G, the 3' end of basic sequence 74 is G, and the other sequences are exactly the same; antisense chain: the 3' end of basic sequence 73 is A, the 5' end of basic sequence 74 is C, and the other sequences are exactly the same. However, the inhibition rate of basic sequence 73 is 50.2% higher than that of basic sequence 74, which is significantly improved.

[0428] Therefore, it is not easy to screen out sequences with significant inhibitory activity from a very large number of oligonucleotide sequences designed for PCSK9 mRNA sequences, and this requires a lot of creative work.

[0429] (4) The effects on activity of different sequences after alternating modification are not consistent. Some of the inhibition rates are significantly improved, such as the basic sequence 5, where the inhibition rate of the alternating modification is 12.4% higher than that of the unmodified sequence; some are not obvious, such as the basic sequences 4, 22 and 52, where the inhibition rates of the alternating modified sequences and the unmodified sequences are basically unchanged.

[0430] Table 12 Comparison of the inhibition rate of the PCSK9 gene by the alternating modified sequence and the unmodified sequence

[0431]

[0432]

[0433] As can be seen from Table 12, the effects of alternating modifications on the PCSK9 mRNA inhibition rate of different sequences are inconsistent. Some are significantly improved, for example, the inhibition rate of alternating modification of basic sequence 5 is 12.4% higher than that of unmodified sequence, and the inhibition rate of alternating modification of basic sequence 82 is 12.2% higher than that of unmodified sequence; some are not obvious, such as basic sequences 4, 22 and 52, the inhibition rates of alternating modified sequences and unmodified sequences are basically unchanged.

[0434] Therefore, not all unmodified sequences can have their activity improved after alternating modification, and the effects of alternating modification on the activities of different sequences are not consistent.

[0435] Summarize:

[0436] (1) 12 unmodified sequences had significant inhibitory effects on the PCSK9 gene, with inhibition rates exceeding 50%, including si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73 and si83. Among them, si5, si81, si82, si3 and si8 had inhibition rates exceeding 60%.

[0437] (2) The inhibition rate of other unmodified sequences on the PCSK9 gene was less than 40%. For example, the inhibition rates of si52 and si74 were only 0.5% and 2.2% respectively.

[0438] (3) The activities of siRNAs with similar sequences vary greatly. For example, the inhibition rate of base sequence 5 is 51.2% higher than that of base sequence 4, which is a significant improvement.

[0439] (4) The effects on activity of different sequences after alternating modification are not consistent. Some of the inhibition rates are significantly improved, such as the basic sequence 5, where the inhibition rate of the alternating modification is 12.4% higher than that of the unmodified sequence; some are not obvious, such as the basic sequences 4, 22 and 52, where the inhibition rates of the alternating modified sequences and the unmodified sequences are basically unchanged.

[0440] Example 4: Inhibition of PCSK9 gene using template-modified sequences

[0441] In this example, the sequences screened in Example 3, i.e., the unmodified sequences si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73 and si83, a total of 12 sequences, were modified using a modification template. Among them, DV25, DV26, DV27, DV28, DV29, DV30 and DV310 are new modification templates designed in the present disclosure, and DV21 and DV22 are disclosed Advanced ESC modification templates.

[0442] 1. Experimental Materials

[0443] Test samples:

[0444] Table 13 lists the sequences si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73 and si83 in Example 3 modified with different templates (DV25, DV26, DV27, DV28, DV29, DV30, DV31, DV21 and DV22), and the corresponding alternatively modified sequences P92-si5, P92-si51, P92-si81, P92-si82, P92-si84, P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si73 and P92-si83 (synthesized in Example 1).

[0445] The modification principles of the disclosed modification template are as follows:

[0446]

[0447]

[0448]

[0449]

[0450]

[0451]

[0452]

[0453]

[0454] 2. Experimental methods

[0455] qRT-PCR was used to detect the inhibition of the test samples on the expression of PCSK9 gene mRNA in the HEP3B cell line. Hep3B cells were provided by Shanghai WuXi AppTec New Drug Development Co., Ltd. (ATCC-tings-1618164).

[0456] 2.1 Cell culture

[0457] Take the HEP3B cell line in subculture, and culture the logarithmically growing cells with 10% fetal bovine serum RPMI 1640 medium (supplemented with 100 μL / mL of penicillin and streptomycin), place them in a cell culture incubator at 37°C with 5% CO2, and change the medium once a day. Digest and subculture with 0.25% trypsin, centrifuge at 1000 r / min for 5 min, discard the supernatant, and add fresh culture medium for subculture.

[0458] 2.2 Cell transfection

[0459] Preparation of transfection mixture: Mix Lipofectamine RNAiMAX and Opti-MEM in a ratio of 1.5:98.5 and vortex to mix.

[0460] Preparation of transfection reagent: Add 60 μL of siRNA solution diluted in Opti-MEM to 60 μL of transfection mixture at a ratio of 1:1 (v / v), vortex and let stand at room temperature for 15 min to obtain lipid nanoparticles (LNP). Take 12.5 μL for encapsulation efficiency detection.

[0461] Transfection reagent for blank control group: Add 60 μL of prepared transfection mixture to 60 μL of Opti-MEM. Vortex to mix well and let stand at room temperature for 15 min.

[0462] Add the prepared transfection reagent to a 24-well cell culture plate (100 μL per well) to make the final siRNA concentration in each well 0.05 nM. Add 500 μL of cell suspension (6×10 cells per ml) 4 After mixing using the cross method, the cells were placed in a 37°C, 5% CO2 cell culture incubator for 40 h.

[0463] 2.3 PCSK9 mRNA detection

[0464] The steps are the same as those in “2.3 PCSK9 mRNA detection” in Example 2.

[0465] 2.4 Data Processing

[0466] The PCSK9 mRNA expression rate (%) was calculated as follows:

[0467] Expression rate = (PCSK9 mRNA expression level / PCSK9 mRNA expression level in blank control group) × 100%;

[0468] PCSK9 gene expression inhibition rate = 1-expression rate (%).

[0469] 2.5 EC50 experiment

[0470] In this experiment, the siRNA concentration for the EC50 experiment of each sequence started from 0.2 nM and was diluted 4 times, with a total of 8 concentration points (0.2 nM, 0.05 nM, 0.0125 nM, 3.13 pM, 0.78 pM, 0.2 pM, 0.05 pM and 0.01 pM). The inhibition rate of each sequence at each concentration was measured, and a plot was drawn to calculate the EC50 concentration of each sequence.

[0471] 3. Experimental results

[0472] After three repeated experiments, the inhibition rate of each modified sequence on the Hep3B cell PCSK9 gene is shown in Tables 14-25.

[0473] The results of the activity detection experiment showed that 12 candidate sequences (unmodified sequences si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73 and si83) were modified with the modification template DV25-29 designed by the present disclosure, and had a significant inhibitory effect on the PCSK9 gene, with inhibition rates of more than 70%. Among them, the inhibition rates of P92-si81-DV26, P92-si82-DV27 and P92-si82-DV29 reached 89.3%, 89.3% and 89.1%.

[0474] The use of the disclosed modified template DV25-29 modified sequence significantly improved the inhibition rate of PCSK9 gene expression compared with the alternating modified sequence. For example, the base sequence 51 used the template DV27 to modify the sequence P92-si51-DV27, and the inhibition rate was 29.1% higher than that of the alternating modified sequence. The base sequence 81 used the template DV26 to modify the sequence P92-si81-DV26, and the inhibition rate was 26.9% higher than that of the alternating modified sequence.

[0475] Moreover, the same siRNA sequence has a very large difference in activity after being modified with different modification templates. For example, the inhibition rate of the base sequence 51 using the modified sequence of the disclosed modification template DV27 is increased by 22.8% compared with the modification sequence of the disclosed modification template DV31; the inhibition rate is increased by 21.3% compared with the modification sequence of the disclosed Advanced ESC template DV21.

[0476] EC50 experiments show that the EC50 values ​​of sequences modified by the disclosed design modification templates are between 0.0001 and 0.005 nM. For example, the EC50 values ​​of P92-si81-DV27, P92-si84-DV26, and P92-si82-DV27 are 0.0003 nM, 0.0004 nM, and 0.0006 nM, respectively. These sequences can effectively inhibit the expression of the PCSK9 gene at low concentrations.

[0477] (i) Effect of template modification on PCSK9 gene inhibition of each base sequence

[0478] (1) Basic sequence 5

[0479] Table 14 PCSK9 gene inhibition rate after template modification of basic sequence 5

[0480]

[0481] I. DV25-29 Template of the Present Disclosure

[0482] The base sequence 5 was modified with the modification templates DV25-29 designed by the present disclosure, and the inhibition rate of the PCSK9 gene exceeded 80%. Compared with the alternating modification of 2'-methoxy and 2'-fluorine, the inhibition rate of the PCSK9 gene was significantly improved. For example, after modification with templates DV26 and DV27, the inhibition rates of P92-si5-DV26 and P92-si5-DV27 increased by 19.5% and 16.6%, respectively ( Figure 7 ).

[0483] II. Other modified templates disclosed herein

[0484] After the basic sequence 5 was modified with templates DV30 and DV31, the inhibition rates of P92-si5-DV30 and P92-si5-DV31 on the PCSK9 gene were 65.3% and 62.4%, respectively, which were 0.1% and 3.0% lower than those of the corresponding alternatively modified sequences.

[0485] By using the modified templates DV26 and DV27 modified sequences disclosed herein, the inhibition rates of P92-si5-DV26 and P92-si5-DV27 were significantly improved by 19.6% and 16.7% compared with P92-si5-DV30, and by 22.5% and 19.6% compared with P92-si5-DV31, respectively.

[0486] III. Prior art has disclosed Advanced ESC templates DV21 (fluorinated sites: antisense strand 2, 6, 14 and 16, sense strand 7, 9, 10, 11, 16 and 17) and DV22 (fluorinated sites: antisense strand 2, 6, 14 and 16, sense strand 7, 9, 10 and 11)

[0487] After the basic sequence 5 was modified with templates DV21 and DV22, the inhibition rates of P92-si5-DV21 and P92-si5-DV22 on the PCSK9 gene were 68.2% and 69.1%, respectively, which were 2.8% and 3.7% higher than those of the alternatively modified sequences.

[0488] By using the modified templates DV26 and DV27 modified sequences disclosed herein, the inhibition rates of P92-si5-DV26 and P92-si5-DV27 were significantly improved by 16.7% and 13.8% compared with P92-si5-DV21, and by 15.8% and 12.9% compared with P92-si5-DV22, respectively.

[0489] From this we can see that:

[0490] 1) The base sequence 5 adopts the modified sequence DV25-29 of the disclosed modification template, and compared with the alternating modified sequence, the inhibitory effect on the PCSK9 gene is significantly improved. For example, the base sequence 5 adopts the DV26 modified sequence, and the inhibition rate is increased by 19.5% compared with the alternating modified sequence.

[0491] 2) The activity of the same siRNA sequence after being modified with different modification templates is very different. For example, the inhibition rate of the basic sequence 5 modified with the disclosed modification templates DV26 and DV27 can be increased by up to 22.5% compared with the modification sequence modified with the disclosed modification templates DV30 and DV31, which is a significant improvement; the inhibition rate can be increased by up to 16.7% compared with the modification sequence modified with the disclosed Advanced ESC templates DV21 and DV22, which is a significant improvement.

[0492] 3) The activity of siRNA sequences modified with different templates varies greatly, up to 20%. Therefore, it is uncertain which template modification can produce high activity for siRNA sequences.

[0493] (2) Basic sequence 51

[0494] Table 15 PCSK9 gene inhibition rate after template modification of basic sequence 51

[0495]

[0496] I. DV25-29 Template of the Present Disclosure

[0497] After the base sequence 51 was modified with the templates DV25-29 designed in the present disclosure, the inhibition rate of the PCSK9 gene exceeded 75%, and compared with the alternating modification of the 2'-methoxy and 2'-fluorine, the inhibition rate of the PCSK9 gene was significantly improved. For example, after modification with the templates DV26 and DV27, the inhibition rates of P92-si51-DV26 and P92-si51-DV27 were increased by 27.7% and 29.1%, respectively.

[0498] II. Other modified templates disclosed herein

[0499] After the basic sequence 51 was modified with templates DV30 and DV31, the inhibition rates of P92-si51-DV30 and P92-si51-DV31 on the PCSK9 gene were 63.5% and 62.8%, respectively, which were only 7.0% and 6.3% higher than those of the corresponding alternatively modified sequences.

[0500] By using the modified templates DV26 and DV27 modified sequences disclosed herein, the inhibition rates of P92-si51-DV26 and P92-si51-DV27 were significantly improved by 20.7% and 22.1% compared with P92-si51-DV30, and by 21.4% and 22.8% compared with P92-si51-DV31, respectively.

[0501] III. Prior art has disclosed Advanced ESC templates DV21 (fluorinated sites: antisense strand 2, 6, 14 and 16, sense strand 7, 9, 10, 11, 16 and 17) and DV22 (fluorinated sites: antisense strand 2, 6, 14 and 16, sense strand 7, 9, 10 and 11)

[0502] After the basic sequence 51 was modified with the publicly available Advanced ESC templates DV21 and DV22, the inhibition rates of P92-si51-DV21 and P92-si51-DV22 on the PCSK9 gene were 64.3% and 65.1%, respectively, which were 7.8% and 8.6% higher than those of the alternatively modified sequences.

[0503] By using the modified templates DV26 and DV27 modified sequences disclosed herein, the inhibition rates of P92-si51-DV26 and P92-si51-DV27 were significantly improved by 19.9% ​​and 21.3% compared with P92-si51-DV21, and by 19.1% and 20.5% compared with P92-si5-DV22, respectively.

[0504] From this we can see that:

[0505] 1) The base sequence 51 adopts the modified sequence DV25-29 of the disclosed modification template, and compared with the alternating modified sequence, the inhibitory effect on the PCSK9 gene is significantly improved. For example, the base sequence 51 adopts the DV27 modified sequence, and the inhibition rate is increased by 29.1% compared with the alternating modified sequence.

[0506] 2) The activity of the same siRNA sequence modified with different modification templates varies greatly. For example, the inhibition rate of the base sequence 51 modified with the disclosed modification templates DV26 and DV27 can be increased by up to 22.8% compared with the modification sequence modified with the disclosed modification templates DV30 and DV31, which is a significant improvement; the inhibition rate can be increased by up to 21.3% compared with the modification sequence modified with the disclosed Advanced ESC templates DV21 and DV22, which is a significant improvement.

[0507] 3) The activity of siRNA sequences modified with different templates varies greatly, up to 20%. Therefore, it is uncertain which template modification can produce high activity for siRNA sequences.

[0508] (3) Basic sequence 81

[0509] Table 16 PCSK9 gene inhibition rate after template modification of basic sequence 81

[0510]

[0511] I. Modification using the DV25-29 template disclosed herein

[0512] The base sequence 81 was modified with the templates DV25-29 designed by the present disclosure, and the inhibition rate of the PCSK9 gene exceeded 80%. Compared with the alternating modification of 2' methoxy and 2' fluorine, the inhibition rate of the PCSK9 gene was significantly improved. For example, after modification with templates DV26 and DV27, the inhibition rates of P92-si81-DV26 and P92-si81-DV27 were increased by 26.9% and 24.7%, respectively.

[0513] II. Other modified templates disclosed herein

[0514] After the basic sequence 81 was modified with templates DV30 and DV31, the inhibition rates of P92-si81-DV30 and P92-si81-DV31 on the PCSK9 gene were 71.6% and 73.5%, respectively, which were 9.2% and 11.1% higher than those of the corresponding alternatively modified sequences.

[0515] By using the modified templates DV26 and DV27 modified sequences disclosed herein, the inhibition rates of P92-si81-DV26 and P92-si81-DV27 were significantly improved by 17.7% and 15.5% compared with P92-si81-DV30, and by 15.8% and 13.6% compared with P92-si81-DV31, respectively.

[0516] III. Prior art has disclosed Advanced ESC templates DV21 (fluorinated sites: antisense strand 2, 6, 14 and 16, sense strand 7, 9, 10, 11, 16 and 17) and DV22 (fluorinated sites: antisense strand 2, 6, 14 and 16, sense strand 7, 9, 10 and 11)

[0517] After the basic sequence 81 was modified with templates DV21 and DV22, the inhibition rates of P92-si81-DV21 and P92-si81-DV22 on the PCSK9 gene were 78.3% and 75.1%, respectively, which were 15.9% and 12.7% higher than those of the alternatively modified sequences.

[0518] By using the modified templates DV26 and DV27 modified sequences disclosed herein, the inhibition rates of P92-si81-DV26 and P92-si81-DV27 were significantly improved by 11.0% and 8.8% compared with P92-si81-DV21, and by 14.2% and 12.0% compared with P92-si81-DV22, respectively.

[0519] From this we can see that:

[0520] 1) The base sequence 81 adopts the modified sequence DV25-29 of the disclosed modification template, and compared with the alternating modified sequence, the inhibitory effect on the PCSK9 gene is significantly improved. For example, the base sequence 81 adopts the DV26 modified sequence, and the inhibition rate is increased by 26.9% compared with the alternating modified sequence.

[0521] 2) The activity of the same siRNA sequence after being modified with different modification templates is very different. For example, the inhibition rate of the base sequence 81 can be increased by up to 17.7% compared with the modification sequence using the disclosed modification templates DV26 and DV27, which is significantly improved; compared with the modification sequence using the disclosed Advanced ESC templates DV21 and DV22, the inhibition rate can be increased by up to 14.2%, which is significantly improved.

[0522] 3) The activity of siRNA sequences modified with different templates varies greatly, up to 20%. Therefore, it is uncertain which template modification can produce high activity in siRNA sequences.

[0523] (4) Basic sequence 82

[0524] Table 17 PCSK9 gene inhibition rate after template modification of basic sequence 82

[0525]

[0526] I. DV25-29 Template of the Present Disclosure

[0527] The base sequence 82 was modified with the modification templates DV25-29 designed by the present disclosure, and the inhibition rate of the PCSK9 gene exceeded 80%. Compared with the alternating modification of 2' methoxy and 2' fluorine, the inhibition rate of the PCSK9 gene was significantly improved. For example, after modification with templates DV27 and DV29, the inhibition rates of P92-si82-DV27 and P92-si82-DV29 increased by 19.6% and 19.4%, respectively.

[0528] II. Other modified templates disclosed herein

[0529] After the basic sequence 82 was modified with templates DV30 and DV31, the inhibition rates of P92-si82-DV30 and P92-si82-DV31 on the PCSK9 gene were 70.2% and 69.7%, respectively, which were comparable to the corresponding alternatively modified sequences.

[0530] By using the modified templates DV27 and DV29 modified sequences disclosed herein, the inhibition rates of P92-si82-DV27 and P92-si82-DV29 were significantly improved by 19.1% and 18.9% compared with P92-si82-DV30, and by 19.6% and 19.4% compared with P92-si82-DV31, respectively.

[0531] III. Prior art has disclosed Advanced ESC templates DV21 (fluorinated sites: antisense strand 2, 6, 14 and 16, sense strand 7, 9, 10, 11, 16 and 17) and DV22 (fluorinated sites: antisense strand 2, 6, 14 and 16, sense strand 7, 9, 10 and 11)

[0532] After the basic sequence 82 was modified with templates DV21 and DV22, the inhibition rates of P92-si82-DV21 and P92-si82-DV22 on the PCSK9 gene were 76.5% and 75.4%, respectively, which were 6.8% and 5.7% higher than those of the alternatively modified sequences.

[0533] By using the modified templates DV27 and DV29 of the present invention to modify the sequences, the inhibition rates of P92-si82-DV27 and P92-si82-DV29 were significantly improved by 12.8% and 12.6% compared with P92-si82-DV21, and by 13.9% and 13.7% compared with P92-si82-DV22, respectively.

[0534] From this we can see that:

[0535] 1) The base sequence 82 uses the modified sequence DV25-29 of the disclosed modification template, and compared with the alternating modified sequence, the inhibitory effect on the PCSK9 gene is significantly improved. For example, the base sequence 82 uses the DV27 modified sequence, and the inhibition rate is 19.6% higher than that of the alternating modified sequence.

[0536] 2) The activity of the same siRNA sequence after being modified with different modification templates is very different. For example, the inhibition rate of the basic sequence 82 can be increased by up to 19.6% compared with the modification sequence using the disclosed modification templates DV27 and DV29, which is significantly improved; compared with the modification sequence using the disclosed Advanced ESC templates DV21 and DV22, the inhibition rate can be increased by up to 13.9%, which is significantly improved.

[0537] 3) The activity of siRNA sequences modified with different templates varies greatly, up to 20%. Therefore, it is uncertain which template modification can produce high activity in siRNA sequences.

[0538] (5) Basic sequence 84

[0539] Table 18 PCSK9 gene inhibition rate after template modification of basic sequence 84

[0540]

[0541] I. DV25-29 Template of the Present Disclosure

[0542] The base sequence 84 was modified with the modification templates DV25-29 designed by the present disclosure, and the inhibition rate of the PCSK9 gene exceeded 85%. Compared with the alternating modification of 2' methoxy and 2' fluorine, the inhibition rate of the PCSK9 gene was significantly improved. For example, after modification with templates DV28 and DV29, the inhibition rates of P92-si84-DV28 and P92-si84-DV29 were increased by 26.8% and 25.9%, respectively.

[0543] II. Other modified templates disclosed herein

[0544] After the basic sequence 84 was modified with templates DV30 and DV31, the inhibition rates of P92-si84-DV30 and P92-si84-DV31 on the PCSK9 gene were 70.3% and 72.4%, respectively, which were 8.7% and 10.8% higher than those of the corresponding alternatively modified sequences.

[0545] By using the modified templates DV28 and DV29 of the present invention to modify the sequences, the inhibition rates of P92-si84-DV28 and P92-si84-DV29 were significantly improved by 18.1% and 17.2% compared with P92-si84-DV30, and by 16.0% and 15.1% compared with P92-si84-DV31, respectively.

[0546] III. Prior art has disclosed Advanced ESC templates DV21 (fluorinated sites: antisense strand 2, 6, 14 and 16, sense strand 7, 9, 10, 11, 16 and 17) and DV22 (fluorinated sites: antisense strand 2, 6, 14 and 16, sense strand 7, 9, 10 and 11)

[0547] After the basic sequence 84 was modified with templates DV21 and DV22, the inhibition rates of P92-si84-DV21 and P92-si84-DV22 on the PCSK9 gene were 77.7% and 75.1%, respectively, which were 16.1% and 13.5% higher than those of the alternatively modified sequences.

[0548] By using the modified templates DV28 and DV29 modified sequences disclosed herein, the inhibition rates of P92-si84-DV28 and P92-si84-DV29 were significantly improved by 10.7% and 9.8% compared with P92-si84-DV21, and by 13.3% and 12.4% compared with P92-si84-DV22, respectively.

[0549] From this we can see that:

[0550] 1) The base sequence 84 adopts the modified sequence DV25-29 of the disclosed modification template, and compared with the alternating modified sequence, the inhibitory effect on the PCSK9 gene is significantly improved. For example, the base sequence 84 adopts the DV28 modified sequence, and the inhibition rate is increased by 26.8% compared with the alternating modified sequence.

[0551] 2) The activity of the same siRNA sequence after being modified with different modification templates is very different. For example, the inhibition rate of the base sequence 84 can be increased by up to 18.1% compared with the modification sequence using the disclosed modification templates DV28 and DV29, which is significantly improved; compared with the modification sequence using the disclosed Advanced ESC templates DV21 and DV22, the inhibition rate can be increased by up to 13.3%, which is significantly improved.

[0552] 3) The activity of siRNA sequences modified with different templates varies greatly, up to 20%. Therefore, it is uncertain which template modification can produce high activity in siRNA sequences.

[0553] (6) Basic sequence 3

[0554] Table 19 PCSK9 gene inhibition rate after template modification of basic sequence 3

[0555]

[0556] 1) The base sequence 3 was modified with the modification templates DV25-29 designed in the present disclosure, and the inhibition rate of the PCSK9 gene exceeded 75%. Compared with the alternating modification of 2'-methoxy and 2'-fluorine, the inhibition rate of the PCSK9 gene was significantly improved. For example, after modification with templates DV28 and DV29, the inhibition rates of P92-si3-DV28 and P92-si3-DV29 increased by 24.0% and 24.7%, respectively.

[0557] 2) It can be seen that the basic sequence 3 using the modified template DV25-29 modified sequence disclosed herein has significantly improved the inhibitory activity on the PCSK9 gene compared with the use of alternating modifications.

[0558] (7) Basic sequence 8

[0559] Table 20 PCSK9 gene inhibition rate after template modification of basic sequence 8

[0560]

[0561] 1) The base sequence 8 was modified with the modification templates DV25-29 designed in the present disclosure, and the inhibition rate of the PCSK9 gene exceeded 75%. Compared with the alternating modification of 2'-methoxy and 2'-fluorine, the inhibition rate of the PCSK9 gene was significantly improved. For example, after modification with templates DV27 and DV28, the inhibition rates of P92-si8-DV27 and P92-si8-DV28 increased by 19.7% and 20.2%, respectively.

[0562] 2) It can be seen that the basic sequence 8 modified with the disclosed modification template DV25-29 has significantly improved the inhibitory activity on the PCSK9 gene compared with the alternating modification.

[0563] (8) Basic sequence 9

[0564] Table 21 PCSK9 gene inhibition rate after template modification of basic sequence 9

[0565]

[0566] 1) The base sequence 9 was modified with the modification templates DV25-29 designed in the present disclosure, and the inhibition rate of the PCSK9 gene exceeded 70%. Compared with the alternating modification of 2'-methoxy and 2'-fluorine, the inhibition rate of the PCSK9 gene was significantly improved. For example, after modification with templates DV27 and DV28, the inhibition rates of P92-si9-DV27 and P92-si9-DV28 increased by 27.2% and 25.4%, respectively.

[0567] 2) It can be seen that the basic sequence 9 modified with the disclosed modification template DV25-29 has significantly improved the inhibitory activity on the PCSK9 gene compared with the alternating modification.

[0568] (9) Basic sequence 21

[0569] Table 22 PCSK9 gene inhibition rate after template modification of basic sequence 21

[0570]

[0571] 1) The base sequence 21 was modified with the modification templates DV25-29 designed in the present disclosure, and the inhibition rate of the PCSK9 gene exceeded 70%. Compared with the alternating modification of 2'-methoxy and 2'-fluorine, the inhibition rate of the PCSK9 gene was significantly improved. For example, after modification with templates DV25 and DV26, the inhibition rates of P92-si21-DV25 and P92-si21-DV26 increased by 24.4% and 26.5%, respectively.

[0572] 2) It can be seen that the basic sequence 21 modified with the modified template DV25-29 disclosed in the present invention has significantly improved the inhibitory activity on the PCSK9 gene compared with the alternating modification.

[0573] (10) Basic sequence 31

[0574] Table 23 PCSK9 gene inhibition rate after template modification of basic sequence 31

[0575]

[0576] 1) The base sequence 31 was modified with the modification templates DV25-29 designed in the present disclosure, and the inhibition rate of the PCSK9 gene exceeded 70%. Compared with the alternating modification of 2'-methoxy and 2'-fluorine, the inhibition rate of the PCSK9 gene was significantly improved. For example, after modification with templates DV25 and DV26, the inhibition rates of P92-si31-DV25 and P92-si31-DV26 increased by 22.9% and 22.6%, respectively.

[0577] 2) It can be seen that the basic sequence 31 modified with the disclosed modification template DV25-29 has significantly improved the inhibitory activity on the PCSK9 gene compared with the alternating modification.

[0578] (11) Basic sequence 73

[0579] Table 24 PCSK9 gene inhibition rate after template modification of base sequence 73

[0580]

[0581] 1) The base sequence 73 was modified with the modification templates DV25-29 designed in the present disclosure, and the inhibition rate of the PCSK9 gene exceeded 70%. Compared with the alternating modification of 2'-methoxy and 2'-fluorine, the inhibition rate of the PCSK9 gene was significantly improved. For example, after modification with templates DV28 and DV29, the inhibition rates of P92-si73-DV28 and P92-si73-DV29 increased by 30.6% and 32.7%, respectively.

[0582] 2) It can be seen that the basic sequence 73 modified with the modified template DV25-29 disclosed in the present invention has significantly improved the inhibitory activity on the PCSK9 gene compared with the use of alternating modifications.

[0583] (12) Basic sequence 83

[0584] Table 25 PCSK9 gene inhibition rate after template modification of basic sequence 83

[0585]

[0586] 1) The base sequence 83 was modified with the modification templates DV25-29 designed in the present disclosure, and the inhibition rate of the PCSK9 gene exceeded 75%. Compared with the alternating modification of 2'-methoxy and 2'-fluorine, the inhibition rate of the PCSK9 gene was significantly improved. For example, after modification with templates DV27 and DV29, the inhibition rates of P92-si83-DV27 and P92-si83-DV29 increased by 30.9% and 29.7%, respectively.

[0587] 2) It can be seen that the basic sequence 83 modified with the disclosed modification template DV25-29 has significantly improved the inhibitory activity on the PCSK9 gene compared with the alternating modification.

[0588] Summarize:

[0589] (1) The selected basic sequences 5, 51, 81, 82, 84, 3, 8, 9, 21, 31, 73 and 83, after being modified with the modification template DV25-29 designed by the present disclosure, had a significant inhibitory effect on PCSK9 gene expression, with inhibition rates of more than 70%. Among them, the inhibition rates of P92-si81-DV26, P92-si82-DV27 and P92-si82-DV29 reached 89.3%, 89.3% and 89.1%.

[0590] (2) The above 12 sequences used the modified sequence DV25-29 of the disclosed modification template, and the inhibition rate of PCSK9 gene expression was significantly improved compared with the alternating modification sequence. For example, the inhibition rate of base sequence 51 using template DV27 to modify sequence P92-si51-DV27 was 29.1% higher than that of the alternating modification sequence, and the inhibition rate of base sequence 81 using template DV26 to modify sequence P92-si81-DV26 was 26.9% higher than that of the alternating modification sequence.

[0591] (3) The same sequence was modified with the disclosed modification template DV25-29, and the inhibition rate of PCSK9 gene expression was significantly improved compared with the modification template disclosed in the prior art. For example, the base sequence 51 was modified with the disclosed modification template DV27, and the inhibition rate was increased by 21.3% compared with the modified sequence with the disclosed Advanced ESC template DV21.

[0592] (4) The same sequence was modified with the modification templates DV25-29 disclosed herein, and the inhibition rate of PCSK9 gene expression was significantly improved compared with that with the other modification templates DV30 and DV31 disclosed herein. For example, the base sequence 51 was modified with the modification template DV27 disclosed herein, and the inhibition rate was increased by 22.8% compared with that with the modification template DV31 disclosed herein.

[0593] (5) The activity of modified sequences with different templates varies greatly. For example, the inhibition rate of base sequence 5 modified with DV26 increased by 22.5% compared with that of base sequence 5 modified with DV31; the inhibition rate of base sequence 51 modified with DV27 increased by 20.5% compared with that of base sequence 51 modified with DV22. Therefore, it is uncertain which modification template can produce high activity for siRNA sequences.

[0594] (ii) EC50 experiment

[0595] Some template modification sequences were selected, including P92-si5-DV26, P92-si51-DV25, P92-si81-DV27, P92-si82-DV27, P92-si84-DV26, P92-si3-DV28, P92-si8-DV29, P92-si9-DV28, P92-si21-DV25, P92-si31-DV27, P92-si73-DV28 and P92-si83-DV26, a total of 12 sequences, and EC50 experiments were carried out to determine the EC50 concentration of each sequence. The experimental results are shown in Table 26.

[0596] Table 26 EC50 experimental results of each modified sequence

[0597]

[0598]

[0599] As can be seen from Table 26, the EC50 values ​​of these 12 sequences are between 0.0001 nM and 0.005 nM. Among them, the EC50 values ​​of P92-si81-DV27, P92-si84-DV26 and P92-si82-DV27 are 0.0003 nM, 0.0004 nM and 0.0006 nM, respectively. This shows that these sequences can effectively inhibit PCSK9 gene expression at low concentrations.

[0600] Example 5: Comparison of the inhibitory effect of the sequences disclosed in the prior art on the PCSK9 gene

[0601] In this example, the unmodified sequences disclosed in the prior art that are identical or similar to the basic sequences 3, 5, 8, 9, 31, 81, 82, 83 and 84 of the present disclosure are compared with the inhibitory efficiency of the PCSK9 gene with the alternating modified sequences of the present disclosure and the sequences modified using the DV25-29 template.

[0602] 1. Experimental Materials

[0603] Test samples:

[0604] (1) Prior art public sequence

[0605]

[0606]

[0607]

[0608]

[0609] Cell type: Hep3B cells, provided by Shanghai WuXi AppTec New Drug Development Co., Ltd. (ATCC-tings-1618164).

[0610] Hep3B cells were cultured in EMEM medium (ATCC-30-2003) containing 10% fetal bovine serum (FBS, ExCell Bio-FSP500), 1% penicillin-streptomycin (HyClone-SV30010), 1% non-essential amino acid solution (Gibco-11140-050), and 1% GlutaMAX supplement (Gibco-35050-061).

[0611] Drug solvent: sterile enzyme-free water, Gibco DMEM.

[0612] 2. Experimental methods

[0613] qRT-PCR was used to detect the inhibitory effect of the test samples on the expression of PCSK9 gene mRNA in HEP3B cell line.

[0614] 2.1 Cell culture

[0615] Take the subcultured Hep3B cell line, and culture the logarithmically growing cells with 10% fetal bovine serum RPMI 1640 culture medium (supplemented with 100 μL / mL of penicillin and streptomycin), place them in a cell culture incubator at 37°C with 5% CO2, and change the medium once a day. Digest and subculture with 0.25% trypsin, centrifuge at 1000 r / min for 5 min, discard the supernatant, and add fresh culture medium for subculture.

[0616] 2.2 Cell transfection

[0617] Take 2 μL siRNA (1 μg / μL) and add 18 μL sterile enzyme-free water according to 1:0.06 (wt / wt), mix well, and then add 22 μL of prepared LNP. Mix well and let stand at room temperature for 15 min. Take 12.5 μL for encapsulation efficiency detection. The final transfection volume per well = (1 μg theoretical sample volume / siRNA purity) / drug loading concentration, and the final siRNA concentration is 0.05 nM.

[0618] Negative control group: Add 22 μL of prepared LNP to 20 μL of sterile enzyme-free water, mix well, and let stand at room temperature for 15 minutes.

[0619] After mixing using the cross method, the cells were placed in a 37°C, 5% CO2 cell culture incubator and cultured for 40 h.

[0620] 2.3 PCSK9 mRNA detection

[0621] 1) RNA extraction

[0622] The steps are the same as "1) RNA extraction" in "2.3 PCSK9 mRNA detection" in Example 2.

[0623] 2) RNA concentration detection

[0624] The steps are the same as those in “2) RNA concentration detection” in “2.3 PCSK9 mRNA detection” in Example 2.

[0625] 3) PCSK9 mRNA quantitative detection

[0626] In a 15 mL centrifuge tube, add the remaining components except primers and template in 7.5×48=360 portions, marked as A.

[0627] Label 1.5 mL EP tubes, add 77 μL of A and 420 ng of total RNA to each tube, mix well and set aside.

[0628] The upstream and downstream primers of the internal reference gene GAPDH and the target gene PCSK9 were mixed and set aside.

[0629] Add 11 μL of B and 1 μL of C to each well of the PCR plate, cover with a sealing film, centrifuge at 3000 rpm for 1 min, and load onto the machine.

[0630] *This step is performed on ice to maintain low temperature conditions.

[0631] Place the plate into the qPCR instrument and run the following program:

[0632] Reverse transcription: 55°C, 15 min;

[0633] Pre-denaturation: 95°C, 30 sec;

[0634] Cyclic reaction: 95°C, 10 sec; 60°C, 35 sec; 40 cycles;

[0635] Melting curve: 95℃, 15 sec; 60℃, 60 sec; 95℃, 15 sec.

[0636] The running time is about 2h. Analyze the experimental results and calculate 2-ΔΔCt.

[0637] 2.4 Data Processing

[0638] The PCSK9 mRNA expression rate (%) was calculated as follows:

[0639] Expression rate = (PCSK9 mRNA expression in the experimental group / PCSK9 mRNA expression in the blank control group) × 100%;

[0640] PCSK9 gene expression inhibition rate = 1-expression rate (%).

[0641] 3. Experimental results

[0642] The specific experimental results are shown in Tables 29 and 30.

[0643] The experimental results show that the alternating modified sequences and sequences modified with a specific modification template disclosed in the present invention have significantly improved PCSK9 inhibitory activity compared to the same or similar unmodified sequences disclosed in the prior art. For example, the inhibition rate of the completely identical unmodified sequence si84 is 38.6%, and the inhibition rate after alternating modification is 61.6%, which is 23.0% higher than that of the unmodified sequence si84. After modification with the modification template DV26 disclosed in the present invention, the inhibition rate reached 86.8%, which is 48.2% higher than that of the unmodified sequence.

[0644] Compared with the sequence si31 disclosed in the prior art, the only difference between the sequence 31P disclosed in the present invention and the sequence si31 is that the 3' end of the antisense strand is missing two bases UG, and the rest are exactly the same. However, the inhibition rate of the unmodified sequence si31 disclosed in the present invention is 10.4% higher than that of 31P, and the inhibition rate of the alternatively modified sequence is 59.5%, which is 21.2% higher than that of 31P. After modification with the modified template DV26 disclosed in the present invention, the inhibition rate reached 80.2%, which is 41.9% higher than that of 31P.

[0645] (1) Compared with the identical unmodified sequences disclosed in the prior art, the alternating modified sequences disclosed in the present invention and the modified sequences using specific modification templates significantly improve the inhibition rate of the PCSK9 gene, which can be increased by up to 40%.

[0646] Compared with the identical sequences disclosed in the prior art, the alternating modified sequences and sequences modified with specific modification templates disclosed in the present invention significantly improve the inhibition rate of the PCSK9 gene. For example, the inhibition rate of the unmodified sequence si84 is 38.6%, and the inhibition rate after alternating modification is 61.6%, which is 23.0% higher than that of the unmodified sequence si84. After modification with the modification template DV26 disclosed in the present invention, the inhibition rate reaches 86.8%, which is 48.2% higher than that of the unmodified sequence.

[0647] Table 29 Inhibition rate of PCSK9 gene by identical sequences in the prior art

[0648]

[0649] The unmodified sequences si81, si84, si3, si8, si9 and si83 disclosed in the prior art in Table 29 are exactly the same as the sequences disclosed in the present invention. After modification with alternating modification and modification templates disclosed in the present invention, the inhibitory effect on PCSK9 is significantly improved. For example, the inhibition rate of the unmodified sequence si84 is 38.6%. After alternating modification, the inhibition rate of P92-si84 is 61.6%, which is 23.0% higher than that of the unmodified sequence si84. After modification with the modification templates disclosed in the present invention DV25-29, the inhibition rates of P92-si84-DV25, P92-si84-DV26, P92-si84-DV27, P92-si84-DV28 and P92-si84-DV29 reached 84.9%, 86.8%, 84.5%, 86.2% and 86.4%, respectively, which are all more than 40% higher than that of the unmodified sequence si84.

[0650] (2) Compared with the unmodified sequences disclosed in the prior art with only minor differences, the unmodified sequences, alternatively modified sequences and sequences modified with specific modification templates disclosed in the present invention significantly improve the inhibition rate of the PCSK9 gene, which can be increased by up to 40%.

[0651] Compared with the sequences disclosed in the prior art with only minor differences, the unmodified sequences, the alternating modified sequences and the sequences modified with the specific modification templates disclosed in the present invention have significantly improved the inhibition rate of the PCSK9 gene. For example, the inhibition rate of the unmodified sequence 31P is 38.3%, the inhibition rate of the unmodified sequence si31 with a similar sequence disclosed in the present invention is 48.7%, which is 10.4% higher than 31P, the inhibition rate of the alternating modified sequence is 59.5%, which is 21.2% higher than 31P, and after modification with the modification template DV26 disclosed in the present invention, the inhibition rate reaches 80.2%, which is 41.9% higher than 31P.

[0652]

[0653] I. Sequence Alignment

[0654] The sequences of the prior art disclosed sequences 5P, 31P and 82P in Table 30 are very close to the sequences si5, si31 and si82 disclosed in the present invention, with only small differences. The specific comparison is shown in the table below:

[0655] Table 31 Comparison of sequences disclosed in the prior art and sequences disclosed in the present invention

[0656]

[0657] It can be seen from Table 31 that, compared with the sequence si5 of the present disclosure, the sequence 5P disclosed in the prior art only has two less bases GG at the 3' end of the antisense chain; compared with the sequence si31 of the present disclosure, the sequence 31P only has two less bases UG at the 3' end of the antisense chain; compared with the sequence si82 of the present disclosure, the sequence 82P only has two less bases AA at the 3' end of the antisense chain, and the other sequences are exactly the same.

[0658] II. Activity comparison

[0659] 1) The activity of the unmodified sequence disclosed in the present invention is significantly improved compared with the similar unmodified sequence disclosed in the prior art. For example, the inhibition rate of the unmodified sequence si31 disclosed in the present invention is 10.4% higher than that of the structurally similar 31P.

[0660] The unmodified sequence si5 disclosed in the present invention has an inhibition rate of 50.1% on the PCSK9 gene, which is 8.3% higher than the similar sequence 5P disclosed in the prior art (inhibition rate is 41.8%), a significant improvement.

[0661] The unmodified sequence si82 disclosed in the present invention has an inhibition rate of 53.8% on the PCSK9 gene, which is 7.1% higher than the similar sequence 82P disclosed in the prior art (inhibition rate of 46.7%), a significant improvement.

[0662] The unmodified sequence si31 disclosed in the present invention has an inhibition rate of 48.7% on the PCSK9 gene, which is 10.4% higher than the similar sequence 31P disclosed in the prior art (inhibition rate is 38.3%), a significant improvement.

[0663] 2) The activity of the alternatively modified sequence disclosed in the present invention is significantly improved compared with the similar unmodified sequence disclosed in the prior art. For example, compared with the sequence 5P, the inhibition rate of the alternatively modified sequence P92-si5 disclosed in the present invention is increased by 22.0%.

[0664] After the basic sequence 5 disclosed in the present invention is alternately modified, the inhibition rate of P92-si5 on the PCSK9 gene is 63.8%, which is 22.0% higher than that of the unmodified sequence 5P disclosed in the prior art, which is a significant improvement.

[0665] After the basic sequence 82 disclosed in the present invention is alternately modified, the inhibition rate of P92-si82 on the PCSK9 gene is 68.3%, which is 21.6% higher than that of the unmodified sequence 82P disclosed in the prior art, which is a significant improvement.

[0666] After the basic sequence 31 disclosed in the present invention is alternately modified, the inhibition rate of P92-si31 on the PCSK9 gene is 59.5%, which is 21.2% higher than the unmodified sequence 31P disclosed in the prior art, which is a significant improvement.

[0667] 3) The activity of the sequences modified by the modified template disclosed in the present invention is significantly improved compared with the similar unmodified sequences disclosed in the prior art. For example, compared with the sequence 82P, the inhibition rate of the alternately modified sequence P92-si82-DV29 disclosed in the present invention is increased by 42.8%.

[0668] After the basic sequence 5 of the present disclosure is modified with the modification templates 25-29, the inhibition rate can be increased by more than 30% compared with the unmodified sequence 5P disclosed in the prior art. For example, P92-si5-DV27 increased by 40.8%, which is a significant improvement.

[0669] After the basic sequence 82 of the present disclosure is modified with the modification templates 25-29, the inhibition rate can be increased by more than 30% compared with the unmodified sequence 82P disclosed in the prior art. For example, P92-si82-DV29 increased by 42.8%, which is a significant improvement.

[0670] After the basic sequence 31 of the present disclosure is modified with the modification templates 25-29, the inhibition rate can be increased by more than 30% compared with the unmodified sequence 31P disclosed in the prior art. For example, P92-si31-DV26 increased by 41.9%, which is a significant improvement.

[0671] It can be seen that compared with similar unmodified sequences in the prior art, the unmodified sequences disclosed herein, and the alternatingly modified and template-modified sequences disclosed herein can significantly enhance the inhibitory activity against PCSK9, and the inhibition rate can be increased by up to 40%.

[0672] Summarize:

[0673] (1) Compared with the identical sequences disclosed in the prior art, the alternatively modified sequences and sequences modified with a specific modification template disclosed in the present invention have significantly improved the inhibitory effect on the PCSK9 gene. For example, the inhibition rate of the unmodified sequence si84 was 38.6%, and the inhibition rate after the alternative modification was 61.6%, which was 23.0% higher than that of the unmodified sequence si84. After modification with the modification template DV26 disclosed in the present invention, the inhibition rate reached 86.8%, which was 48.2% higher than that of the unmodified sequence.

[0674] (2) Compared with similar sequences disclosed in the prior art, the unmodified sequences, alternating modified sequences and sequences modified using a specific modification template disclosed in the present invention have significantly improved inhibitory effects on the PCSK9 gene. For example, the unmodified sequence si31 disclosed in the present invention has an inhibition rate increased by 10.4% compared with 31P, which is similar to the sequence disclosed in the prior art. The sequence si5 disclosed in the present invention is alternatingly modified into the sequence P92-si5, which has an inhibition rate increased by 22.0% compared with the unmodified sequence 5P, which is similar to the si5 sequence disclosed in the prior art. The sequence si82 disclosed in the present invention is the sequence P92-si82-DV29 modified using the modification template DV29 disclosed in the present invention, which has an inhibition rate increased by 42.8% compared with the unmodified sequence 82P, which is similar to the si82 sequence disclosed in the prior art.

[0675] Example 6: Inhibitory effect of sequences designed to prevent off-target genes on PCSK9 and off-target genes

[0676] In the actual application of siRNA, there are a lot of cases where the expression of non-target mRNA that is only partially complementary to the guide strand (antisense strand) is inhibited. Research by Alnylam has shown that the hepatotoxicity of n-acetylgalactosamine (GalNAc)-coupled siRNA is mainly attributed to the gene inhibition of the wrong target caused by the off-target effect through a recognition mechanism similar to microRNA (miRNA).

[0677] To solve this problem, Alnylam placed a glycol nucleic acid (GNA) modification at position 7 of the antisense strand of siRNA in its latest fifth-generation template design to disrupt the seed region of the antisense strand, thereby significantly reducing off-target effects and alleviating hepatotoxicity. Such modifications can affect the binding of siRNA to non-designed targets through seed region recognition, thereby inhibiting off-target effects.

[0678] Natural 5'-end phosphorylation or simple direct 5'-end phosphorylation may be dephosphorylated in cells. Direct 5'-end phosphorylated oligonucleotide chains can be 90% dephosphorylated after circulating in the blood for 2 hours and completely disappear after 24 hours. The 5'-end phosphorylation design (5'-E-VP) uses E-vinylphosphonate to replace the bridging oxygen, which has the best phosphorylation effect and higher stability.

[0679] In summary, in order to reduce the off-target effect of the sequence and examine the effect of 5' end phosphorylation on the off-target effect, this example uses the basic sequences 5, 51, 81 and 84 modified with DV25-29, and adds 5'-E-VP modification and 7-position GNA anti-off-target modification at the 5' end of the antisense strand.

[0680] In addition, the sequences P92-si3, P92-si8, P92-si21, P92-si31, P92-si73 and P92-si83 modified with alternating 2'-methoxy and 2'-fluoro, and the above sequences P92-si3+, P92-si8+, P92-si21+, P92-si31+, P92-si73+ and P92-si83+ containing the antisense strand 7-position GNA anti-off-target modification design were compared to detect off-target effects.

[0681] The experimental results show that at a concentration of 10 nM, the sequences designed with anti-off-target effects have a significant inhibitory effect on the target gene PCSK9, and the inhibitory effect on off-target genes is significantly reduced. This shows that the use of anti-off-target design will not affect the inhibitory effect of the disclosed alternating modification and template modification sequences on the PCSK9 gene, but can significantly inhibit the off-target effect.

[0682] 1. Experimental Materials

[0683] 1) Test samples:

[0684] Alternating modified sequences: Alternating modified sequences P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si73 and P92-si83 were used.

[0685] Sequences of alternating modifications and anti-off-target design: P92-si3+, P92-si8+, P92-si9+, P92-si21+, P92-si31+, P92-si73+, and P92-si83+ (Table 32).

[0686] The basic sequences 5, 84, 81 and 51 used template-modified sequences, sequences using template modification and 5'-E-VP modification, sequences using template modification and anti-off-target design, and sequences using template modification, 5'-E-VP modification and anti-off-target design (Table 33).

[0687] 2) Sequence synthesis:

[0688] I. Alternating Modified Sequences and Template Modified Sequences

[0689] The synthesis method is as in Example 1.

[0690] II. siRNA sequences containing 5'-E-VP

[0691] Referring to Example 1, the siRNA sequence was synthesized. When synthesizing the base at the 5' end of the antisense strand (the last base), a monomer containing a phosphonic acid group at the 5' end was used, for example, vinyl-(E)-phosphonate-A-OMe phosphoramidite monomer (Formula 9), vinyl-(E)-phosphonate-U-OMe phosphoramidite monomer (Formula 10), and the structure thereof is exemplified as follows:

[0692]

[0693] III. siRNA sequences with anti-off-target design

[0694] The siRNA sequence was synthesized with reference to Example 1. The GNA monomer was used to synthesize the sequence from the 7th base at the 5' end of the antisense strand. The structure of the GNA monomer is as follows:

[0695]

[0696]

[0697]

[0698]

[0699] Cell type: Hep3B cells, provided by Shanghai WuXi AppTec New Drug Development Co., Ltd. (ATCC-tings-1618164).

[0700] Hep3B cells were cultured in EMEM medium (ATCC-30-2003) containing 10% fetal bovine serum (FBS, ExCell Bio-FSP500), 1% penicillin-streptomycin (HyClone-SV30010), 1% non-essential amino acid solution (Gibco-11140-050), and 1% GlutaMAX supplement (Gibco-35050-061).

[0701] Drug solvent: sterile enzyme-free water, Gibco DMEM.

[0702] 2. Experimental methods

[0703] 1) Compound dilution

[0704] For off-target experiments, the test samples were diluted to a concentration of 10 nM and tested in triplicate wells.

[0705] Hep3B cell digestion count:

[0706] Hep3B cells with a density of 80% were taken out, rinsed with Dulbecco's phosphate buffered saline (DPBS), and digested with 0.05% trypsin for 3-10 min. After collecting the cells, they were counted with Countstar Rigel S2 and the number of cells was adjusted to 2×10 5 / mL density.

[0707] 2) Preparation of transfection reagent

[0708] Prepare RNAiMAX transfection reagent, and prepare an appropriate volume in a 15mL centrifuge tube at a ratio of RNAiMAX: Opti-MEM = 3:97, vortex for 15 seconds, mix, and incubate at room temperature for 15 minutes. Add 40 μL RNAiMAX Opti-MEM to each well at the corresponding position, and take 40 μL of the diluted compound of the corresponding concentration and add it to the corresponding well of the dilution plate, mix and incubate for 15 minutes.

[0709] 3) Cell plating

[0710] Hep3B cells (2 × 10 4 cells / well) to a 96-well cell plate, and the siRNA compound was mixed with RNAiMAX Opti-MEM transfection reagent and added to the cells in each well. At the same time, a control group without siRNA compound containing RNAiMAX Opti-MEM was set up.

[0711] Anti-off-target experiment: Take the compound and RNAiMAX Opti-MEM mixture from the dilution plate and add it to a 96-well cell culture plate (20 μL / well), then add 100 μL / well cells to the 96-well plate, and the final volume per well is 120 μL. After plating, place the plate in a 5% CO2, 37 ℃ incubator for 24 h.

[0712] 4) RNA extraction and reverse transcription

[0713] 24 h after transfection, the medium was removed and the cells were collected for RNA extraction. Total RNA was extracted using RNeasy® 96 Kit (QIAGEN-74182) according to the kit instructions. Subsequently, cDNA was synthesized using FastKing RT Kit (WithgDNase) (TIANGEN-KR116-02) according to the instructions.

[0714] 5) RT-qPCR

[0715] The target cDNA was detected by qPCR, and GAPDH cDNA was detected in parallel as an internal control. 8 μL of the prepared qPCR reaction solution and 2 μL of sample cDNA were added to 384 wells. The TaqMan qPCR reaction program was: heating at 95 °C for 10 min, then entering the cycle mode, heating at 95 °C for 15 s, then 60 °C for 1 min, for a total of 40 cycles. The SYBR qPCR reaction program was: heating at 50 °C for 2 min, heating at 95 °C for 10 min, then entering the cycle mode, heating at 95 °C for 15 sec, then 60 °C for 1 min, for a total of 40 cycles; the final melting curve was heated at 95 °C for 15 sec, 60 °C for 1 min, and 95°C for 15 sec.

[0716] 6) Data analysis

[0717] The target gene RNA expression level in the sample was calculated based on the Ct value of each sample using the ΔΔCt relative quantitative method. The relative expression of the target gene was expressed as 2-ΔΔCT.

[0718] The calculation formula is as follows:

[0719] ΔCT = average Ct value of target gene - average Ct value of reference gene;

[0720] ΔΔCT = ΔCT (drug-treated group) - ΔCT (RNAiMAX control group);

[0721] Relative expression of target gene mRNA = 2-ΔΔCT

[0722] Inhibition rate = (1 – relative expression level of sample / average expression level of RNAiMAX control) × 100%

[0723] 3. Experimental results

[0724] (1) Different modified sequences all had significant inhibitory effects on the PCSK9 gene. For example, the inhibition rate of the alternating modification P92-si3 reached 75.6%, and the inhibition rate of the template modification and 5'-E-VP modification sequence D84-DV27P was as high as 94.4%.

[0725] The inhibition rates of all tested samples on the PCSK9 gene are shown in Tables 34-36.

[0726] All the alternatively modified sequences had significant inhibitory effects on PCSK9 at a concentration of 10 nM. For example, the inhibition rate of the alternatively modified sequence P92-si3 reached 75.6%.

[0727] I. The alternating modified sequences had a significant inhibitory effect on the PCSK9 gene, with inhibition rates exceeding 60%, with P92-si3 reaching 75.6%.

[0728] Table 34 Inhibition rate of the PCSK9 gene with alternating modified sequences

[0729]

[0730] It can be seen from the above table that at a concentration of 10 nM, the alternating modified sequences P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si51, P92-si73 and P92-si83 all had a significant inhibitory effect on the PCSK9 gene, with inhibition rates exceeding 60%. Among them, P92-si3 had the highest inhibition rate, reaching 75.6%.

[0731] II. The template modification sequence adopts anti-off-target design and / or 5'-E-VP modification, which has a significant inhibitory effect on the PCSK9 gene. For example, the inhibition rate of the template modification and 5'-E-VP modification sequence D84-DV27P is as high as 94.4%.

[0732] Table 35 Inhibition rate of PCSK9 gene by template modification and anti-off-target or / and 5'-E-VP modified sequence

[0733]

[0734] 1) After the base sequences 5, 51, 81 and 84 were modified with the disclosed modification template, they had a significant inhibitory effect on the PCSK9 gene, with an inhibition rate of more than 90%. Moreover, the inhibitory effect was further enhanced compared with the alternating modification sequence. For example, after the base sequence 51 was alternatingly modified, the inhibition rate of P92-si51 was 70.1% (see Table 34), and after modification with the template DV26, the inhibition rate of D51-DV26 reached 90.7%, which was 20.6% higher than that of the alternating modification sequence, significantly improving ( Figure 8 ).

[0735] 2) After template modification, anti-off-target design was performed, which showed significant inhibitory activity on PCSK9 gene expression. For example, the base sequence 84 was modified with template DV26 and then anti-off-target design was performed, and the inhibition rate of D84-DV26+ was as high as 90.1%.

[0736] 3) After template modification, 5'-E-VP modification can enhance the inhibitory effect on PCSK9 gene. For example, the base sequence 84 was modified with template DV27, and the inhibition rate of D84-DV27 was 91.5%. After 5'-E-VP modification, the inhibition rate of D84-DV27P was 94.4%, which was increased by 2.9%.

[0737] 4) After template modification, anti-off-target design and 5'-E-VP modification were performed, and the inhibitory activity on the PCSK9 gene could reach more than 90%. For example, the base sequence 84 was modified with template DV27, and then anti-off-target and 5'-E-VP modifications were performed, and the inhibition rate of D84-DV27+P could reach 90.4%.

[0738] It can be seen that the modified sequence using the modified template DV25-29 disclosed herein can further enhance the inhibitory effect compared to the alternating modified sequence. In addition, the sequence modified using the modified template DV25-29 disclosed herein, followed by anti-off-target design or / and 5'-E-VP modification, has a significant inhibitory effect on PCSK9 gene expression, with an inhibition rate of more than 90%.

[0739] (2) After adopting any one or more of the various modification methods disclosed in the present invention, anti-off-target design is performed, which has a significant anti-off-target effect on off-target genes and reduces the inhibitory effect on off-target genes.

[0740] The experimental results show that:

[0741] 1) The alternating modification or template modification sequence disclosed in the present invention adopts an anti-off-target design, which can reduce the inhibitory effect on off-target genes, that is, it has a significant anti-off-target effect;

[0742] 2) By using the template-modified sequence, anti-off-target design and 5'-E-VP modification, the inhibition rate of off-target genes was significantly reduced, that is, it had a significant anti-off-target effect.

[0743] I. The disclosed alternately modified sequence adopts an anti-off-target design, has a significant anti-off-target effect, and can reduce the inhibition rate of off-target genes by 20%.

[0744] Table 36 Inhibition rate of off-target genes by alternating modification and its anti-off-target modification sequence

[0745]

[0746]

[0747] As can be seen from Table 36, after the alternate modified sequence of the present disclosure adopts the anti-off-target design, the inhibition rate of off-target genes is reduced, and it has an anti-off-target effect. For example, the alternate modified sequence P92-si3+ using the anti-off-target design has a 20.0% lower inhibition rate for the off-target gene AARSD1 and a 20.5% lower inhibition rate for the off-target gene ACAP2 than the sequence P92-si3 without the anti-off-target design, which is significantly reduced.

[0748] II. The modified sequence using the disclosed modification template adopts an anti-off-target design, which has a significant anti-off-target effect and can reduce the inhibition rate of off-target genes by up to 73.6%.

[0749] Table 37 Template modification sequence and its anti-off-target and / or 5'-E-VP modification inhibition rate on off-target genes

[0750]

[0751]

[0752] 1) Only anti-off-target design is used (indicated by "+" in the sequence number)

[0753] After the template-modified sequence was designed to prevent off-target genes, the inhibitory effect on off-target genes was significantly reduced. For example, the inhibition rate of MXD1 gene by D84-DV26+ was reduced by 39.9%, the inhibition rate of PCYOX1 gene by D81-DV25+ was reduced by 54.1%, the inhibition rate of NEPRO gene by D51-DV26+ was reduced by 25.9%, and the inhibition rate of DTWD1 gene by D5-DV25+ was reduced by 10.9%.

[0754] It shows that after the basic sequences 5, 51, 81 and 84 are modified with the modification template designed in the present invention and subjected to the anti-off-target design, they all have significant anti-off-target effects.

[0755] 2) Anti-off-target design and 5'-E-VP modification (indicated by "+P" in the sequence number) are used simultaneously

[0756] The template-modified and 5'-E-VP-modified sequences significantly reduced the inhibition rate of off-target genes, showing a significant anti-off-target effect. For example, the inhibition rate of D84-DV26+P on the off-target gene MXD1 was reduced by 73.6%, the inhibition rate of D81-DV27+P on the off-target gene PCYOX1 was reduced by 31.1%, and the inhibition rate of D51-DV26+P on the off-target gene KIF1B was reduced by 41.6%, which was significantly reduced.

[0757] It shows that after the basic sequences 5, 51, 81 and 84 are modified with the modification template designed by the present disclosure, anti-off-target design and 5'-E-VP modification are simultaneously adopted, there is a significant off-target effect.

[0758] Summarize:

[0759] 1. Different modified sequences all had significant inhibitory effects on the PCSK9 gene. For example, the inhibition rate of the alternating modification P92-si3 reached 75.6%, and the inhibition rate of the template modification and 5'-E-VP modification sequence D84-DV27P was as high as 94.4%.

[0760] (1) The alternating modified sequences had a significant inhibitory effect on the PCSK9 gene, with inhibition rates exceeding 60%, with P92-si3 reaching 75.6%.

[0761] (2) The template modification sequence adopts anti-off-target design and / or 5'-E-VP modification, which has a significant inhibitory effect on the PCSK9 gene. For example, the inhibition rate of the template modification and 5'-E-VP modification sequence D84-DV27P is as high as 94.4%.

[0762] 2. After any one or more of the various modification methods disclosed in the present invention are used for modification, anti-off-target design is performed, which has a significant anti-off-target effect on off-target genes and reduces the inhibitory effect on off-target genes.

[0763] (1) The alternating modified sequence disclosed in the present invention adopts an anti-off-target design, which has a significant anti-off-target effect and can reduce the inhibition rate of off-target genes by 20%.

[0764] (2) The modified sequence of the modified template disclosed herein adopts an anti-off-target design, which has a significant anti-off-target effect and can reduce the inhibition rate of off-target genes by up to 73.6%.

[0765] Example 7: Effects of sequences modified using the disclosed modification template on PCSK9, low-density lipoprotein cholesterol (LDL-C) and total cholesterol (TC) in mouse serum

[0766] This example selects some sequences, including basic sequences 5, 51, 81, 82 and 84, and modifies these sequences, such as using only template modification, using template modification and anti-off-target design at the same time, using template modification and 5'-E-VP modification at the same time, and using template modification, 5'-E-VP and anti-off-target design at the same time. Transgenic mice expressing human PCSK9 gene were used to detect the inhibitory effects of the above sequences on PCSK9, low-density lipoprotein cholesterol (LDL-C) and total cholesterol (TC) in serum at different time points by ELISA.

[0767] 1. Experimental Materials

[0768] Tested drugs:

[0769] Each sequence in Table 38 includes sequences using only template modification, sequences using template modification and anti-off-target design, sequences using template modification and anti-off-target design, and sequences using template modification, 5'-E-VP and anti-off-target design at the same time, and the 3' end of the sense chain of these sequences is coupled to GalNAc ligand G4, G5, G6 or G7:

[0770] ,

[0771] ,

[0772] ,

[0773] .

[0774] The method for coupling the oligonucleotide with the ligand G4, G5, G6 or G7 is the same as the preparation method of conjugate 4, conjugate 5, conjugate 6 and conjugate 7 in Example 3 of patent application CN116854754A, that is, YK-GAL-304, YK-GAL-305, YK-GAL-306 and YK-GAL-307 are coupled with the oligonucleotide. The synthesis method of YK-GAL-304, YK-GAL-305, YK-GAL-306 and YK-GAL-307 is the same as Example 1 of this patent application.

[0775] The oligonucleotide forms a conjugate with the ligand as shown below:

[0776] ,

[0777] ,

[0778] .

[0779] The specific sequences of each sequence are shown in Table 38. G4, G5, G6 and G7 in the sequence number indicate that the sequence is coupled to the GalNAc ligand G4, G5, G6 or G7.

[0780]

[0781]

[0782] Preparation of test drug:

[0783] Drug solvent: PBS buffer

[0784] Preparation conditions: Sterile environment

[0785] Labeling method: The prepared drug preparations are labeled with labels, and the outer packaging is marked with the topic number, name, concentration, quantity, preparation date, preparer, and storage conditions;

[0786] Storage conditions: Prepare immediately before use and store remaining samples at -80℃.

[0787] Experimental Animal Information:

[0788] Species / Strain: hPCSK9 transgenic mice

[0789] Rating: SPF

[0790] Gender: Male

[0791] Quantity: 214

[0792] Age: 4-7 weeks

[0793] Weight: 18~20g

[0794] Source: Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.

[0795] Production license number: SCXK (Su) 2018-0008

[0796] Experimental Animal Ethics Review (IACUC):

[0797] The experimental animals were received and kept at Youji (Tianjin) Pharmaceutical Technology Co., Ltd., with the use license number: SYXK (Jinbin) 2019-0002. This project has been reviewed by the Experimental Animal Ethics Committee of Youji (Tianjin) Pharmaceutical Technology Co., Ltd., and the experimental process was carried out in strict accordance with IACUC requirements to ensure animal welfare.

[0798] Feeding and management:

[0799] Feeding conditions: The experimental animals were received and kept by Youji (Tianjin) Pharmaceutical Technology Co., Ltd., with the license number SYXK (Jinbin) 2019-0002. They were kept in a feeding cage with the specifications of length × width × height = 29.0 cm × 18.5 cm × 13.0 cm; the set temperature range was 20-26℃, the set humidity range was 40%-70%, the air change frequency was not less than 15 times of fresh air / hour, and the artificial lighting was alternating between 12 hours of light and 12 hours of dark.

[0800] The breeding environment conditions are based on the National Standard of the People's Republic of China GB14925-2010, and the environment is controlled by a modular air-conditioning unit.

[0801] Animals were allowed to eat and drink freely. The drinking water bottles and the drinking water in the bottles should be changed at least twice a week. After use, the drinking water bottles should be sterilized by high pressure in a pulse vacuum sterilizer and then reused.

[0802] Animal cages and bedding should be replaced at least once a week. All animal cages and bedding should be sterilized under high pressure in a pulsating vacuum sterilizer before being used in a barrier environment. Animal cages should be cleaned, disinfected and wiped at least once a week.

[0803] The animal breeding and observation room is cleaned and disinfected every day, including the flat racks, floors, tables, etc.

[0804] The disinfectants used in the barrier environment include: 6.67% Sanisol solution, 0.5% 84 disinfectant, 75% disinfectant, and 0.08% Baidusai. The four disinfectants should be used in turn and cannot be mixed.

[0805] Experimental animal feed: SPF rat maintenance feed: produced by Sibeifu (Beijing) Biotechnology Co., Ltd., animal feed production license number is SCXK (Beijing) 2019-0010, issued by Beijing Municipal Science and Technology Commission.

[0806] Feed testing: Each batch of feed has a quality certificate, and the company conducts microbiological testing once a quarter. The feed supplier provides a recent third-party feed testing report every six months. Feed nutrient testing refers to the National Standard of the People's Republic of China GB14924.3-2010, and pollutant index testing refers to the National Standard of the People's Republic of China GB14924.2-2001.

[0807] Drinking water for experimental animals: Drinking water: sterile water prepared by the filtration system, directly filled in drinking bottles.

[0808] Drinking water testing: Our company conducts microbiological testing once a quarter and sends water to a third-party testing agency for water quality testing once a year. Drinking water testing refers to the National Standard of the People's Republic of China GB5749-2006.

[0809] Animal bedding: Corn cob bedding: produced by Sibefor (Beijing) Biotechnology Co., Ltd., animal bedding production license number is SCXK (Beijing) 2019-0004, issued by Beijing Municipal Science and Technology Commission.

[0810] Bedding testing: Our company conducts microbiological testing once a quarter, and the bedding supplier provides at least one third-party bedding testing report every six months. Bedding testing refers to the National Standard of the People's Republic of China GB14924.2-2001.

[0811] 2. Experimental methods

[0812] Dosage design and grouping

[0813] Definition of experimental date: The day on which the animals were administered with the vehicle or the test drug was defined as day 0.

[0814] Grouping and administration: After the experimental animals were adaptively fed, they were randomly divided into a negative control group and a test drug group according to the serum PSCK9 protein content, with 5 animals in each group. The drug was administered by a single subcutaneous injection, with a dose of 6 mg / kg, a volume of 1 mL / kg, and a concentration of 6 mg / mL. The day of administration was recorded as day 0.

[0815] Animals are individually identified by ear tags. Cages are identified by hanging cage cards. Laboratory identification signs are hung at the door of the laboratory. Grouping information is detailed in Table 39.

[0816] Table 39

[0817]

[0818] Detection indicators

[0819] (1) General observation

[0820] The subjects were observed once a day from one week before administration to the end of the experiment.

[0821] Observation content: Observe the animal's death or dying, mental state, behavioral activities, feces characteristics, feed and water supply, etc. beside the cage.

[0822] Test animals: all animals in the negative control group and the test drug group.

[0823] (2) Expression of PCSK9 protein in serum

[0824] Testing time: before dosing on day -3 (day -3), 1 week after dosing on day 7 (1 w), 2 weeks after dosing on day 14 (2 w), 3 weeks after dosing on day 21 (3 w), 4 weeks after dosing on day 28 (4 w), and 5 weeks after dosing on day 35 (5 w).

[0825] PCSK9 protein level detection method: ELISA kit was used for detection; serum samples were prevented from repeated freezing and thawing.

[0826] Test animals: all animals in the negative control group and the test drug group.

[0827] (3) Blood lipid measurement

[0828] Testing time: before administration on day -3 (day -3), 1 week on day 7 (1 w), 2 weeks on day 14 (2 w), 3 weeks on day 21 (3 w), 4 weeks on day 28 (4 w), 5 weeks on day 35 (5 w), about 200 μL of blood was collected from the inner canthus. The whole blood sample was temporarily stored in an ice box before centrifugation, centrifuged at 2~8℃ and a centrifugal force of about 3000 g for 10 minutes, divided into 2 tubes (one of which was about 60 μL, and the remaining serum was stored in the other tube), stored at -70~-86℃ for blood lipid testing.

[0829] (4) Data processing and statistical analysis

[0830] The experimental data were expressed as mean ± standard deviation (Mean ± SD) and analyzed using GraphPad Prism 8.3 analysis software. The LSD test was used to test for homogeneity of variance, and the Dunnett T3 test was used for unequal variance. P < 0.05 was considered statistically significant.

[0831] 3. Experimental results

[0832] Specific experimental results are shown in Tables 40-42.

[0833] It can be seen that these sequences can significantly and continuously inhibit serum PCSK9 protein and significantly reduce serum low-density lipoprotein cholesterol (LDL-C) and serum total cholesterol (TC) levels. For example, the inhibition rates of serum PCSK9 protein in the D81-DV25G7 group reached 83.1%, 82.2% and 70.3% on the 7th, 14th and 28th days, respectively; the serum LDL-C levels in the D82-DV27PG5 group decreased by 32.6%, 35.8% and 21.7% on the 7th, 14th and 28th days, respectively; the serum TC levels in the D82-DV29PG7 group decreased by 32.2%, 26.8% and 19.6% on the 7th, 14th and 28th days, respectively.

[0834] (1) The sequences disclosed herein, such as basic sequences 5, 51, 81, 82 and 84, with different modifications, have a significant inhibitory effect on the expression of PCSK9 protein in serum. For example, the inhibition rates of D81-DV25G7 on days 7, 14 and 28 reached 83.1%, 82.2% and 70.3%, respectively.

[0835] Table 40 Inhibition rate of PCSK9 protein in serum by different sequences

[0836]

[0837] As can be seen from Table 40, the conjugates formed by conjugating each sequence with the GalNAc compound have a significant inhibitory effect on the expression of PCSK9 protein in serum. For example, the inhibition rates of D81-DV25G7 on the 7th, 14th and 28th days were 83.1%, 82.2% and 70.3%, respectively ( Fig. 9 ).

[0838] It shows that the basic sequences designed in the present invention, such as 5, 51, 81, 82 and 84, can be efficiently delivered to animal livers and significantly inhibit PCSK9 gene expression by using the template modification of the present invention, or by using 5'-E-VP modification and / or anti-off-target design at the same time, and conjugated with GalNAc compounds.

[0839] (2) The sequences disclosed herein, such as basic sequences 5, 51, 81, 82 and 84, with different modifications can significantly reduce the level of low-density lipoprotein cholesterol (LDL-C) in serum. For example, the D82-DV27PG5 group reduced the level by 32.6%, 35.8% and 21.7% on the 7th day, 14th day and 28th day, respectively.

[0840] Table 41 Effects of different sequences on the reduction of serum low-density lipoprotein cholesterol (LDL-C)

[0841]

[0842] As can be seen from Table 41, serum LDL-C was significantly reduced in each experimental group. For example, the D82-DV27PG5 group decreased by 32.6%, 35.8% and 21.7% on the 7th, 14th and 28th days, respectively ( Fig.10 ).

[0843] It is shown that the basic sequences designed in the present invention, such as 5, 51, 81, 82 and 84, can be efficiently delivered to animal livers and significantly reduce the level of low-density lipoprotein cholesterol (LDL-C) in serum by using the template modification of the present invention, or simultaneously using 5'-E-VP modification and / or anti-off-target design, and conjugating with GalNAc compounds.

[0844] (3) The sequences disclosed herein, such as basic sequences 5, 51, 81, 82 and 84, can significantly reduce serum total cholesterol (TC) levels by using different modifications. For example, D82-DV29PG7 reduced TC levels by 32.2%, 26.8% and 19.6% on the 7th, 14th and 28th days, respectively.

[0845] Table 42 The effects of different sequences on the reduction of serum total cholesterol (TC)

[0846]

[0847] As can be seen from Table 42, serum total cholesterol (TC) was significantly reduced in each experimental group. For example, the D82-DV29PG7 group decreased by 32.2%, 26.8% and 19.6% on the 7th, 14th and 28th days, respectively ( Fig.11 ).

[0848] It shows that the basic sequences designed in the present invention, such as 5, 51, 81, 82 and 84, modified with the template of the present invention, or simultaneously modified with 5'-E-VP and / or anti-off-target design, and conjugated with GalNAc compounds can be efficiently delivered to animal livers and significantly reduce total cholesterol (TC) levels in serum.

[0849] Summarize:

[0850] The basic sequences designed in the present invention, such as 5, 51, 81, 82 and 84, are modified with the template of the present invention, or are simultaneously modified with 5'-E-VP and / or anti-off-target design, and conjugated with GalNAc compounds. They can be efficiently delivered to the liver of animals, and can significantly and continuously inhibit the expression of PCSK9 protein in serum, and reduce the levels of serum low-density lipoprotein cholesterol (LDL-C) and serum total cholesterol (TC).

[0851] For example, the inhibition rate of PCSK9 protein expression in the serum of the D81-DV25G7 group reached 83.1%, 82.2% and 70.3% on the 7th, 14th and 28th days, respectively; the serum low-density lipoprotein cholesterol (LDL-C) level of the D82-DV27PG5 group decreased by 32.6%, 35.8% and 21.7% on the 7th, 14th and 28th days, respectively; the serum total cholesterol (TC) level of the D82-DV29PG7 group decreased by 32.2%, 26.8% and 19.6% on the 7th, 14th and 28th days, respectively.

[0852] in conclusion:

[0853] The present invention designs a series of siRNAs based on the PCSK9 mRNA sequence, modifies them alternately and with a set of specific modification templates, and performs off-target design and 5'-E-VP modification on some of the sequences. The results show that:

[0854] (1) Unmodified sequences, including basic sequences 5, 51, 81, 82, 84, 3, 8, 9, 21, 31, 73 and 83, all have significant inhibitory effects on PCSK9, with the highest inhibition rate exceeding 60%.

[0855] (2) Using multiple modified sequences, the inhibition rate can reach up to more than 90%. In addition, the modified sequence is conjugated with the GalNAc compound, which can be efficiently delivered to the animal liver and significantly inhibit PCSK9 gene expression, significantly reduce serum low-density lipoprotein cholesterol (LDL-C) levels, and significantly reduce serum total cholesterol (TC) levels.

[0856] The details are as follows:

[0857] 1. The disclosed alternative modified sequence has a significant inhibitory effect on the PCSK9 gene

[0858] (1) Among the 84 designed sequences, 12 sequences had significant inhibitory effects on the PCSK9 gene, with inhibition rates exceeding 50%, including P92-si5, P92-si51, P92-si81, P92-si82, P92-si84, P92-si3, P92-si8, P92-si9, P92-si21, P92-si31, P92-si73 and P92-si83. Among them, the inhibition rates of P92-si5, P92-si81, P92-si82, P92-si3, P92-si8 and P92-si31 exceeded 70%.

[0859] (2) The inhibition rates of the 26 sequences on the PCSK9 gene ranged from 30% to 50%. For example, the inhibition rates of P92-si6 and P92-si7 were 38.3% and 35.7%, respectively.

[0860] (3) The inhibition rates of 46 sequences on the PCSK9 gene were below 30%. For example, the inhibition rates of P92-si1 and P92-si20 were only 9.2% and 6.0%, respectively.

[0861] (4) The activities of siRNAs with similar sequences vary greatly. For example, the inhibition rate of P92-si5 is 61.8% higher than that of P92-si4, which is a significant improvement.

[0862] 2. The unmodified sequence disclosed herein has a significant inhibitory effect on the PCSK9 gene

[0863] (1) 12 unmodified sequences had significant inhibitory effects on the PCSK9 gene, with inhibition rates exceeding 50%, including si5, si51, si81, si82, si84, si3, si8, si9, si21, si31, si73 and si83. Among them, si5, si81, si82, si3 and si8 had inhibition rates exceeding 60%.

[0864] (2) The inhibition rates of other unmodified sequences on the PCSK9 gene were all lower than 40%. For example, the inhibition rates of si52 and si74 were only 0.5% and 2.2% respectively.

[0865] (3) The activities of siRNAs with similar sequences vary greatly. For example, the inhibition rate of base sequence 5 is 51.2% higher than that of base sequence 4, which is a significant improvement.

[0866] (4) The effects on activity of different sequences after alternating modification are not consistent. Some of the inhibition rates are significantly improved, such as the basic sequence 5, where the inhibition rate of the alternating modification is 12.4% higher than that of the unmodified sequence; some are not obvious, such as the basic sequences 4, 22 and 52, where the inhibition rates of the alternating modified sequences and the unmodified sequences are basically unchanged.

[0867] 3. The sequence modified by the modified template disclosed herein has a significant inhibitory effect on the PCSK9 gene

[0868] (1) After modification with the modification template DV25-29 designed by the present disclosure, the basic sequences 5, 51, 81, 82, 84, 3, 8, 9, 21, 31, 73 and 83 had a significant inhibitory effect on PCSK9 gene expression, with the inhibition rate being above 70%. Among them, the inhibition rates of P92-si81-DV26, P92-si82-DV27 and P92-si82-DV29 reached 89.3%, 89.3% and 89.1% respectively.

[0869] (2) The above 12 sequences used the modified sequence DV25-29 of the disclosed modification template, and the inhibition rate of PCSK9 gene expression was significantly improved compared with the alternating modification sequence. For example, the inhibition rate of base sequence 51 using template DV27 to modify sequence P92-si51-DV27 was 29.1% higher than that of the alternating modification sequence, and the inhibition rate of base sequence 81 using template DV26 to modify sequence P92-si81-DV26 was 26.9% higher than that of the alternating modification sequence.

[0870] (3) The same sequence was modified with the disclosed modification template DV25-29, and the inhibition rate of PCSK9 gene expression was significantly improved compared with the modification template disclosed in the prior art. For example, the base sequence 51 was modified with the disclosed modification template DV27, and the inhibition rate was increased by 21.3% compared with the modified sequence with the disclosed Advanced ESC template DV21.

[0871] (4) The same sequence was modified with the modification templates DV25-29 disclosed herein, and the inhibition rate of PCSK9 gene expression was significantly improved compared with that with the other modification templates DV30 and DV31 disclosed herein. For example, the base sequence 51 was modified with the modification template DV27 disclosed herein, and the inhibition rate was increased by 22.8% compared with that with the modification template DV31 disclosed herein.

[0872] (5) The EC50 values ​​of the above 12 sequences ranged from 0.0001 nM to 0.005 nM. Among them, the EC50 values ​​of P92-si81-DV27, P92-si84-DV26 and P92-si82-DV27 were 0.0003 nM, 0.0004 nM and 0.0006 nM, respectively. This indicates that these sequences can effectively inhibit PCSK9 gene expression at low concentrations.

[0873] 4. The sequences modified by alternating modification and modification templates disclosed in the present invention have significantly improved PCSK9 inhibitory activity compared with unmodified sequences that are completely identical to or have very little difference from the sequences disclosed in the prior art.

[0874] (1) Compared with the identical unmodified sequences disclosed in the prior art, the alternating modified sequences disclosed in the present invention and the modified sequences using specific modification templates significantly improve the inhibition rate of the PCSK9 gene, which can be increased by up to 40%.

[0875] (2) Compared with the unmodified sequences disclosed in the prior art with only minor differences, the unmodified sequences, alternatively modified sequences and sequences modified with specific modification templates disclosed in the present invention significantly improve the inhibition rate of the PCSK9 gene, which can be increased by up to 40%.

[0876] I. The activity of the unmodified sequence disclosed in the present invention is significantly improved compared with the similar unmodified sequence disclosed in the prior art. For example, the inhibition rate of the unmodified sequence si31 disclosed in the present invention is increased by 10.4% compared with the structurally similar 31P.

[0877] II. The activity of the alternatively modified sequences disclosed in the present invention is significantly improved compared with the similar unmodified sequences disclosed in the prior art. For example, compared with the sequence 5P, the inhibition rate of the alternatively modified sequence P92-si5 disclosed in the present invention is increased by 22.0%.

[0878] III. The activity of the sequences modified by the modified template disclosed in the present invention is significantly improved compared with the similar unmodified sequences disclosed in the prior art. For example, compared with the sequence 82P, the inhibition rate of the alternately modified sequence P92-si82-DV29 disclosed in the present invention is increased by 42.8%.

[0879] 5. The alternating modified sequence and template modified sequence disclosed in the present invention adopt a specific anti-off-target design, which has a significant inhibitory effect on the PCSK9 gene and significantly reduces the inhibitory effect on off-target genes.

[0880] (1) Different modified sequences all had significant inhibitory effects on the PCSK9 gene. For example, the inhibition rate of the alternating modification P92-si3 reached 75.6%, and the inhibition rate of the template modification and 5'-E-VP modification sequence D84-DV27P was as high as 94.4%.

[0881] I. The alternating modified sequences had a significant inhibitory effect on the PCSK9 gene, with inhibition rates exceeding 60%, with P92-si3 reaching 75.6%.

[0882] II. The template modification sequence adopts anti-off-target design and / or 5'-E-VP modification, which has a significant inhibitory effect on the PCSK9 gene. For example, the inhibition rate of the template modification and 5'-E-VP modification sequence D84-DV27P is as high as 94.4%.

[0883] (2) After adopting any one or more of the various modification methods disclosed in the present invention, anti-off-target design is performed, which has a significant anti-off-target effect on off-target genes and reduces the inhibitory effect on off-target genes.

[0884] I. The disclosed alternately modified sequence adopts an anti-off-target design, has a significant anti-off-target effect, and can reduce the inhibition rate of off-target genes by 20%.

[0885] II. The modified sequence using the disclosed modification template adopts an anti-off-target design, which has a significant anti-off-target effect and can reduce the inhibition rate of off-target genes by up to 73.6%.

[0886] 6. The sequence modified by the modification template disclosed herein can significantly inhibit PCSK9 expression in mouse serum and significantly reduce the levels of low-density lipoprotein cholesterol (LDL-C) and total cholesterol (TC)

[0887] (1) The disclosed basic sequences 5, 51, 81, 82 and 84 were modified differently and had a significant inhibitory effect on the expression of PCSK9 protein in serum. For example, the inhibition rates of D81-DV25G7 on the 7th day, 14th day and 28th day were 83.1%, 82.2% and 70.3%, respectively.

[0888] (2) The disclosed basic sequences 5, 51, 81, 82 and 84 were modified in different ways to significantly reduce the level of low-density lipoprotein cholesterol (LDL-C) in serum. For example, the D82-DV27PG5 group had a decrease of 32.6%, 35.8% and 21.7% on the 7th day, 14th day and 28th day, respectively.

[0889] (3) The disclosed basic sequences 5, 51, 81, 82 and 84 were modified in different ways to significantly reduce the total cholesterol (TC) level in serum. For example, D82-DV29PG7 reduced TC by 32.2%, 26.8% and 19.6% on the 7th, 14th and 28th days, respectively.

Claims

1. A double-stranded RNAi agent for reducing the expression of PCSK9, comprising an oligonucleotide duplex consisting of the following sense strand and antisense strand pairing: The positive strand consists of the sequence shown in SEQ ID NO. 2 or a modified sequence thereof, wherein: The sequence shown in SEQ ID NO. 2 is as follows: UGGAGGCUUAGCUUUCUGGAU; The antisense strand consists of the sequence shown in SEQ ID NO. 14 or a modified sequence thereof, wherein the sequence shown in SEQ ID NO. 14 is as follows: AUCCAGAAAGCUAAGCCUCCAUU.

2. The double-stranded RNAi agent according to claim 1, wherein the chemical modification of the 2' position of each nucleotide ribose is as follows: the odd-numbered positions of the sense chain are all 2'-fluoro modified, and the even-numbered positions are all 2'-methoxy modified; the odd-numbered positions of the antisense chain are all 2'-methoxy modified, and the even-numbered positions are all 2'-fluoro modified.

3. The double-stranded RNAi agent according to claim 1, wherein the 3',5'-phosphodiester bonds connecting the nucleotide monomers are thio-modified.

4. The double-stranded RNAi agent according to claim 3, wherein the double-stranded RNAi agent comprises an oligonucleotide duplex consisting of a sense strand as shown in SEQ ID NO. 170 and an antisense strand as shown in SEQ ID NO. 182, wherein: The sense strand sequence shown in SEQ ID NO. 170 is as follows: Ufs-Gms-Gf-Am-Gf-Gm-Cf-Um-Uf-Am-Gf-Cm-Uf-Um-Uf-Cm-Uf-Gm-Gf-Am-Uf; The antisense strand sequence shown in SEQ ID NO. 182 is as follows: Ams-Ufs-Cm-Cf-Am-Gf-Am-Af-Am-Gf-Cm-Uf-Am-Af-Gm-Cf-Cm-Uf-Cm-Cf-Ams-Ufs-Um; in, Af, Gf, Cf and Uf are 2'-fluoro modified A, G, C and U nucleotides respectively; Am, Gm, Cm and Um are 2'-methoxy modified A, G, C and U nucleotides respectively; s indicates that the 3',5'-phosphodiester bonds connecting the nucleotide monomers are thio-modified.

5. The double-stranded RNAi agent according to claim 1, wherein the double-stranded RNAi agent comprises any oligonucleotide duplex selected from the following sense strand and antisense strand pairing: (1) The sense strand consists of the sequence shown in SEQ ID NO. 342; and the antisense strand consists of the sequence shown in SEQ ID NO. 380, wherein: The sense strand sequence shown in SEQ ID NO. 342 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Af-Gf-Cm-Um-Um-Um-Cm-Uf-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 380 is as follows: Ams-Ufs-Cm-Cm-Am-Gf-Am-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cf-Cm-Um-Cm-Cm-Ams-Ums-Um; (2) The sense strand consists of the sequence shown in SEQ ID NO. 342; and the antisense strand consists of the sequence shown in SEQ ID NO. 381, wherein: The sense strand sequence shown in SEQ ID NO. 342 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Af-Gf-Cm-Um-Um-Um-Cm-Uf-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 381 is as follows: Ams-Ufs-Cf-Cf-Am-Gf-Am-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cf-Cm-Um-Cm-Cm-Ams-Ums-Um; (3) The sense strand consists of the sequence shown in SEQ ID NO. 342; and the antisense strand consists of the sequence shown in SEQ ID NO. 382, ​​wherein: The sense strand sequence shown in SEQ ID NO. 342 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Af-Gf-Cm-Um-Um-Um-Cm-Uf-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 382 is as follows: Ams-Ufs-Cm-Cf-Af-Gf-Am-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cf-Cm-Um-Cm-Cm-Ams-Ums-Um; (4) The sense strand consists of the sequence shown in SEQ ID NO. 343; and the antisense strand consists of the sequence shown in SEQ ID NO. 381, wherein: The sense strand sequence shown in SEQ ID NO. 343 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Am-Gf-Cm-Um-Um-Um-Cm-Uf-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 381 is as follows: Ams-Ufs-Cf-Cf-Am-Gf-Am-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cf-Cm-Um-Cm-Cm-Ams-Ums-Um; (5) The sense strand consists of the sequence shown in SEQ ID NO. 343; and the antisense strand consists of the sequence shown in SEQ ID NO. 382, ​​wherein: The sense strand sequence shown in SEQ ID NO. 343 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Am-Gf-Cm-Um-Um-Um-Cm-Uf-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 382 is as follows: Ams-Ufs-Cm-Cf-Af-Gf-Am-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cf-Cm-Um-Cm-Cm-Ams-Ums-Um; (6) The sense strand consists of the sequence shown in SEQ ID NO. 344; and the antisense strand consists of the sequence shown in SEQ ID NO. 383, wherein: The sense strand sequence shown in SEQ ID NO. 344 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Af-Gf-Cm-Um-Um-Um-Cm-Um-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 383 is as follows: Ams-Ufs-Cm-Cm-Am-Gf-Am-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cm-Cm-Um-Cm-Cm-Ams-Ums-Um; (7) The sense strand consists of the sequence shown in SEQ ID NO. 345; and the antisense strand consists of the sequence shown in SEQ ID NO. 380, wherein: The sense strand sequence shown in SEQ ID NO. 345 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Af-Gm-Cm-Um-Um-Um-Cm-Um-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 380 is as follows: Ams-Ufs-Cm-Cm-Am-Gf-Am-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cf-Cm-Um-Cm-Cm-Ams-Ums-Um; (8) The sense strand consists of the sequence shown in SEQ ID NO. 346; and the antisense strand consists of the sequence shown in SEQ ID NO. 380, wherein: The sense strand sequence shown in SEQ ID NO. 346 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Af-Gf-Cm-Um-Um-Um-Cf-Uf-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 380 is as follows: Ams-Ufs-Cm-Cm-Am-Gf-Am-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cf-Cm-Um-Cm-Cm-Ams-Ums-Um; (9) The sense strand consists of the sequence shown in SEQ ID NO. 344; and the antisense strand consists of the sequence shown in SEQ ID NO. 380, wherein: The sense strand sequence shown in SEQ ID NO. 344 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Af-Gf-Cm-Um-Um-Um-Cm-Um-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 380 is as follows: Ams-Ufs-Cm-Cm-Am-Gf-Am-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cf-Cm-Um-Cm-Cm-Ams-Ums-Um; Among them, Af, Gf, Cf and Uf are 2'-fluoro-modified A, G, C and U nucleotides respectively; Am, Gm, Cm and Um are 2'-methoxy-modified A, G, C and U nucleotides respectively; s indicates that the 3',5'-phosphodiester bonds connecting the nucleotide monomers are thio-modified.

6. The double-stranded RNAi agent according to claim 2 or 5, wherein the 5'-carbon atom of the modified antisense strand 5'-terminal nucleotide glycoside is phosphorylated, and the phosphorylated group of the 5'-carbon atom is a 5'-vinyl phosphonate group (5'-E-VP), and its structure is shown as follows: ； in, R is C 1-4 Alkoxy; The base is adenine.

7. A conjugate for reducing the expression of PCSK9, comprising the double-stranded RNAi agent according to any one of claims 1 to 6, and a ligand conjugated thereto; wherein the ligand is conjugated to the 3'-end or 5'-end of the sense strand of the oligonucleotide; wherein the ligand is one or more GalNAc derivatives attached using a divalent or trivalent branched linkage.

8. The conjugate according to claim 7, wherein the ligand is: 。 9. The conjugate according to claim 7, wherein the ligand is G4, G5, G6 or G7: ， ， ， 。 10. The conjugate according to claim 7, which has the structure shown below: ， ， ， ,or 。 11. The conjugate according to claim 9, wherein The oligonucleotide duplex is conjugated with ligand G4, G5, G6 or G7, and the double-stranded RNAi agent comprises any oligonucleotide duplex selected from the following sense strand and antisense strand pairing: (1) The sense strand consists of the sequence shown in SEQ ID NO. 342; and the antisense strand consists of the sequence shown in SEQ ID NO. 381, wherein: The sense strand sequence shown in SEQ ID NO. 342 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Af-Gf-Cm-Um-Um-Um-Cm-Uf-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 381 is as follows: Ams-Ufs-Cf-Cf-Am-Gf-Am-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cf-Cm-Um-Cm-Cm-Ams-Ums-Um; (2) the sense strand consists of the sequence shown in SEQ ID NO. 342; and the antisense strand consists of the sequence shown in SEQ ID NO. 430, wherein: The sense strand sequence shown in SEQ ID NO. 342 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Af-Gf-Cm-Um-Um-Um-Cm-Uf-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 430 is as follows: Ams-Ufs-Cf-Cf-Am-Gf-Agna-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cf-Cm-Um-Cm-Cm-Ams-Ums-Um; (3) The sense strand consists of the sequence shown in SEQ ID NO. 342; and the antisense strand consists of the sequence shown in SEQ ID NO. 431, wherein: The sense strand sequence shown in SEQ ID NO. 342 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Af-Gf-Cm-Um-Um-Um-Cm-Uf-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 431 is as follows: AmsEVP-Ufs-Cf-Cf-Am-Gf-Am-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cf-Cm-Um-Cm-Cm-Ams-Ums-Um; Among them, Af, Gf, Cf and Uf are 2'-fluoro modified A, G, C and U nucleotides respectively; Am, Gm, Cm and Um are 2'-methoxy modified A, G, C and U nucleotides respectively; s indicates that the 3',5'-phosphodiester bonds connecting the nucleotide monomers are thio-modified; the 5'-carbon atom of the 5'-terminal nucleotide glycoside of the antisense chain shown in SEQ ID NO. 431 is phosphorylated, and the phosphorylation group of the 5'-carbon atom is a 5'-vinylphosphonate group EVP.

12. The conjugate of claim 11, wherein the double-stranded RNAi agent comprises any oligonucleotide duplex selected from the following sense and antisense strand pairs: (1) the sense strand consists of the sequence shown in SEQ ID NO. 342; and the antisense strand consists of the sequence shown in SEQ ID NO. 381, and the sense strand of the oligonucleotide duplex is conjugated with ligand G4 or G6, wherein: The sense strand sequence shown in SEQ ID NO. 342 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Af-Gf-Cm-Um-Um-Um-Cm-Uf-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 381 is as follows: Ams-Ufs-Cf-Cf-Am-Gf-Am-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cf-Cm-Um-Cm-Cm-Ams-Ums-Um; (2) the sense strand consists of the sequence shown in SEQ ID NO. 342; and the antisense strand consists of the sequence shown in SEQ ID NO. 430, and the sense strand of the oligonucleotide duplex is conjugated with ligand G5 or G7, wherein: The sense strand sequence shown in SEQ ID NO. 342 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Af-Gf-Cm-Um-Um-Um-Cm-Uf-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 430 is as follows: Ams-Ufs-Cf-Cf-Am-Gf-Agna-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cf-Cm-Um-Cm-Cm-American-Ums-Um; (3) the sense strand consists of the sequence shown in SEQ ID NO. 342; and the antisense strand consists of the sequence shown in SEQ ID NO. 431, and the sense strand of the oligonucleotide duplex is conjugated with ligand G6 or G7, wherein: The sense strand sequence shown in SEQ ID NO. 342 is as follows: Ums-Gms-Gm-Am-Gm-Gm-Cf-Um-Uf-Af-Gf-Cm-Um-Um-Um-Cm-Uf-Gm-Gm-Am-Um; The antisense strand sequence shown in SEQ ID NO. 431 is as follows: AmsEVP-Ufs-Cf-Cf-Am-Gf-Am-Am-Am-Gm-Cm-Um-Am-Af-Gm-Cf-Cm-Um-Cm-Cm-Ams-Ums-Um.

13. The conjugate according to claim 12, wherein the double-stranded RNAi agent comprises an oligonucleotide duplex consisting of a pair of a sense strand shown in SEQ ID NO. 342 and an antisense strand shown in SEQ ID NO. 431, and the sense strand of the oligonucleotide duplex is conjugated to the ligand G6.

14. A pharmaceutical composition comprising the double-stranded RNAi agent according to any one of claims 1 to 6 or the conjugate according to any one of claims 7 to 13, and a pharmaceutically acceptable carrier.

15. Use of the double-stranded RNAi agent according to any one of claims 1 to 6, the conjugate according to any one of claims 7 to 13, or the pharmaceutical composition according to claim 14 in the preparation of a drug for treating a disease associated with PCSK9, The PCSK9-related disease is selected from hypercholesterolemia, atherosclerosis, dyslipidemia or cardiovascular and cerebrovascular diseases.

Images