A kit for specifically detecting Bacillus subtilis and its application

Abstract

The present invention belongs to the field of biological pesticides or microorganisms, and particularly relates to a kit for specific detection of Bacillus subtilis and its application, the main contents of which are to extract the total DNA of the sample to be tested, screen out the LigB gene fragment that can be used for specific primer design through whole genome comparison, design specific primers BsspF / BsspR; establish a fluorescent PCR detection reaction system and reaction procedure by using SYBR technology, and determine the detection result according to the CT value and amplification curve. The fluorescent PCR detection method provided by the present invention can quickly detect Bacillus subtilis in the sample, the method is simple, accurate, and has good application value.

Description

Technical Field

[0001] The invention belongs to the field of biological pesticides or microorganisms, and particularly relates to a kit for specifically detecting Bacillus subtilis and an application of the kit in detecting Bacillus subtilis by fluorescent quantitative PCR. Background Art

[0002] Bacillus subtilis is the most widely used microbial species in microbial pesticides. It has the advantages of being resistant to desiccation, heat and ultraviolet radiation. Bacillus with excellent biocontrol effects is widely used in the prevention and control of crop diseases. Bacillus subtilis belongs to the genus Bacillus. The species in this group have similar morphological and biological characteristics, and are difficult to distinguish using morphological, physiological and biochemical characteristics. In addition, the similarity between species in this group in commonly used identification genes is relatively high, resulting in low molecular identification accuracy. Based on the above social needs and current technical difficulties,

[0003] The existing molecular detection technology for Bacillus subtilis mainly uses conventional PCR. After the microbial DNA in the sample is extracted, PCR is performed using specific primers. The PCR product also needs to be subjected to agarose gel electrophoresis and the specific bands are observed under a gel imager. This method has a long detection cycle and is time-consuming and labor-intensive.

[0004] The reported method for applying the fluorescence detection technology of Bacillus subtilis is the probe-based fluorescence quantitative PCR technology. During PCR amplification, a specific fluorescent probe is added at the same time as a pair of primers. The two ends of the probe are respectively labeled with a reporter fluorescent group and a quencher fluorescent group. This method requires the addition of probe primers, and the amount of primer reagents used is relatively large.

[0005] The currently disclosed Bacillus subtilis detection systems mainly include microscope counting, conventional PCR, and TaqMan probe method, which have problems such as large errors, low efficiency, long cycle, and large amount of detection reagents. Summary of the invention

[0006] Based on the technical problems existing in the technical background, the present invention combines modern molecular biology methods and establishes a rapid, accurate and economical kit for specific detection of Bacillus subtilis based on SYBR Green dye method fluorescence PCR technology, and its application in fluorescence quantitative PCR detection of Bacillus subtilis.

[0007] To achieve the above purpose, the present invention adopts the following technical solution:

[0008] A kit for specifically detecting Bacillus subtilis, comprising specific primers BsspF / BsspR;

[0009] BsspF:TGAAATTGGCAGGCGCTCTA,

[0010] BsspR:GCAGGCGTACCGTCTTGATA.

[0011] The kit contains 2×ChamQ Universal SYBR qPCR Master Mix 10 µl, DNA working solution 1 µl, BsspF (10 µM) 0.4 µl, BsspR (10 µM) 0.4 µl, and ddH2O 8.2 µl.

[0012] An application of the kit for specifically detecting Bacillus subtilis, and an application of the kit in specifically detecting Bacillus subtilis.

[0013] A fluorescent quantitative PCR detection method for specifically detecting Bacillus subtilis, using the kit to perform fluorescent quantitative PCR detection, and determining the detection according to the CT value and the amplification curve.

[0014] The Ct value of the test group was ≤40, and an exponential amplification curve appeared; the Ct value of the control group was >40, and no exponential amplification curve appeared, and the test group was judged to be positive.

[0015] Specifically:

[0016] A. Use the CTAB method to extract the microbial DNA from the samples to be tested in the test group;

[0017] B. using the kit to perform fluorescence PCR detection;

[0018] C. The reaction program was 95°C pre-denaturation for 1 min, 94°C denaturation for 30 s, 56°C annealing for 30 s, and 72°C extension for 30 s, and denaturation, annealing, and extension were repeated for 40 cycles;

[0019] D. Determine based on the CT value and amplification curve. The result judgment standard is that the Ct value of the test group is ≤40, and an exponential amplification curve appears; the Ct value of the control group is >40, and no exponential amplification curve appears, and the test group is judged as positive.

[0020] The fluorescent PCR test can detect different Bacillus subtilis preparation products, and the minimum detection concentration of the test sample DNA working solution is 10 fg / ml.

[0021] The advantages of the present invention are:

[0022] The present invention is based on the Bacillus subtilis detection system of SYBR Green dye method fluorescence PCR technology, designs specific primers with LigB gene, and establishes Bacillus subtilis SYBR Green dye method fluorescence PCR detection technology by optimizing the reaction program. The sensitivity of the Bacillus subtilis fluorescence detection system based on the primer is higher than all the detection systems reported so far, and the minimum detection limit is 10 fg / ml of Bacillus subtilis DNA concentration. The technology has the advantages of short detection cycle, reagent saving, small error, etc., provides quality assessment and detection technology for the development and application of Bacillus subtilis products, and further provides effective technology for microbial pesticide detection, and has good application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 1 is a schematic diagram of the specific dissolution curve of the detection system designed by the present invention, wherein ① is the target detection sample, ②③④⑤⑥⑦⑧⑨⑩ are the control strains, ①: Bacillus subtilis; ②: Bacillus megaterium; ③: Bacillus thuringiensis; ④: Bacillus sphaericus; ⑤: Escherichia coli; ⑥: Pseudomonas fluorescens; ⑦: Bacillus cereus; ⑧: Bacillus amyloliquefaciens; ⑨: Bacillus thuringiensis; ⑩: Erwinia.

[0024] Figure 2 1 is a schematic diagram of the specific amplification curve of the detection system designed by the present invention, wherein ① is the target detection sample, ②③④⑤⑥⑦⑧⑨⑩ are the control strains, ①: Bacillus subtilis; ②: Bacillus megaterium; ③: Bacillus thuringiensis; ④: Bacillus sphaericus; ⑤: Escherichia coli; ⑥: Pseudomonas fluorescens; ⑦: Bacillus cereus; ⑧: Bacillus amyloliquefaciens; ⑨: Bacillus thuringiensis; ⑩: Erwinia.

[0025] Figure 3 It is a schematic diagram of the sensitivity dissolution curve of the detection system designed in the present invention, ①②③④⑤⑥ are 10 μg / ml, 10 ng / ml, 100 pg / ml, 10 pg / ml, 100 fg / ml, and 10 fg / ml, respectively.

[0026] Figure 4 It is a schematic diagram of the sensitivity amplification curve of the detection system designed in the present invention, wherein ①②③④⑤⑥ are 10 μg / ml, 10 ng / ml, 100 pg / ml, 10 pg / ml, 100 fg / ml and 10 fg / ml respectively.

[0027] Figure 5 The diagram is a schematic diagram of the amplification curves of the detection system designed by the present invention for detecting four types of Bacillus subtilis samples, ①: wettable powder, 10 billion CFU / g; ②: wettable powder, 100 billion CFU / g; ③: suspension, 20 billion CFU / ml; ④: aqueous solution, 3 billion CFU / ml.

[0028] Figure 6 The diagram is a schematic diagram of the dissolution curves of four Bacillus subtilis samples detected by the detection system designed by the present invention, ①: wettable powder, 10 billion CFU / g; ②: wettable powder, 100 billion CFU / g; ③: suspension, 20 billion CFU / ml; ④: aqueous solution, 3 billion CFU / ml. DETAILED DESCRIPTION

[0029] The specific implementation modes of the present invention are further described below in conjunction with examples. It should be noted that the specific implementation modes described here are only for illustrating and explaining the present invention, and are not limited to the present invention. Example 1

[0030] Determination of Bacillus subtilis specific primers:

[0031] Based on the comparison of the whole genome sequences of Bacillus subtilis and other microorganisms, the ATP-dependent DNA ligase gene (LigB) was selected as the target fragment, and specific primers for fluorescence PCR detection of Bacillus subtilis were designed.

[0032] The target fragment is as follows:

[0033] TTGTTTATATCCCCAATGCTGCTAGAATCCACAAAAGATCCATTCGATGATGATTCTTATATCACTGAGCTGAAATTTGATGGCATACGGCTTGTACTATCAAAATTCAATAATCAAATAAAGCTATATACTCGTCACAAGAATGAGGTTAGCAGCAAGTTTCCCGAATTATTGAATTTGGATGTGCCGGACGGGACTGTGCTAGACGGTGAAGTAATTGTAACCGATGCTGACGGATCTCCTGATTTTGAGGCTGTCATGGAGCGATTTATGTCTAATAAGTCCCCTCATAAGATCGTTTATTGCATTTTTGATGTTATATATTCAAATGGTCAATCTATTGCATCAAAGCCACTGACACAACGAAAGGAAGCTCTTAAAGCCCTTGGAATAAACCATCCGAACGCTTTTGTACTTGATGGGATAAAAGGAAATGGTGTCTCTTATTTCAGCATGGTTAAAGAAAAAGGACTCGAAGGTATTGTTCTAAAAAAAGCAAACTCATCATATGAAATTGGCAGGCGCTCTAAGAACTGGATTAAAGTCATCAACTATGACTTTACTGAAGTGCTGATAACCGGATACTCCCGTAAAGATATAAAATTCCTGCTGACTTATCAAGACGGTACGCCTGCTGGAATGATGGAATTTATGCCAAATCCTGAACGTCACAAGTTTCATTTAATGAAAAAATTAACGTCTGAAACTGAAGACTTTGTTTTTATTGAACCTATCCATTGCAAAGTTAAGCACCGATTTATGACTAAGCACGGGAAACTTCGTTTGCCCTCATTCGTTTCTTGGAGAGAATAA

[0034] Primer:

[0035] BsspF: TGAAATTGGCAGGCGCTCTA

[0036] BsspR: GCAGGCGTACCGTCTTGATA Example 2

[0037] Extraction of total DNA of sample microorganisms, taking extraction of Bacillus subtilis as an example:

[0038] Inoculate Bacillus subtilis in 100 ml LB culture medium, culture at 28℃ and 150 r / min for 48 h, take 1.5 ml culture medium and place it in a 2 ml centrifuge tube, add 600 μl TE buffer, vortex and resuspend, add 30 μl 10% SDS and 15 μl proteinase K, mix well, and incubate at 37℃ for 1 h. Add 100 μl 5 mol / L NaCl, mix well, then add 80 μl CTAB / NaCl solution, mix well and incubate at 65℃ for 10 min. Add an equal volume of phenol / chloroform / isoamyl alcohol and mix well, centrifuge for 5 min, transfer the supernatant to a new 1.5 ml centrifuge tube, add 0.8 times the volume of isopropanol, mix gently and centrifuge. Wash the precipitate with 1 ml 70% ethanol, centrifuge and discard the ethanol, dry in a clean bench, and redissolve in 20 μl TE buffer. The DNA working solution of Bacillus subtilis to be extracted is obtained.

[0039] Then, DNA working solutions of Bacillus megaterium, Bacillus thuringiensis, Bacillus sphaericus, Escherichia coli, Pseudomonas fluorescens, Bacillus cereus, Bacillus amyloliquefaciens, Bacillus hyaluronic acid, and Erwinia spp. were obtained according to the above method (all strains are commercially available), and then the specificity of the detection system was determined;

[0040] The detection system consisted of 2×ChamQ Universal SYBR qPCR Master Mix 10 µl, DNA working solution 1 µl, BsspF (10 µM) 0.4 µl, BsspR (10 µM) 0.4 µl, and ddH2O 8.2 µl.

[0041] Fluorescence PCR detection was performed using the above detection system. The reaction procedure was pre-denaturation at 95°C for 1 min, denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s. Denaturation, annealing, and extension were repeated for 40 cycles.

[0042] The results were determined based on the CT value and amplification curve. The result was determined as follows: the Ct value of the test group was ≤40, and an exponential amplification curve appeared; the Ct value of the control group was >40, and no exponential amplification curve appeared, and the test group was determined to be positive.

[0043] The melting curve of the target test sample in this system has a single peak, the TM value is between 88 and 89, and the characteristic peak is obvious, which proves that the product is single and the primer is highly specific; the melting curve of the control strain is wavy and no obvious single peak appears. Figure 1The Ct value of the target detection sample of this system is 28.07, which is less than 40, and the amplification curve has obvious exponential amplification characteristics; it proves that the detection system can effectively detect Bacillus subtilis; the Ct values ​​of the control strains are 41.29, 44.22, 43.82, 42.28, 43.44, 46.98, 43.37, 45.38, and 48.19, all of which are greater than 40, and there is no amplification curve with exponential amplification characteristics. The test results are shown in Figure 2 . Example 3

[0044] Sensitivity determination of detection system

[0045] The Bacillus subtilis DNA working solution obtained in Example 2 was diluted with TE buffer to 10 μg / ml, 10 ng / ml, 100 pg / ml, 10 pg / ml, 100 fg / ml, and 10 fg / ml, respectively.

[0046] Then, fluorescence PCR detection was performed using the detection system, which consisted of 10 µl of 2×ChamQ Universal SYBRqPCR Master Mix, 1 µl of DNA working solution, 0.4 µl of BsspF (10 µM), 0.4 µl of BsspR (10 µM), and 8.2 µl of ddH2O.

[0047] The PCR detection reaction program was 95°C pre-denaturation for 1 min, 94°C denaturation for 30 s, 56°C annealing for 30 s, and 72°C extension for 30 s, with denaturation, annealing, and extension repeated for 40 cycles;

[0048] Single-peak dissolution curves appeared in all treatments with different concentrations, indicating that the target microorganisms could be detected in all six concentrations. Figure 3 The Ct values ​​of this system for 10 μg / ml, 10 ng / ml, 100 pg / ml, 10 pg / ml, 100 fg / ml, and 10fg / ml were 29.07, 28.97, 28.68, 28.93, 27.64, and 26.08, respectively. The exponential expansion curves appeared in the different concentration treatments, indicating that the target microorganisms can be detected in the six concentration treatments. The test results are shown in Figure 4 . Example 4

[0049] Detection of commercially available samples by the detection system

[0050] Fluorescence PCR detection was performed on different commercially available Bacillus subtilis preparations using the detection system, which consisted of 10 µl of 2×ChamQ Universal SYBR qPCR Master Mix, 1 µl of DNA working solution, 0.4 µl of BsspF (10 µM), 0.4 µl of BsspR (10 µM), and 8.2 µl of ddH2O.

[0051] The PCR detection reaction program was 95°C pre-denaturation for 1 min, 94°C denaturation for 30 s, 56°C annealing for 30 s, and 72°C extension for 30 s, and denaturation, annealing and extension were repeated for 40 cycles.

[0052] In this example, four different commercially available preparations containing Bacillus subtilis were tested: ①: wettable powder, 10 billion CFU / g, Biovox Corporation, USA; ②: wettable powder, 100 billion CFU / g, Shandong Lukang Biological Pesticide Co., Ltd.; ③: dispersible oil suspension, 20 billion CFU / ml, Deqiang Biological Co., Ltd.; ④: aqueous solution, 3 billion CFU / ml, Guangdong Plant Dragon Biotechnology Co., Ltd.

[0053] Depend on Figure 5 It can be seen that the Ct values ​​of the system for the four test samples were 29.28, 28.28, 28.54 and 29.78, all less than 40, and the amplification curve had obvious exponential amplification characteristics; Figure 6 It can be seen that the dissolution curves of the four test samples have single peaks, TM values ​​are between 83 and 90, and the characteristic peaks are obvious, indicating that the detection system designed in the present invention can be applied to the specific detection of Bacillus subtilis.

Claims

1. A kit for specific detection of Bacillus subtilis, characterized in that: Contains specific primers BsspF and BsspR; BsspF:TGAAATTGGCAGGCGCTCTA, BsspR:GCAGGCGTACCGTCTTGATA.

2. The kit for specific detection of Bacillus subtilis according to claim 1, characterized in that: The kit consists of 10 µl of 2×ChamQ Universal SYBR qPCR Master Mix, 1 µl of DNA working solution, 0.4 µl of 10 µM BsspF, 0.4 µl of 10 µM BsspR, and 8.2 µl of ddH2O.

3. Use of the kit according to claim 1 in the specific detection of Bacillus subtilis.

4. A fluorescent quantitative PCR detection method for specifically detecting Bacillus subtilis, characterized in that: The kit according to claim 1 is used to perform fluorescence quantitative PCR detection, and the detection result is determined according to the CT value and the amplification curve.

5. The fluorescent quantitative PCR detection method for specific detection of Bacillus subtilis according to claim 4, characterized in that: The Ct value of the test group was ≤40, and an exponential amplification curve appeared; the Ct value of the control group was >40, and no exponential amplification curve appeared, and the test group was judged to be positive.

6. The fluorescent quantitative PCR detection method for specific detection of Bacillus subtilis according to claim 5, characterized in that: A. Use the CTAB method to extract the microbial DNA from the samples to be tested in the test group; B. Performing fluorescent PCR detection using the kit described in claim 1; C. The reaction program was 95°C pre-denaturation for 1 min, 94°C denaturation for 30 s, 56°C annealing for 30 s, and 72°C extension for 30 s, and denaturation, annealing, and extension were repeated for 40 cycles; D. Determine the test results based on the CT value and amplification curve.

7. The fluorescent quantitative PCR detection method for specific detection of Bacillus subtilis according to claim 6, characterized in that: The fluorescent PCR test can detect different Bacillus subtilis preparation products, and the minimum detection concentration of the test sample DNA working solution is 10 fg / ml.

Images