Peptide inhibitors targeting human multidrug resistance-associated protein MRP5

Abstract

The present invention designs and screens specific polypeptide molecules that can bind to and inhibit the transport activity of human ATP-dependent binding cassette (ABC) multidrug resistance-associated protein (ABCC5 / MRP5), reduce the efflux effect of anti-tumor drug molecules, and increase the concentration of anti-tumor drugs in tumor cells, thereby enhancing the therapeutic effect of anti-tumor drugs.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a class of specific polypeptide molecules, which can bind to and inhibit the transport activity of human ATP-dependent binding cassette (ABC) multidrug resistance-associated protein (ABCC5 / MRP5), and can be used to reduce the efflux effect of anti-tumor drug molecules, increase the concentration of anti-tumor drugs in tumor cells, and enhance the therapeutic effect of anti-tumor drugs. Background Art

[0002] As one of the key means of treating patients with advanced cancer, chemotherapy faces the challenge of multidrug resistance (MDR), which is a common phenomenon in chemotherapy and significantly affects the effectiveness of tumor treatment. The mechanism of MDR is not limited to patients with advanced cancer, but also involves a variety of pathological conditions such as genetic diseases and inflammatory diseases, which increases the complexity and difficulty of treatment. In order to overcome the obstacles brought by MDR and improve the efficacy of chemotherapy drugs and the quality of life of patients, researchers and clinicians are constantly exploring new treatment methods and strategies. These efforts include but are not limited to the development of new anti-tumor drugs, the improvement of drug delivery systems, the exploration of combined drug regimens, and the study of the molecular mechanisms of MDR.

[0003] The ATP-binding cassette (ABC) transporter family is an important class of transmembrane proteins, whose core function is to use the energy generated by ATP hydrolysis to promote the transmembrane transport of substrate molecules bound to it. In the human genome, 49 transcriptionally active ABC transporter genes have been identified, which are divided into 7 subfamilies, namely ABC-A to ABC-G, based on the homology of the conserved region sequences. Among them, 9 multidrug resistance associated proteins (MRPs) have been identified, encoded by ABCC1, ABCC2, ABCC3, ABCC4, ABCC5, ABCC6, ABCC10, ABCC11 and ABCC12 genes, respectively. MRP is a member of the C subfamily of the ATP-binding cassette (ABC) family. MRP has the function of transferring anticancer drugs to the extracellular space, effectively reducing the intracellular drug concentration, and therefore plays a key role in mediating chemotherapy resistance. The MRP subfamily is also known as "efflux proteins". In mammals, they can transport a variety of endogenous or exogenous substances with different structures and properties to the outside of cells, and they play an important role in maintaining the body's homeostasis. MRP proteins are expressed in multiple tissues and organs such as the intestine, liver, kidney, and brain. Their presence not only limits the body's absorption of drugs, but also prevents drugs from entering the target tissues, while accelerating the metabolism and excretion of drugs in the liver and kidneys. Therefore, the phenomenon of multidrug resistance mediated by the MRP family has become a major obstacle to the effective treatment of cancer. In view of this, researchers have shown great interest in developing methods to reduce the resistance of cancer cells to chemotherapeutic drugs. In particular, overcoming multidrug resistance by inhibiting the drug transport function of MRP proteins has become a hot topic in current cancer treatment research. Technological advances in this field are expected to provide new strategies for cancer treatment to improve the efficacy of chemotherapeutic drugs and overcome the problem of drug resistance mediated by MRP.

[0004] Human multidrug resistance-associated protein MRP5 (hMRP5) is unique in structure and function. First, unlike MRP1, which contains an additional N-terminal transmembrane domain (TMD0), MRP5 contains a flexible N-terminal long loop from Met1 to Thr94 ( Figure 1 ), which is located in front of the lasso domain. In addition, MRP5 has a unique regulatory motif in its first nucleotide binding domain (NBD), namely the R motif ( Figure 1). In addition, glutathione, as a substrate of MRP1, can bind to MRP1, but no studies have shown that glutathione can affect the transport of MRP5. This shows that although MRP5 and MRP1 belong to the same subfamily, there are differences in their biological functions. Wijnholds first discovered that the substrates of MRP5 transporter are nucleotide analogs; subsequent studies also found that MRP5, as a cyclic nucleotide organic anion transporter, mediates the transport of a variety of organic anions, including nucleotide monophosphates (cGMP and cAMP) and purine analogs. Given that hMRP5 transports cyclic nucleotides and their analogs in normal tissues, it is called a "cyclic nucleotide efflux pump." In the field of clinical oncology, data have confirmed that hMRP5 can excrete a variety of anticancer drugs through cellular efflux, such as methotrexate, cisplatin, purine analogs, pyrimidine analogs, doxorubicin, antifolates, etc., thereby directly promoting the drug resistance of tumor cells. In addition, hMRP5 may also contribute to the multidrug resistance problem in antiviral therapy by transporting monophosphate nucleotide analogs such as 9-(2-phosphomethoxy)adenine.

[0005] hMRP5 is highly expressed in many cancer types ( Figure 2 ), and plays a key role in inducing the occurrence and development of cancer, mainly by promoting tumor cells to develop resistance to chemotherapeutic drugs. Especially in pancreatic cancer, this tumor is considered to be one of the diseases that is extremely resistant to chemotherapy. The study used human pancreatic cancer cells, cells stably transfected with human transporter cDNA, or cells in which specific transporters were knocked out by RNA interference to show that hMRP5 affects the chemotherapeutic resistance of these tumor cells. Cytotoxicity studies of hMRP5-overexpressing or hMRP5-silenced cells showed that hMRP5 mediates cell resistance to gemcitabine. The expression levels of transporters in pancreatic cancer cells can be affected to varying degrees by combined treatment with the nucleoside drug gemcitabine or chemotherapeutic drugs.

[0006] A major obstacle in the treatment of acute leukemia is the development of drug resistance, among which the expression of ABCC family members, especially hMRP5, plays a key role in the formation of drug resistance in acute leukemia cells. Studies have revealed that the level of intracellular cyclic nucleotides is an important factor in regulating the sensitivity of leukemia cells to specific anti-tumor drugs and pro-apoptotic signals. hMRP5, through its efflux effect on nucleoside analogs, can cause cells to develop resistance to these nucleotide drugs, which are key cytotoxic therapeutic agents for the treatment of acute leukemia.

[0007] Glioblastoma Multiforme (GBM) is the most common primary malignant brain tumor, known for its high invasiveness, significant heterogeneity of grading models, and extensive resistance to therapeutic drugs. The differentiation process of GBM cells is considered to be an important factor in its chemotherapy resistance. The formation of resistance is closely related to the expression of MRP. Studies have shown that studies have observed that the expression level of hMRP5 is significantly increased in GBM patients and their differentiated GBM cells; conversely, by blocking the expression or function of ABC transporters such as hMRP5, the efficacy of anti-tumor drugs can be significantly enhanced, the growth of tumor cells can be effectively inhibited, and the risk of tumor recurrence can be reduced.

[0008] In addition, hMRP5 is commonly expressed in a variety of tumor tissues such as lung cancer, breast cancer, gastric cancer and colorectal cancer, and its expression level is closely correlated with the patient's clinical pathological characteristics and prognosis. Studies have shown that in lung cancer patients who have been treated with cisplatin for a long time, the expression level of hMRP5 has increased significantly, and high expression of hMRP5 is associated with a lower survival rate. In addition, in cancer patients, overexpression of hMRP5 is closely associated with poor prognosis. On the contrary, by reducing the expression of endogenous hMRP5, the intracellular concentrations of various drugs such as pemetrexed, 5-fluorouracil and their metabolites can be significantly increased. These research results suggest that inhibiting the transport activity of hMRP5 or reducing its expression level has potential efficacy in overcoming multidrug resistance of cancer cells.

[0009] The combination of hMRP5 inhibitors and anticancer drugs has been shown to improve the therapeutic effects of cancers such as liver cancer, colorectal cancer, lymphocytic leukemia and breast cancer. Currently, research reports have confirmed that small molecules such as trequinsin, probenecid, sulfinpyrazone, MK-571, zaprinast, and sildenafil can inhibit the transport activity of MRP5. However, these small molecules exhibit disadvantages such as low efficiency, low specificity and poor safety, and the working mechanism of these small molecules blocking the transport activity of hMRP5 is still unclear. At the same time, studies have shown that peptide inhibitors have a larger binding interface and a stable conformation, with advantages such as high affinity and specificity. Recently, researchers have screened a macrocyclic peptide called CPI1, which specifically inhibits the transport activity of MRP1 with its high affinity, showing great potential in the treatment of cancer multidrug resistance; similarly, the herpes simplex virus inhibitory protein ICP47 polypeptide molecule has also been shown to specifically bind to and inhibit the antigen processing-associated transporter (TAP) (ABC family transporter), and studies have shown that this polypeptide molecule has good prospects in the treatment of infectious diseases and malignant diseases, such as type I naked lymphocyte syndrome and cancer. In view of this, the development of hMRP5 polypeptide molecule inhibitors with high specificity and strong affinity is not only scientifically feasible, but also clinically of great medical significance for overcoming tumor multidrug resistance. The development of such polypeptide inhibitors is expected to bring new breakthroughs in cancer treatment, improve treatment effects, and provide patients with more treatment options.

[0010] In addition, peptides play a vital role in the research, development and application of RNA drugs (including vaccines). With the rapid development of biotechnology, RNA drugs have become an efficient means of preventing and / or treating diseases. Peptides, as fragments of proteins, have high specificity and affinity and can accurately bind to target proteins. In the design of RNA drugs, RNA sequences encoding specific peptides can be embedded in vaccines. When these RNA sequences enter human cells, they will be translated into corresponding peptides and accurately bind to target proteins. Therefore, the application of peptides in RNA drugs has broad prospects and huge potential, and the discovery of peptide inhibitors also provides the possibility for the future preparation of RNA drugs that inhibit multidrug resistance-related proteins. Summary of the invention

[0011] The present invention provides an inhibitor capable of inhibiting the function of hMRP5 (human multidrug resistance-associated protein MRP5, ABCC5). The inventor first designed a series of polypeptide molecules based on the N-terminal sequence of hMRP5, and then screened out polypeptide candidate molecules with high binding affinity to hMRP5 by microthermophoresis technology. Through the transport experiment at the cellular level, the inhibitory effect of these polypeptide molecules on the transport activity of hMRP5 was verified and confirmed. Further, the inventor used cryo-electron microscopy (Cryo-Electron Microscopy, Cryo-EM) technology to analyze the three-dimensional structure of hMRP5 after binding with the polypeptide molecule, thereby explaining the mechanism of interaction between the polypeptide molecule and hMRP5. These polypeptide molecules of the present invention have a specific inhibitory effect on the transport function of hMRP5, can reduce the drug efflux activity mediated by it, thereby reducing the efflux of anticancer drugs such as doxorubicin caused by hMRP5, maintaining a higher concentration of anticancer drugs in cells, enhancing the therapeutic effect of anticancer drugs, overcoming the multidrug resistance of tumor cells, and having important clinical significance for improving the cancer treatment effect of anticancer drugs.

[0012] The first aspect of the present invention is to provide a polypeptide, which can compete with the C46-S64 peptide segment (SEQ ID No. 1) of hMRP5 and bind to the substrate binding pocket of hMRP5.

[0013] According to the present invention, the length of the polypeptide is 19-41 amino acids.

[0014] In one class of embodiments of the invention, the polypeptide comprises an amino acid sequence that is 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID No. 1. SEQ ID No. 1: CQDALETAARAEGLSLDAS.

[0015] According to the present invention, in this class of embodiments, the amino acid sequence of the polypeptide is formula (I): (Xaa) m -CQD-X1-LE-X2-AARAEGL-X3-LDAS-(Xaa) n; wherein Xaa is independently selected from glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, tyrosine, tryptophan, serine, threonine, cysteine, methionine, asparagine, aspartic acid, glutamine, glutamic acid, lysine, arginine and histidine, and m and n are independently selected from integers of 0-22; X1 is alanine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline; X2 is threonine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline; X3 is serine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline.

[0016] In some embodiments of the present invention, preferably, in formula (I), Xaa is independently selected from cysteine, aspartic acid, serine, lysine, phenylalanine, arginine, threonine, proline, leucine, glutamic acid, methionine, histidine, glutamine and isoleucine, and m and n are the same and are selected from integers of 0-11. In some embodiments of the present invention, (Xaa) m is selected from: (Xaa) 0 (i.e., absent), E, ​​LE, PLE, RPLE, TRPLE, RTRPLE, RRTRPLE, FRRTRPLE, KFRRTRPLE, SKFRRTRPLE, DSKFRRTRPLE, or CSKFRRTRPLE. In some embodiments of the invention, (Xaa) n is selected from: (Xaa)0 (i.e., absent), M, MH, MHS, MHSQ, MHSQL, MHSQLR, MHSQLRI, MHSQLRIL, MHSQLRILD, MHSQLRILDE, MHSQLRILDEE, or MHSQLRILDEC. In some embodiments of the invention, (Xaa) m Selected from: (Xaa) 0 (i.e., absent), E, ​​LE, PLE, RPLE, TRPLE, RTRPLE, RRTRPLE, FRRTRPLE, KFRRTRPLE, SKFRRTRPLE, DSKFRRTRPLE or CSKFRRTRPLE; (Xaa) n Selected from: (Xaa)0 (i.e., absent), M, MH, MHS, MHSQ, MHSQL, MHSQLR, MHSQLRI, MHSQLRIL, MHSQLRILD, MHSQLRILDE, MHSQLRILDEE, or MHSQLRILDEC.

[0017] In some embodiments of the present invention, preferably, in formula (I), X1 is alanine, valine, leucine, isoleucine, phenylalanine or proline. More preferably, X1 is alanine or phenylalanine.

[0018] In some embodiments of the present invention, preferably, in formula (I), X2 is threonine, valine, leucine, isoleucine, phenylalanine or proline. More preferably, X2 is threonine or phenylalanine.

[0019] In some embodiments of the present invention, preferably, in formula (I), X3 is serine, valine, leucine, isoleucine, phenylalanine or proline. More preferably, X3 is serine or proline.

[0020] In some embodiments of the present invention, preferably, in formula (I), X2 is threonine; X3 is serine; X1 is alanine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X1 is alanine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X1 is alanine or phenylalanine.

[0021] In some embodiments of the present invention, preferably, in formula (I), X1 is alanine; X3 is serine; X2 is threonine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X2 is threonine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X2 is threonine or phenylalanine.

[0022] In some embodiments of the present invention, preferably, in formula (I), X1 is alanine; X2 is threonine; X3 is serine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X3 is serine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X3 is serine or proline.

[0023] In some embodiments of the present invention, preferably, in formula (I), (Xaa) m Selected from: (Xaa) 0 (i.e., absent), E, ​​LE, PLE, RPLE, TRPLE, RTRPLE, RRTRPLE, FRRTRPLE, KFRRTRPLE, SKFRRTRPLE, DSKFRRTRPLE or CSKFRRTRPLE; (Xaa) n is selected from: (Xaa)0 (i.e., absent), M, MH, MHS, MHSQ, MHSQL, MHSQLR, MHSQLRI, MHSQLRIL, MHSQLRILD, MHSQLRILDE, MHSQLRILDEE, or MHSQLRILDEC; and,

[0024] X2 is threonine; X3 is serine; X1 is alanine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X1 is alanine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X1 is alanine or phenylalanine; or,

[0025] X1 is alanine; X3 is serine; X2 is threonine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X2 is threonine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X2 is threonine or phenylalanine; or

[0026] X1 is alanine; X2 is threonine; X3 is serine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X3 is serine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X3 is serine or proline. In some embodiments of the present invention, in formula (I), m and n are 0; and,

[0027] X2 is threonine; X3 is serine; X1 is alanine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X1 is alanine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X1 is alanine or phenylalanine; or,

[0028] X1 is alanine; X3 is serine; X2 is threonine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X2 is threonine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X2 is threonine or phenylalanine; or

[0029] X1 is alanine; X2 is threonine; X3 is serine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X3 is serine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X3 is serine or proline.

[0030] In some embodiments of the present invention, in formula (I), (Xaa) m is RTRPLE; (Xaa) n is MHSQLR; and

[0031] X2 is threonine; X3 is serine; X1 is alanine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X1 is alanine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X1 is alanine or phenylalanine; or,

[0032] X1 is alanine; X3 is serine; X2 is threonine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X2 is threonine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X2 is threonine or phenylalanine; or

[0033] X1 is alanine; X2 is threonine; X3 is serine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X3 is serine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X3 is serine or proline.

[0034] In some embodiments of the present invention, in formula (I), (Xaa) m DSKFRRTRPLE or CSKFRRTRPLE; (Xaa) n is MHSQLRILDEE or MHSQLRILDEC; and,

[0035] X2 is threonine; X3 is serine; X1 is alanine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X1 is alanine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X1 is alanine or phenylalanine; or,

[0036] X1 is alanine; X3 is serine; X2 is threonine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X2 is threonine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X2 is threonine or phenylalanine; or

[0037] X1 is alanine; X2 is threonine; X3 is serine, tryptophan, valine, leucine, isoleucine, methionine, phenylalanine or proline, preferably X3 is serine, valine, leucine, isoleucine, phenylalanine or proline, more preferably X3 is serine or proline.

[0038] In a specific embodiment of the present invention, the amino acid sequence of the polypeptide is shown in any one of SEQ ID No.1-SEQ ID No.16.

[0039] In another class of embodiments of the invention, the polypeptide comprises an amino acid sequence that is 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID No. 17. SEQ ID No. 17: DIGKEYIIPSPGYRSVRERTS.

[0040] In a specific embodiment of this type of embodiment, the amino acid sequence of the polypeptide is shown as SEQ ID No.17.

[0041] The polypeptide of the present invention can be prepared by transfecting host cells with expression vectors through genetic engineering. The polypeptide of the present invention, especially short peptides, can also be prepared by using liquid phase or solid phase synthesis techniques known and / or commonly used in the art.

[0042] Those skilled in the art will appreciate that the polypeptide may be modified with a group at its N-terminus or C-terminus to increase the lipophilicity of the peptide, help maintain the stability of the peptide, prevent the peptide from being degraded by endopeptidases in the body, and the like.

[0043] Therefore, the present invention also provides a nucleic acid encoding the polypeptide according to the first aspect of the present invention.

[0044] In certain embodiments, the nucleotide sequence of the nucleic acid is codon-optimized or non-optimized according to the codon preference of the host cell.

[0045] In some embodiments of the invention, the nucleic acid is DNA.

[0046] In other embodiments of the present invention, the nucleic acid is cRNA.

[0047] In other embodiments of the present invention, the nucleic acid is mRNA. According to the present invention, the mRNA may further comprise a 5' cap structure, a 5' UTR, a 3' UTR and a poly-A tail from the 5' end to the 3' end.

[0048] After the cRNA or mRNA enters the cell, it can be translated and synthesized into the polypeptide of the present invention in the cell, thereby inhibiting the hMRP5 function. According to the present invention, the cRNA or mRNA can be delivered into the cell using a delivery system known in the art, including LNPs (nanolipid nanoparticles).

[0049] In a specific embodiment of the present invention, the nucleic acid is a nucleic acid encoding the amino acid sequence shown in SEQ ID No.13, and its nucleotide sequence is shown in SEQ ID No.18, SEQ ID No.19 or SEQ ID No.20.

[0050] The present invention also provides an expression vector, the expression vector comprising the nucleic acid described above. In some embodiments, the vector is a plasmid vector or a viral vector.

[0051] The present invention also provides a host cell, the host cell comprising the expression vector described above or the nucleic acid described above integrated into its genome. In some embodiments, the host cell is a prokaryotic cell. In some embodiments, the host cell is a eukaryotic cell. In some embodiments, the host cell is a mammalian cell. The mammal includes but is not limited to ungulates such as cattle, sheep, horses, pigs, rodents such as rabbits, rats, mice, guinea pigs, primates such as monkeys and gorillas, cats, dogs, etc.

[0052] The second aspect of the present invention is to provide a pharmaceutical composition, which comprises the polypeptide or nucleic acid described in the first aspect of the present invention, and optionally further comprises a pharmaceutically acceptable excipient. The pharmaceutically acceptable excipient is a variety of excipients commonly used or known in the pharmaceutical field, including but not limited to: diluents, binders, antioxidants, pH regulators, preservatives, lubricants, disintegrants, etc.

[0053] The pharmaceutical composition may be in the form of an oral dosage form, such as tablets, capsules, pills, powders, granules, suspensions, syrups, etc.; or in the form of an injectable dosage form, such as an injection, a powder injection, etc., which is administered by intravenous, intraperitoneal, subcutaneous or intramuscular injection. All dosage forms used are well known to those skilled in the art of pharmacy.

[0054] The routes of administration of the pharmaceutical composition include, but are not limited to, oral, buccal, sublingual, transdermal, pulmonary, rectal, parenteral, for example, by injection, including subcutaneous, intradermal, intramuscular, intravenous; by implanted reservoir or reservoir.

[0055] The third aspect of the present invention is to provide the use of the polypeptide, nucleic acid described in the first aspect or the pharmaceutical composition described in the second aspect in the preparation of a drug for treating tumors.

[0056] The tumors include, but are not limited to, leukemias (e.g., acute leukemia, acute lymphocytic leukemia, acute myeloid leukemia, acute granulocytic leukemia, acute promyelocytic leukemia, acute myelo-monocytic leukemia, acute monocytic leukemia, acute leukemia, chronic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, polycythemia vera), lymphomas (Hodgkin's disease, non-Hodgkin's disease), primary macroglobulinemia, heavy chain disease, solid tumors such as sarcomas and cancers (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, endotheliosarcoma, lymphangiosarcoma, angiosarcoma, lymphangioendotheliosarcoma, synovialoma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, Myoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, bronchial carcinoma, medullary carcinoma, renal cell carcinoma, liver cancer, Nile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms tumor, cervical cancer, uterine cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma (e.g., glioblastoma, oligodendroglioma, astrocytoma, medulloblastoma), craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, schwannoma, meningioma, melanoma, neuroblastoma, retinoblastoma, esophageal cancer, gallbladder cancer, kidney cancer, multiple myeloma).

[0057] Preferably, the "tumor" includes but is not limited to: pancreatic cancer, glioma (e.g., glioblastoma multiforme), gastric cancer, breast cancer, cervical cancer, colorectal cancer, esophageal cancer, head and neck cancer, kidney cancer, leukemia, liver cancer, lung cancer, lymphoma, and prostate cancer.

[0058] Preferably, the tumor is a drug-resistant tumor, especially a tumor that highly expresses hMRP5.

[0059] Preferably, the drug is used in combination with an anti-tumor drug. The anti-tumor drug includes, but is not limited to: drugs that destroy DNA structure and / or function, such as alkylating agents, nitrogen mustards, thiotepas, nitrosoureas, methyl sulfonates, platinum compounds, mitomycin, bleomycin, etc., specifically, nitrogen mustard, chlorambucil, cyclophosphamide, ifosfamide, thiotepa, carmustine, semustine, lomustine, busulfan, cisplatin, oxaliplatin, carboplatin, oxaliplatin, mitomycin, bleomycin, etc.; drugs that affect nucleic acid synthesis, such as dihydrofolate reductase inhibitors, pyrimidine nucleotide synthetase inhibitors, purine nucleotide synthetase inhibitors, ribonucleotide reductase inhibitors, DNA polymerase Inhibitors, such as methotrexate, 5-FU, tegafur, capecitabine, 6-mercaptopurine, 6-TG, hydroxyurea, cytarabine, gemcitabine, pemetrexed, stentstatin, ancitabine, etc.; drugs acting on nucleic acid transcription, such as actinomycin D, daunorubicin, doxorubicin, epirubicin, aclarubicin, mithramycin, etc.; topoisomerase I inhibitors acting on DNA replication, such as irinotecan, topotecan, hydroxycamptothecin, etc.; drugs acting in mitosis that interfere with microtubule synthesis, such as paclitaxel, docetaxel, vinblastine, vincristine, vinorelbine, podophyllotoxins, homoharringtonine, etc.

[0060] Therefore, the present invention also provides the use of the polypeptide or nucleic acid described in the first aspect or the pharmaceutical composition described in the second aspect in combination with an anti-tumor drug in the preparation of a drug for treating tumors.

[0061] The present invention also provides the use of the polypeptide or nucleic acid described in the first aspect or the pharmaceutical composition described in the second aspect in the preparation of a drug for treating tumors in combination with an anti-tumor drug.

[0062] The fourth aspect of the present invention is to provide a method for treating tumors, wherein a therapeutically effective amount of the polypeptide or nucleic acid described in the first aspect, or the pharmaceutical composition described in the second aspect, is administered to a patient in need. The method of treatment optionally includes administering an anti-tumor drug to the patient in combination.

[0063] The fifth aspect of the present invention is to provide use of the polypeptide or nucleic acid described in the first aspect of the present invention or the pharmaceutical composition described in the second aspect in treating tumors.

[0064] The tumor type is as described above. Preferably, the tumor is a drug-resistant tumor, especially a tumor that highly expresses hMRP5.

[0065] The present invention also provides a method for in vitro screening of peptide compounds capable of inhibiting hMRP5 transport function.

[0066] The method comprises the following steps:

[0067] (1) Preparing high-purity hMRP5 protein;

[0068] (2) designing and preparing a polypeptide candidate compound, and combining the candidate compound with the hMRP5 protein in step (1);

[0069] (3) Measuring the binding affinity of candidate compounds to hMRP5 protein.

[0070] The method may further comprise the following steps:

[0071] (4) The candidate compound with high binding affinity determined in step (3) is subjected to a transport function experiment using Xenopus oocytes to evaluate the inhibitory effect of the candidate compound on the transport function of hMRP5.

[0072] The method may further include the following steps: using cryo-electron microscopy (Cryo-EM) to observe and analyze the three-dimensional structure of the candidate compound with high binding affinity determined in step (3) and its binding to the hMRP5 protein.

[0073] In one embodiment of the present invention, the method for measuring binding affinity in step (3) is microscale thermophoresis (MST).

[0074] According to the present invention, the "high binding affinity to hMRP5 protein" means that under the same experimental conditions, the binding affinity of the candidate compound to hMRP5 protein is higher than or close to the binding affinity of doxorubicin to hMRP5 protein, or / and, higher than or close to the binding affinity of Trequinsin to hMRP5 protein. In one embodiment of the present invention, the binding affinity to hMRP5 protein is determined by micro-thermophoresis (MST) technology.

[0075] Sequence of the present invention:

[0076]

[0077]

[0078] Beneficial effects of the present invention:

[0079] The present invention clarifies the wild-type hMRP5 structure by cryo-electron microscopy technology, analyzes and compares the structure, and reveals the structural characteristics of wild-type hMRP5. Based on the revealed wild-type hMRP5 structure, the present invention designs different polypeptide molecules and screens out polypeptide molecules with high affinity and strong specificity for hMRP5, such as SEQ ID No. 13 (codenamed "M5PI" in this article). Through microthermophoresis and transport experiments, it is shown that M5PI has the ability to specifically bind to hMRP5 and inhibit transport; through cryo-electron microscopy technology, the inventor can intuitively explain from the structure that the M5PI polypeptide molecule is bound to the hMRP5 transport channel through hydrophobic, electrostatic charge, and hydrogen bond interactions, and occupies the substrate binding site.

[0080] In the prior art, it has been reported that small molecule compounds such as trequinsin, probenecid, sulfinpyrazone, MK-571, zaprinast, and sildenafil can inhibit the ability of MRP5 to transport substrates. However, these inhibitors exhibit disadvantages such as low efficiency, weak specificity, and poor safety; at the same time, the concentration of metabolites produced by the inhibitors may exceed the concentration range that the living organism can withstand, thereby producing side effects, and the molecular mechanism of these small molecules acting on hMRP5 has not yet been clarified. In contrast, the polypeptide inhibitors of the present invention are highly similar to the polypeptide structures naturally present in the human body, and have few side effects on the human body; they have a large protein interaction interface and a stable conformation, and have advantages such as high affinity and selectivity for hMRP5.

[0081] definition:

[0082] “And / or” will be considered as a specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” used in phrases such as “A and / or B” is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Similarly, the term “and / or” used in phrases such as “A, B, and / or C” is intended to cover each of the following: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0083] "Including" and "comprising" have the same meaning, are intended to be open ended and allow but not require the inclusion of additional elements or steps. When the terms "including" or "comprising" are used herein, the terms "consisting of" and / or "consisting essentially of" are also included and disclosed.

[0084] In this specification and claims, the conventional one-letter or three-letter codes for amino acid residues are used.Unless otherwise indicated, amino acid sequences are written left to right in amino to carboxyl orientation.

[0085] For ease of reference, the polypeptides of the present invention are described using the following naming convention: original amino acid: position in the entire protein sequence: substituted amino acid. According to this naming convention, for example, aspartic acid at position 35 is replaced by cysteine, which is represented as: Asp35Cys or D35C; a continuous stretch of amino acid residues is deleted, such as amino acid residues 1-94, which is represented as Δ1-94; a peptide segment from cysteine ​​at position 46 to serine at position 64 is represented as: Cys46-Ser64 peptide segment or C46-S64.

[0086] The terms "polypeptide" and "peptide" are used interchangeably and refer to compounds consisting of a chain of amino acid residues linked by peptide bonds. The polypeptides described in the present invention include reduced and oxidized forms of the amino acid residue chains constituting their amino acid sequences. Without being bound by theory, if two or more cysteines are present in the amino acid sequence of the polypeptide of the present invention, or when a certain amino acid in the amino acid sequence of the polypeptide is replaced with cysteine, the cysteines may form one or more disulfide bonds between any two cysteines under possible or appropriate conditions.

[0087] In this specification and claims, nucleotides are referred to by their commonly accepted single-letter codes. Unless otherwise indicated, nucleotide sequences are written from left to right in a 5' to 3' direction. Nucleobases are represented herein by the commonly known single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Committee. Thus, A represents adenine, C represents cytosine, G represents guanine, T represents thymine, and U represents uracil. It will be understood by the technician that the T bases in the codons disclosed herein are present in DNA, while the T bases will be replaced by U bases in the corresponding RNA.

[0088] The terms "nucleic acid sequence", "nucleotide sequence" or "polynucleotide sequence" are used interchangeably and refer to a contiguous sequence of nucleic acids. The sequence may be single-stranded or double-stranded DNA or RNA, such as mRNA.

[0089] "A nucleotide sequence encoding ..." refers to a nucleic acid (e.g., mRNA or DNA molecule) coding sequence encoding a polypeptide. The coding sequence may further include start and stop signals operably linked to regulatory elements, including a promoter and polyadenylation signal capable of directing expression in cells of an individual or mammal to which the nucleic acid is administered.

[0090] The term "homology" refers to the overall relatedness between polymer molecules, for example, between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Typically, the term "homology" means the evolutionary relationship between two molecules. Thus, two homologous molecules will have a common evolutionary ancestor. In the present invention, the term "homology" includes identity and similarity.

[0091] In some embodiments, polymer molecules are considered to be "homologous" to each other if, for example, at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the monomers in the molecule are identical (identical monomers) or similar (conservative substitutions). The term "homologous" necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences).

[0092] The term "identity" refers to the overall monomer conservation between polymer molecules, such as between polynucleotide molecules (such as DNA molecules and / or RNA molecules) and / or between polypeptide molecules. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered to be equivalent.

[0093] Suitable software programs are available from various sources and are used for the alignment of both protein and nucleotide sequences. For example, programs that determine percent sequence identity: Bl2seq, Needle, Stretcher, Water or Matcher, etc.

[0094] "About": The term "about" used in conjunction with numerical values ​​throughout the specification and claims indicates an interval of accuracy that is familiar and acceptable to those skilled in the art. Typically, this interval of accuracy is ±10%.

[0095] The terms "expression" and "gene expression" have the same meaning, referring to the process by which cells, during their life cycle, convert genetic information stored in nucleotide sequences into biologically active protein molecules through transcription and translation.

[0096] The terms "increased expression" and "high expression" have the same meaning, and refer to an increase in the number of copies of gene transcription and / or an increase in translation, etc., compared with normal levels or tumors that have not developed drug resistance. According to the present invention, the increase in the number of copies of gene transcription and / or the increase in translation is at least 1% higher than that of normal levels or tumors that have not developed drug resistance, for example, at least 5%, at least 10%, at least 15%, at least 20%, at least 25% or even higher, for example, 1.3 times, 1.5 times, 1.7 times, 2 times, 3 times, 4 times, 5 times, 10 times, 20 times or more of that of normal levels or tumors that have not developed drug resistance.

[0097] "Pharmaceutically acceptable excipients" refers to any ingredient other than the short peptides described herein, and has substantially non-toxic and non-inflammatory properties in the human body, including but not limited to any and all solvents, dispersion media or other liquid carriers, dispersion or suspension aids, diluents, granulation and / or dispersing agents, surfactants, isotonic agents, thickeners or emulsifiers, preservatives, binders, lubricants, colorants, sweeteners or flavoring agents, stabilizers, antioxidants, antimicrobial agents or antifungal agents, molar osmotic pressure concentration regulators, pH regulators, buffers, chelating agents, cryoprotectants and / or fillers, as suitable for the specific dosage form required. Various excipients for formulating pharmaceutical compositions and techniques for preparing the compositions are known in the art. Exemplary antimicrobial or antifungal agents include, but are not limited to, benzalkonium chloride, benzethonium chloride, methylparaben, ethylparaben, propylparaben, butylparaben, benzoic acid, hydroxybenzoic acid, potassium benzoate or sodium benzoate, potassium or sodium sorbate, sodium propionate, sorbic acid, etc., and combinations thereof. Exemplary preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, ascorbic acid, butylated hydroxyanisole, ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), etc., and combinations thereof. Exemplary buffers for controlling pH may include, but are not limited to, sodium phosphate, sodium citrate, sodium succinate, histidine (or histidine-HCl), sodium malate, sodium carbonate, etc., and / or combinations thereof. Exemplary cryoprotectants include, but are not limited to, mannitol, sucrose, trehalose, lactose, glycerol, dextrose, etc., and combinations thereof. Exemplary fillers may include, but are not limited to, sucrose, trehalose, mannitol, glycine, lactose, raffinose, and combinations thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0098] Figure 1 Topological structure of wild-type human MRP5 (wt-hMRP5). In the figure: the green, blue and pink parts are the Lasso domain, half 1 (transmembrane domain [TMD] 1 and nucleotide binding domain [NBD] 1) and half 2 (TMD2 and NBD2), respectively; the orange and light coral parts are the special N-terminal and R motifs, respectively.

[0099] Figure 2 The mRNA levels of ATP-binding cassette transporter family in different tumors disclosed in the prior art. The figure shows the statistically significant data of overexpression (red) or downregulated expression (blue) of ABC transporter family mRNA.

[0100] Figure 3"Molecular sieve" purification and SDS-PAGE verification of wild-type hMRP5. "Molecular sieve" purification (left) and gel electrophoresis (SDS-PAGE, right) results, SDS-PAGE lanes 1-5 correspond to the "peak" positions of SEC 1.8, 1.9, 2.0, 2.1 and 2.2 mL, respectively.

[0101] Figure 4 Cryo-EM image of wild-type human MRP5 (wt-hMRP5). In the image: the green, blue, and pink parts are the Lasso domain, half 1 (transmembrane domain [TMD] 1 and nucleotide binding domain [NBD] 1), and half 2 (TMD2 and NBD2), respectively; the density C46-S64 that binds to the pocket of human MRP5 is orange.

[0102] Figure 5 Analysis of the structure of hMRP5-Δ1-94. Electron microscopy density map of hMRP5-Δ1-94 (left), and the empty substrate binding pocket of hMRP5-Δ1-94 (right). In the figure, green is the Lasso domain, and blue and pink are the two halves of hMRP5, respectively.

[0103] Figure 6 Analysis of contact sites of C46-S64 in the wt-hMRP5 structure. Electron microscopy density and side chain display of C46-S64 (left), atomic model of wt-hMRP5 (middle), and the interaction interface between C46-S64 and wt-hMRP5 (right). Amino acids associated with C46-S64 binding are shown as sticks colored by heteroatoms. Transmembrane helices (TMs) 2, 3, 5, 6, 9, 10, 11, and 12 that interact with C46-S64 are labeled. C46-S64 is in orange.

[0104] Figure 7 Design of peptides and detection of peptide binding affinity with hMRP5 using MST. In the figure: A. Amino acid sequence of the N-terminus (1-94) of wt-hMRP5 (upper figure); different peptides designed and used in the experiment (lower figure). B. Affinity detection of hMRP5-Δ1-94 with different peptides, doxorubicin and trequinsin. C. Amino acid sequences of M5PI polypeptide mutants A49F, T52F and S60P. D. Affinity detection of M5PI and its polypeptide mutants A49F, T52F and S60P. Data represent the mean ± SEM of three independent measurements.

[0105] Figure 8Results of the transport experiment in which M5PI inhibited the transport of doxorubicin by hMRP5. GFP fluorescence indicates the expression of GFP-tagged hMRP5 gene, and mcherry fluorescence indicates the expression of mcherry-tagged M5PI gene. Water was used as blank control. Bar = 100 μm. The y-axis is the concentration of doxorubicin in the final 50 μL of Xenopus oocyte extract used for mass spectrometry analysis. Data represent the mean ± SD of independent measurements. Points represent biologically independent experiments (n ≥ 3). A two-tailed t-test was performed. P = 0.0190 between blank and GFP-hMRP5; P = 0.0442 between GFP-hMRP5+mcherry-M5PI and GFP-hMRP5.

[0106] Fig. 9 Structural analysis of hMRP5 bound to M5PI. A. Structure of hMRP5 bound to M5PI (left). Electron microscopy density map of M5PI (orange, right). B. Hydrophobic pocket where M5PI binds to hMRP5. C. Interaction site between M5PI and hMRP5.

[0107] Fig.10 Binding affinity of hMRP4 to PGE1 and M5PI detected by MST. Data represent the mean ± SEM of three independent measurements. ND: not detected. DETAILED DESCRIPTION

[0108] The technical scheme of the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only exemplary descriptions and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are included in the scope that the present invention is intended to protect.

[0109] Unless otherwise specified, the raw materials and reagents used in the following examples are all commercially available products, or can be prepared by known methods. The biological experiments performed are all routine biological experiments in the art and can be performed according to the instructions of the corresponding experimental manual or kit instructions.

[0110] 1. Protein expression and purification:

[0111] The codon-optimized hABCC5 full-length gene encoding hMRP5 protein (UniProt ID: O15440) was cloned into the pCAG vector with a 2×Strep tag at the C-terminus by homologous recombination using the ClonExpress Ultra One Step Cloning Kit (Vazyme Biotech). 6When the cell / ml was 4.5mg linear polyethyleneimine (polyciences) and 1.5mg plasmid were mixed with HEK293F culture medium respectively. After 5min, the mixture was mixed evenly, and then transferred to 800ml HEK293F cells after standing for 15min. The transfected cells were cultured at 37℃. After 48h, centrifuged at 2000rpm for 10min, the cell pellet was resuspended and washed with 1× phosphate-buffered saline (PBS), and the cells were collected by centrifugation. The collected cells were quickly frozen with liquid nitrogen and stored at -80℃ for use. Subsequent purification processes were carried out at 4℃. After the cell pellet was thawed, it was lysed in a lysis buffer containing 100mM Tris-HCl (pH 8.0), 150mM NaCl, 1mM phenylmethylsulfonyl fluoride (PMSF), 2mM dithiothreitol (DTT), cocktail, 1% (DDM) and 0.2% (w / v) CHS. After 2 h, the cell lysate was centrifuged at 20,000 rpm for 1 h, and the supernatant was transferred to Strep-Tactin Beads (IBA Lifesciences) and further incubated at 4 ° C for 1.5 h. Then, the Strep-Tactin Beads were collected and washed with 20 column volumes of washing buffer, wherein the washing buffer contained 25 mM Tris-HCl (pH 8.0), 150 mM NaCl, 10% (v / v) glycerol, 2 mm DTT and 0.06% (w / v) digitonin (Apollo Scientific). After elution, the protein was eluted with an elution buffer containing 25 mM Tris-HCl (pH 8.0), 150 mM NaCl, 5% (v / v) glycerol, 2 mM DTT, 0.06% (w / v) digitonin and 50 mM biotin. The protein eluate was concentrated using a 100 kDa concentrator (Millipore) and further separated and purified using a Superose 6 Increase column (GE Healthcare) in a molecular sieve buffer containing 25 mM Tris-HCl (pH 8.0), 50 mM NaCl, 2 mM DTT and 0.06% (w / v) digitonin. Finally, the proteins with the highest peaks in molecular sieve purification were concentrated and used for further biochemical studies or cryo-EM sample preparation.

[0112] 2. Preparation of frozen samples:

[0113] The purified hMRP5 protein was concentrated to ~5 mg / ml. The porous carbon grid (Quantifoil Au R1.2 / 1.3, 300 mesh) was hydrophilized and the glow discharge conditions were 0.39 mBar air, 15 mA, 50 s. 4 μl of protein was added to the porous carbon grid and the sample was prepared using FEI Vitrobot Mark IV (Thermo Fisher Scientific). The preparation conditions were as follows: wait time was 11 s; blot time was 4 s; blot force was -2; temperature was 10 °C; humidity was 100%. Finally, the porous carbon grid was transferred to liquid nitrogen and stored until data acquisition.

[0114] 3. Cryo-EM data collection:

[0115] The steps for cryo-EM data collection in this study are as follows:

[0116] 1) Shooting the Atlas: The Atlas is a low-magnification map of the entire sample, which is used to select the required square when collecting data. Select Atlas-Session Setup, select New Session, enter the name you want to save, and Apply. Then select Atlas-Atlas Acquisition-Star to start shooting the Atlas.

[0117] 2)EPU parameter setting: First, click New Session in EPU-session setup to create a new session, enter the file name, select manual mode, Faster acquisition; select tiff format, select the corresponding grid model. The commonly used models in this study are: QUANTIFOIL R 1.2 / 1.3, grid: Au 300, and finally click Apply.

[0118] 3) Square selection: By default, EPU will automatically import the previous step Atlas and select all squares. Click Unselect All in EPU to cancel the selection. According to the thickness of the ice, use the mouse to point to the square you want to collect, right-click, select add, and select the square that suits your sample.

[0119] 4) Hole selection: Move the mouse to the selected square, click the left mouse button and select move stage to grid square. After the stage moves to the center of the square, select Hole selection in the left task bar. After selecting the desired hole in a square, click prepare all square in the task bar to calibrate the height of all selected squares. After that, select the required holes in all squares through Hole selection.

[0120] 5) Definition of shooting mode: After Hole Selection is completed, select Template Definition in the task bar on the left to define the empty position, shooting position, underfocus, focus position and focus mode.

[0121] 6) Data collection: Check auto loss to yes and click star run to start collecting data.

[0122] 4. Cryo-EM data processing:

[0123] In this study, cryo-EM data processing was mainly performed using Cryosparc. The specific steps are as follows:

[0124] 1) Create a new calculation project: Log in to Cryosparc and create a new calculation project.

[0125] 2) Import of electron microscope data images: In Builder-Import-Import Movies, select the photo path, and enter the corresponding pixel size according to the magnification of data collection, Voltage: 300kV; Spherical Aberration: 2.7mm; Total exposure dose: 50e / A 2 .

[0126] 3) Displacement Correction: Builder-Motion Correction-Patch Motion Correction. Drag the photo imported in the previous step to this task, set the parameter Output F-crop factor to 1 / 2, and submit the task.

[0127] 4) CTF Estimation: Builder-CTF Estimation-Patch CTF Estimation, drag the output of the previous step to this task, use the default parameters, and submit the task.

[0128] 5) Manually select particles: Builder-Particle Picking-Manual Picker, drag the output of the previous step to this task, use the default parameters, and submit the task. At this time, an interface will pop up, set the particle diameter to a diameter suitable for the sample. In this study, the particle diameter is set to 100-140, and the box size is set to 128. Click on the photo to select about 100 particles. After the selection is completed, click Done Picking|Extract Particles in the upper right corner.

[0129] 6) Calculation of 2D classification: Builder-Particle Curation-2D Classification. Drag the output of the previous step to this task. The Number of 2D classes depends on the specific situation. You can first select 100. The Number of online-EM iterations depends on the specific situation. You can first set it to 50. Set Cache particle images on SSD to uncheck.

[0130] 7) 2D selection: Builder-Particle Curation-Select 2D Class, drag the output of the previous step to this task, submit the task, and select as many 2D classes with characteristics and quality as possible.

[0131] 8) Template-based particle picking: Builder-Particle Picking-Template Picker, drag the output of the previous step to this task, set the particle diameter to 100-140, set the Maximum number of local maixmato consider to 4000, and submit the task.

[0132] 9) Check the particle picking results: Builder-Particle Picking-Inspect Particle Picks. Adjust the values ​​of the horizontal and vertical axes to make the particle picking results meet expectations, and click Done Picking in the upper right corner.

[0133] 10) Extraction of particles: Builder-Extraction-Extraction from Micrographs (multi-GPU), drag the output of the previous step to this task, set the box size to 128, and submit the task.

[0134] 11) Repeat the 2D classification and 2D selection steps.

[0135] 12) Reconstruction of the initial model: Builder-3D Reconstruction-Ab initio Reconstruction, drag the output of the previous step to this task, set the symmetry parameter Symmetry to C1, and submit the task.

[0136] 13) 3D Reconstruction: Builder-3D Refinement-Hetero Refinement. Drag the output of the previous step to this task, set the symmetry parameter Symmetry to C1, and submit the task.

[0137] 14) Three-dimensional reconstruction again: Builder-3D Refinement-NU Refinement, drag the output of the previous step to this task, set the symmetry parameter Symmetry to C1, submit the task, and end.

[0138] 5. Microscale thermophoresis (MST) experiment:

[0139] In this study, the MST experiment was mainly conducted using the MO series RED-tris-NTA protein labeling kit (NanoTemper, MO-L018). Based on the characteristics of RED-tris-NTA second-generation dye labeling proteins or peptides with His-tags, the inventors added 8-histidine His-tags when constructing the hMRP5 vector for MST experiments, so that the protein can be specifically labeled with the second-generation dye. The specific steps are as follows:

[0140] 1) Protein purification: In the MST experiment, Hepes buffer was used instead of Tris buffer for protein purification.

[0141] 2) Protein labeling: The purified protein was mixed with RED-tris-NTA second-generation dye. The final concentrations of protein and dye were controlled to be 50nM and 25nM, respectively.

[0142] 3) Protein-dye binding: Next, the serially diluted substrate or peptide (with the highest concentration of 100 μM) was thoroughly mixed with the labeled hMRP5 protein.

[0143] 4) Sample detection: The above samples were incubated at room temperature for 15 min, loaded using a capillary tube, and detected under 3% LED / excitation power and medium MST power. All peptides used in this study were synthesized by GLBiochem (Shanghai). MST data were analyzed using MO.Affinity Analysis software.

[0144] 6. In vitro Transcription

[0145] In vitro transcription refers to the use of DNA as a template to mimic the in vivo transcription process in an in vitro cell-free system under conditions containing RNA transcriptase, NTP, etc. to generate RNA. The in vitro transcription in this study was completed using the mMESSAGE mMACHINE T7 transcription kit. During the transcription process, taking the 20μL system as an example, 6μL of the recovered enzyme digestion product, 10μL 2×NTP / CAP, 2μL 10xreaction buffer and 2μL RNA transcriptase were fully mixed. After placing at 37℃ for 2h, 1μL TURBO DNase was added and incubated at 37℃ for 15min to fully remove the template DNA. After in vitro transcription, the RNeasy Mini Kit (QiaGen: 74104) was used for recovery, and the recovery steps were consistent with the above-mentioned gel recovery steps. The final transcribed RNA was stored at -80℃.

[0146] 7. Transport Experiment

[0147] The cell transport experiment is an important method for studying the transport mechanism of drug molecules across the cell membrane. The basic principle is that exogenous drug molecules are transported across the membrane mainly through two pathways: one is passive diffusion that does not rely on cell energy to cross the membrane, and the other is active transmembrane transport that relies on cell energy. hMRP5 obtains energy by hydrolyzing ATP to actively expel drug molecules in the cell to the outside of the cell, thereby reducing the therapeutic concentration of the drug in the cell and affecting the therapeutic effect. In order to evaluate the transport ability of hMRP5, the present invention uses Xenopus laevis oocytes as a cell transport experimental reaction system, treats Xenopus oocytes with anti-tumor drugs in the presence or absence of M5PI polypeptide molecules, and performs relative quantitative analysis of exogenous tumor drugs in the cell by mass spectrometry detection technology. Finally, the difference in the concentration of anti-tumor drug molecules in drug-treated and untreated cells is compared and analyzed; based on the concentration difference of anti-tumor drug molecules, the ability of hMRP5 to transport drugs is finally judged. The specific steps of the experiment are as follows:

[0148] 1) Preparation of cRNA: cRNAs of hMRP5 tagged with GFP at the C-terminus and M5PI tagged with mcherry at the C-terminus were prepared from the linearized pcs2CAG vector DNA template using the mMESSAGE mMACHINE T7 transcription system (the specific transcription method is described above).

[0149] The cRNA sequence of M5PI is:

[0150] 5'UGUUCCAAGUUCAGGAGAACUCGACCGUUGGAAUGCCAAGAUGCCUUGGAAACAGCAGCCC GAGCCGAGGGCCUCUCUUGAUGCCUCCAUGCAUUCUCAGCUCAGAAUCCUGGAUGAGUGU3'

[0151] The optimized RNA sequence can be:

[0152] 5'UGUAGCAAAUUCAGAAGAACUAGACCUCUCGAAUGUCAGGAUGCUCUUGAAACAGCUGCU AGAGCUGAGGGGCUGUCCCUUGACGCAUCAAUGCACAGCCAGCUGCGCAUUCUGGACGAGUGU3'

[0153] or,

[0154] 5'UGCUCAAAAUUUCGAAGAACAAGACCCCUGGAAUGCCAAGACGCCCUCGAGACCGCUGCAA GAGCCGAAGGACUGUCUCUUGACGCCUCCAUGCAUUCCCAGCUCCGGAUACUGGAUGAGUGC3'.

[0155] 2) Acquisition of Xenopus oocytes: Fresh Xenopus oocytes were placed in ND96 solution (96 mM NaCl, 2 mM KCl, 1 mM MgCl2, 1.8 mM CaCl2, 5 mM Hepes, pH 7.4) at 16°C overnight.

[0156] 3) cRNA injection: The above-mentioned Xenopus oocytes in good condition were injected with 30 nL cRNA, of which 30 ng were GFP-labeled hMRP5 and 30 ng were mcherry-labeled M5PI. At the same time, the blank group was injected with an equal volume of ddH2O. The injected Xenopus oocytes were cultured at 16°C for 3 days.

[0157] 4) Identification of cRNA overexpression: Detect GFP and mcherry fluorescence of oocytes using Nikon confocal A1R, and select oocytes with similar fluorescence intensity for subsequent detection.

[0158] 5) Incubation with doxorubicin: The selected oocytes were pre-incubated in Kulori buffer (90 mM NaCl, 1 mM KCl, 1 mM MgCl2, 5 mM Hepes, pH 7.4) for 5 min, then transferred to 1 mL Kulori buffer containing 200 μM doxorubicin and incubated at 16°C for 180 min.

[0159] 6) Preparation of mass spectrometry samples: Remove the Kulori buffer containing doxorubicin, wash at least 3 times with pre-cooled Kulori buffer, and transfer the oocytes to 1.5mL EP tubes (3 oocytes per tube). Remove the excess Kulori buffer in the EP tube, add 50μL 50% methanol to each tube, and repeatedly beat to fully break the oocytes. Centrifuge the homogenized sample at 13000rpm for 10min at 4℃, transfer the supernatant to a new EP tube, place at -20℃ for more than 1h to allow the fragments to further precipitate, and centrifuge at 13000rpm for 10min.

[0160] 7) Mass spectrometry analysis: The supernatant was analyzed using a Q Exactive mass spectrometer and an UltiMate 3000 liquid chromatography system (Thermo scientific, CA, USA). A Hypersil GOLDTM C18 column (2.1×100 mm, 1.9 μm, Thermo Scientific) was used with a flow rate of 0.3 ml min -1 Separation was performed. Mobile phase A was 0.1% formic acid and mobile phase B was 0.1% formic acid modified acetonitrile. The mass spectrometer was operated in positive mode with a spray voltage of 3.5 kV. Full scan mass spectrometry data were recorded in the range of m / z80-800. Based on the results of the analysis, a standard dilution curve for doxorubicin quantification was drawn and the transport test results were statistically analyzed using GraphPad Prism.

[0161] Example 1 Identification of the N-terminus of hMRP5 Autoinhibition

[0162] By protein purification ( Figure 3 ) and cryo-EM ( Figure 4 ) data analysis, the inventors found that wild-type hMRP5 (wt-hMRP5) contains a flexible N-terminal loop located before the lasso domain, from Met1 to Thr94 ( Figure 1 In addition, hMRP5 has a unique regulatory motif (R motif) in its first nucleotide binding domain (NBD) ( Figure 1 Except for some flexible regions (such as M1-T94, D500-L574 and L786-S840), most regions of hMRP5 can be atomically modeled ( Figure 4 ). Overall, hMRP5 exhibits the characteristics of a typical inward-open conformation without nucleotide binding; its height is ~ Width is~ The 12 transmembrane helices (TM1-TM12) form two pseudo-symmetric bundles (TMD1 and TMD2), each connected to a nucleotide binding domain (NBD). In addition to the TMD and NBD regions, a distinct electron microscopy density of peptide size and shape is shown in the transport channel close to the cytoplasmic leaflet.

[0163] In order to study the density of the wild-type human MRP5 binding pocket, the inventors truncated the N-terminal 1-94 of MRP5 (hMRP5-Δ1-94). The protein expression and purification of hMRP5-Δ1-94, the frozen sample preparation and cryo-EM data collection were the same as the previous method. Cryo-EM analysis found that ( Figure 5 ), the overall electron microscopic density map of hMRP5-Δ1-94 presents an inwardly open conformation, which is basically consistent with the conformation of wt-hMRP5, indicating that despite the lack of the N-terminus, hMRP5-Δ1-94 still retains the conformational state of the protein opening inward and binding to the substrate, and can still achieve binding and transport with the substrate. However, it is worth noting that the inventors did not observe additional electron microscopic density in the hMRP5-Δ1-94 transport channel, and the substrate binding pocket showed a cavity state, which indicates that the central cavity electron microscopic density comes from the flexible region of the N-terminus (Met1-Thr94) of hMRP5, revealing that the wild-type hMRP5 exists in a conformation that is bound by its own N-terminal fragment and inhibits the transport of bound substrates, that is, an autoinhibitory conformation. The inventors reported for the first time that this N-terminal polypeptide self-inhibits substrate transport in an ABC transporter, indicating that hMRP5 has a very different working mechanism from other ABC transporters. Through the structural characteristics of the electron microscopy density map of the peptide and repeated atomic model adjustments, the inventors finally determined that the electron microscopy density in the hMRP5 transport channel comes from the N-terminal Cys46-Ser64 peptide segment, referred to as C46-S64 here. The amino acids of this peptide segment can fit well in the electron microscopy density ( Figure 6 ). In terms of space, C46-S64 is located in a space with a volume of approximately space and bound near the plasma membrane ( Figure 6 ), and has extensive contacts with the surrounding transmembrane helices, including TM2-3, TM5-6 and TM9-12. In this binding pocket, C46-S64 presents a coiled, serpentine structure with its side chain facing the cytoplasm. By analyzing the amino acid sites interacting with C46-S64, it was found that the amino acids surrounding the C46-S64 peptide can be mainly divided into three groups, namely hydrophobic, polar and charged amino acids ( Figure 6 ), and through structural analysis, it was found that amino acids A49, T52 and S60 in C46-S64 are located in the hydrophobic pocket.

[0164] Example 2: Design of peptide molecules targeting hMRP5

[0165] The inventors designed peptides based on the N-terminal amino acid sequence information of hMRP5 and the above-mentioned protein structure analysis, and synthesized a series of polypeptide molecules, including Asp5-Ser25, Cys46-Ser64, Arg40-Arg70, Arg40-Ser60Asp-Arg70 (S60 was mutated to an acidic amino acid, hereinafter referred to as 40-70 (S60D)), Asp35-Glu75, Asp35Cys-Glu75Cys (D35C-E75C), Asp35Cys-Ala49Phe-G lu75Cys (D35C-A49F-E75C, abbreviated as A49F in the following examples, A49 is mutated to a hydrophobic amino acid), Asp35Cys-Thr52Phe-Glu75Cys (D35C-T52F-E75C, abbreviated as T52F in the following examples, T52 is mutated to a hydrophobic amino acid), Asp35Cys-Ser60Pro-Glu75Cys (D35C-S60P-E75C, abbreviated as S60P in the following examples, S60 is mutated to a hydrophobic amino acid) (Table 1). The inventors hope to find a sequence with strong binding affinity to block the transport of hMRP5 by screening the binding of these peptides to hMRP5.

[0166] Table 1 Amino acid sequences of different peptides

[0167]

[0168] Example 3: M5PI specifically targets hMRP5 with high affinity

[0169] In order to verify the binding affinity between hMRP5 and the designed peptide molecules, the inventors first expressed and purified the hMRP5-Δ1-94 protein, and used microscale thermophoresis (MST) technology to measure the binding affinity of these peptides to hMRP5-Δ1-94 ( Figure 7 ). MST results showed that except for 40-70 (S60D) (affinity Kd value of 104.6±74.4μM), the remaining peptides had high binding affinity with hMRP5, among which D35C-E75C had the highest binding affinity of 2.66±0.25μM ( Figure 7 ). This result shows that the adjacent amino acids other than C46-S64 also affect the binding of the peptide. In addition, the anti-tumor drug molecule doxorubicin will be transported out of hMRP5 and produce tumor cell resistance. The inventors further used MST technology to detect the affinity of the anti-tumor drug molecule doxorubicin to hMRP5; the results showed that the binding affinity of these peptides to hMRP5 is close to or higher than that of doxorubicin ( Figure 7 ). Similarly, in order to compare the difference between the binding affinity of the peptides and the existing hMRP5 inhibitors, the inventors tested the binding of the inhibitor trequinsin to hMRP5. Trequinsin is an inhibitor with a high binding affinity to hMRP5 reported so far, and has an inhibitory effect on the transport of hMRP5. The results showed that the binding affinity of these peptides to hMRP5 is close to or higher than that of trequinsin ( Figure 7 ). In general, the MST experiment proved that the designed peptides have a high affinity for hMRP5 compared with the substrate doxorubicin and the inhibitor troquinoxaline. They should be able to competitively bind to the hMRP5 transport channel and inhibit the transport of anti-tumor drug molecules. Among them, D35C-E75C has the highest binding affinity. Therefore, the inventors used D35C-E75C as the research fragment for subsequent experiments. For subsequent convenience, the inventors named the D35C-E75C peptide segment M5PI.

[0170] Example 4: M5PI inhibits hMRP5 transport of anti-tumor drug molecules at the cellular level

[0171] In order to further verify the inhibitory function of M5PI on hMRP5 transport substrates, the inventors conducted a transport experiment in African clawed frog oocytes. In this experiment, the inventors set up three groups, namely: blank group (injection of water); experimental group 1 (injection of GFP-hMRP5+mcherry-M5PI) and experimental group 2 (injection of GFP-hMRP5). The inventors selected oocytes with more consistent fluorescence expression for transport experiments. In the transport experiment, the oocytes were first incubated with the substrate doxorubicin, and then the supernatant was removed. The content of doxorubicin in the oocytes was detected by mass spectrometry to determine the transport capacity of hMRP5. The comparison between the blank group and the oocytes expressing only hMRP5 showed that the content of doxorubicin in the oocytes expressing only hMRP5 was significantly lower than that in the blank group, proving that in the case of overexpression of hMRP5, doxorubicin is transported and excreted outside the cells. When the two experimental groups were compared, it was found that the content of doxorubicin in oocytes expressing both hMRP5 and M5PI was relatively high, while the content of doxorubicin in oocytes expressing only hMRP5 was significantly reduced ( Figure 8 ), which indicates that in the presence of M5PI, the function of hMRP5 in transporting doxorubicin is inhibited. M5PI inhibits the transport process of hMRP5 and increases the concentration and efficacy of anti-tumor drug molecules in cells.

[0172] Example 5: The structural basis of M5PI binding and inhibition of hMRP5 is clear

[0173] On the basis of the previous functional experiments, in order to further evaluate whether M5PI can block the transport pathway in space, the inventors hope to analyze the structure of M5PI binding to hMRP5 by cryo-electron microscopy technology to observe the steric hindrance of M5PI to the protein. The inventors recombined M5PI and hMRP5-Δ1-94 in vitro at a ratio of 2:1, incubated at 4°C for 1h, prepared frozen samples and collected electron microscopy data. The inventors analyzed the electron microscopy density map of hMRP5-Δ1-94 bound to M5PI and found that the structure as a whole presented an inward open conformation ( Fig. 9 ), NBD separation, and the conformation is basically consistent with that of wt-hMRP5, which indicates that M5PI does not change the overall conformation of hMRP5. However, it is worth noting that a careful observation of the substrate binding pocket of hMRP5-Δ1-94 revealed that a density similar to C46-S64 appeared in the pocket. Since the hMRP5 in this structure is a 1-94 truncation, C46-S64 must not appear here. Therefore, the inventors believe that this density is M5PI incubated with hMRP5-Δ1-94 before frozen sample preparation. The atomic model shows that despite the lack of phosphorylated Ser60, M5PI exhibits almost the same conformation as C46-S64 when binding to the central cavity. In addition, in addition to the density derived from C46-S64, additional electron microscopy density corresponding to Met65-Leu69 was observed, indicating that these adjacent amino acid residues also contacted the transmembrane helix of hMRP5. Similar to C46-S64, M5PI forms an interaction interface composed of hydrophobic, electrostatic and hydrogen bonding interactions ( Fig. 9 ), stably binding to hMRP5. This structure mimics the autoinhibitory state of the natural N-terminal fragment tightly binding to hMRP5.

[0174] Example 6: M5PI specifically targets hMRP5

[0175] In order to further verify the specificity of M5PI for hMRP5, the inventors also used human MRP4 (hMRP4) as a control to detect the binding of hMRP4 with M5PI and PGE1 (hMRP4 substrate, prostaglandin E1) ( Fig.10 ). The results showed that hMRP4 could bind to PGE1 with μM affinity, but could not bind to M5PI, proving that M5PI is specific for hMRP5.

[0176] The results of the comprehensive use of microscale thermophoresis (MST) experiments, cell transport experiments and structural biology techniques consistently showed that there was a strong binding affinity between the M5PI inhibitor and human multidrug resistance-associated protein 5 (hMRP5). M5PI not only effectively inhibited the transport capacity of hMRP5 for doxorubicin, but also confirmed that it could specifically bind to the substrate binding pocket of hMRP5, thereby occupying and blocking the transport channel of drug molecules.

[0177] These findings indicate that M5PI, through its high affinity binding to the central pocket of hMRP5, may compete with anti-tumor drugs for substrate binding sites in the clinic, effectively inhibit hMRP5-mediated drug efflux, increase intracellular drug concentration, and thus improve the therapeutic effect. The peptide inhibitor strategy designed based on the protein's own regulatory region used in this study provides a valuable reference and scientific basis for the future development of new inhibitors against multidrug resistance.

[0178] The innovation of this method is that it not only intervenes in the specific structure and function of hMRP5, but also provides a new perspective and treatment strategy for overcoming the drug resistance problem in tumor treatment. Through this strategy, we can expect to develop more efficient and specific peptide inhibitors, bringing new hope for cancer treatment.

[0179] The above is an explanation of the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A polypeptide, characterized in that The polypeptide can compete with the C46-S64 peptide segment of hMRP5 and bind to the substrate binding pocket of hMRP5. The amino acid sequence of the polypeptide is shown in any one of SEQ ID No.1, SEQ ID No.5, SEQ ID No.9, SEQ ID No.13, SEQ ID No.14, SEQ ID No.15, SEQ ID No.16, and SEQ ID No.

17.

2. The polypeptide according to claim 1, characterized in that The amino acid sequence of the polypeptide is shown in SEQ ID No.

17.

3. A nucleic acid, characterized in that The nucleic acid encodes the polypeptide of claim 1 or 2.

4. The nucleic acid according to claim 3, characterized in that The nucleic acid is DNA, cRNA or mRNA.

5. The nucleic acid according to claim 3, characterized in that The nucleic acid is a nucleic acid encoding the amino acid sequence shown in SEQ ID No.

13.

6. An expression vector, characterized in that: The expression vector comprises the nucleic acid of claim 3.

7. A host cell, characterized in that The host cell contains the expression vector of claim 6 or the nucleic acid of claim 3 is integrated into its genome.

8. A pharmaceutical composition, characterized in that Comprising the polypeptide according to claim 1 or 2 or the nucleic acid according to claim 3.

9. The pharmaceutical composition according to claim 8, characterized in that Further comprising a pharmaceutically acceptable excipient.

10. Use of the polypeptide according to claim 1 or 2, the nucleic acid according to claim 3, or the pharmaceutical composition according to claim 8 in the preparation of a drug for treating tumors.

11. The use according to claim 10, characterized in that The medicine further comprises an anti-tumor drug.

12. The use according to claim 10, characterized in that The tumor is selected from leukemia, lymphoma, primary macroglobulinemia, heavy chain disease or solid tumor.

13. The use according to claim 12, characterized in that The leukemia is selected from acute leukemia, acute lymphocytic leukemia, acute myeloid leukemia, acute granulocytic leukemia, acute promyelocytic leukemia, acute myelo-monocytic leukemia, acute monocytic leukemia, chronic leukemia, chronic granulocytic leukemia, chronic lymphocytic leukemia or polycythemia vera.

14. The use according to claim 12, characterized in that The lymphoma is selected from Hodgkin's disease or non-Hodgkin's disease.

15. The use according to claim 12, characterized in that The solid tumor is selected from the group consisting of fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, endotheliosarcoma, lymphangiosarcoma, angiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, bronchial carcinoma , medullary carcinoma, renal cell carcinoma, hepatocellular carcinoma, Nile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, uterine cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, neurilemoma, meningioma, melanoma, neuroblastoma, retinoblastoma, esophageal cancer, gallbladder cancer, kidney cancer, or multiple myeloma.

16. The use according to claim 15, characterized in that The glioma is selected from glioblastoma, oligodendroglioma, astrocytoma or medulloblastoma.

17. The use according to claim 10, characterized in that The tumor is selected from pancreatic cancer, glioma, gastric cancer, breast cancer, cervical cancer, colorectal cancer, esophageal cancer, head and neck cancer, kidney cancer, leukemia, liver cancer, lung cancer, lymphoma or prostate cancer.

18. The use according to claim 17, characterized in that The glioma is selected from glioblastoma multiforme.

19. The use according to claim 10, characterized in that The tumor is a drug-resistant tumor.

20. The use according to claim 10, characterized in that The tumor is a tumor that highly expresses hMRP5.

21. The use according to claim 11, characterized in that The anti-tumor drug is selected from: drugs that destroy DNA structure and / or function; drugs that affect nucleic acid synthesis; drugs that act on nucleic acid transcription; topoisomerase I inhibitors that act on DNA replication; or drugs that act on mitosis to interfere with microtubule protein synthesis.

22. The use according to claim 21, characterized in that The drug that destroys DNA structure and / or function is an alkylating agent, nitrogen mustard, thiotepa, nitrosourea, methanesulfonate, platinum compound, mitomycin or bleomycin.

23. The use according to claim 21, characterized in that The drug that destroys DNA structure and / or function is nitrogen mustard, chlorambucil, cyclophosphamide, ifosfamide, thiotepa, carmustine, semustine, lomustine, busulfan, cisplatin, oxaliplatin, carboplatin, oxaliplatin, mitomycin or bleomycin.

24. The use according to claim 21, characterized in that The drug affecting nucleic acid synthesis is a dihydrofolate reductase inhibitor, a pyrimidine nucleotide synthetase inhibitor, a purine nucleotide synthetase inhibitor, a nucleotide reductase inhibitor or a DNA polymerase inhibitor.

25. The use according to claim 21, characterized in that The drug affecting nucleic acid synthesis is methotrexate, 5-FU, tegafur, capecitabine, 6-mercaptopurine, 6-TG, hydroxyurea, cytarabine, gemcitabine, pemetrexed, septomycin or ancitabine.

26. The use according to claim 21, characterized in that The drug acting on nucleic acid transcription is actinomycin D, daunorubicin, doxorubicin, epirubicin, aclarubicin or mithramycin.

27. The use according to claim 21, characterized in that The topoisomerase I inhibitor acting on DNA replication is irinotecan, topotecan or hydroxycamptothecin.

28. The use according to claim 21, characterized in that The drug that acts on the mitotic phase to interfere with tubulin synthesis is paclitaxel, docetaxel, vinblastine, vincristine, vinorelbine, podophyllotoxin or homoharringtonine.

Images