Staphylococcus cohnii S129 that promotes fat hydrolysis and has high antioxidant activity and application thereof

Abstract

The present application relates to the field of food processing technology, and in particular to a Staphylococcus cohnii S129 that promotes fat hydrolysis and has high antioxidant activity and an application thereof; the preservation number of Staphylococcus cohnii S129 is CCTCC NO.M 2024084; the preservation unit of Staphylococcus cohnii S129 is China Center for Type Culture Collection, the preservation name of Staphylococcus cohnii S129 is Staphylococcus cohnii S129, and the preservation time of Staphylococcus cohnii S129 is January 11, 2024; the Staphylococcus cohnii S129 solves the defects of poor hydrolysis and antioxidant properties of Staphylococcus cohnii.

Description

Technical Field

[0001] The present application relates to the field of food processing technology, and in particular to a Staphylococcus cohnii S129 that promotes fat hydrolysis and has high antioxidant activity and an application thereof. Background Art

[0002] With the continuous development of the field of food products, as an indispensable type on people's tables, the field of meat products has also made great progress; due to the perishable nature of meat products, in order to preserve the flavor of meat products, fermented meat products came into being; the starters currently widely used in fermented meat products include lactic acid bacteria and staphylococci, among which lactic acid bacteria are mainly responsible for acidifying meat products in the early stage of fermentation. In addition, lactic acid bacteria can also inhibit the growth of harmful bacteria to improve the microbial safety of fermented meat products; Staphylococci play an important role in the flavor formation and color stability of fermented meat products. Current research shows that staphylococci play an important role in the flavor formation of fermented meat products. It inhibits the formation of peroxides through the activity of antioxidant enzymes such as superoxide dismutase and catalase, and prevents excessive fat oxidation; Staphylococci can reduce nitrates to nitrites. During the fermentation and maturation process, nitrites combine with myoglobin to form nitric oxide myoglobin, making the meat color bright red and ensuring the appearance quality of meat products. Therefore, adding staphylococci to fermented meat products can prevent the rancidity of meat products and give them good color and flavor. In addition, Staphylococci can produce flavor and aroma compounds through protein hydrolysis and fat hydrolysis. Therefore, these functional characteristics of Staphylococci play an important role in the formation of quality characteristics of fermented meat products, which makes Staphylococci considered as important "flavor bacteria" in fermented meat products.

[0003] The staphylococci currently used in fermented meat products include Staphylococcus xylosus. xylosus), saprophytic Staphylococcus (S.saphylococcus), horse stomach Staphylococcus (S.equorum) and meat Staphylococcus (S.carnosus), epidermidis Staphylococcus (S.epidermidis), squirrel Staphylococcus (S.sciuri) and imitation Staphylococcus (S.simulans), among which S.xylosus and S.carnosus are the two most commonly used staphylococcal commercial fermentation agents in industry. However, commercial fermentation agents cannot always maintain their advantages in the process of competing with the microbial population of local meat products, which leads to the loss of ideal sensory properties of fermented meat products. Therefore, screening suitable fermentation agents from the microbial population of local meat products can better adapt to the local meat processing environment, and are more competitive due to their unique metabolic ability. However, there are few staphylococci with both high hydrolysis ability and high antioxidant activity reported in the literature, and it is difficult to efficiently complete the process of fat hydrolysis and oxidation. Therefore, how to provide a staphylococcus that promotes fat hydrolysis and has high antioxidant activity is a technical problem that needs to be solved urgently. Summary of the invention

[0004] The present application provides a Staphylococcus cohnii S129 that promotes fat hydrolysis and has high antioxidant activity and its application, so as to solve the technical problem that Staphylococcus aureus has poor fat hydrolysis and antioxidant ability in the prior art.

[0005] In the first aspect, the present application provides a Staphylococcus cohnii S129 that promotes fat hydrolysis and has high antioxidant activity, the preservation number of the Staphylococcus cohnii S129 is CCTCC NO.M 2024084; the preservation unit of the Staphylococcus cohnii S129 is: China Center for Type Culture Collection, the preservation name of the Staphylococcus cohnii S129 is Staphylococcus cohnii S129, and the preservation time of the Staphylococcus cohnii S129 is January 11, 2024.

[0006] Optionally, the 16S rRNA sequence of Staphylococcus cohnii S129 is shown as SEQ ID NO.1.

[0007] Optionally, the homology between the Staphylococcus cohnii S129 and Staphylococcus cohnii Tr05I is ≥ 99.8%.

[0008] Optionally, the total intracellular reducing power of the Staphylococcus cohnii S129 is ≥80%, and the total reducing power of the bacterial solution of the Staphylococcus cohnii S129 is ≥95%.

[0009] In a second aspect, the present application provides an application of Staphylococcus cohnii S129 that promotes fat hydrolysis and has high antioxidant activity, wherein the application comprises using the Staphylococcus cohnii S129 described in the first aspect in the fermentation of meat products.

[0010] Optionally, the amount of Staphylococcus cohnii S129 added is ≥ 1×10 7 CFU / g.

[0011] Optionally, the fatty acid content of the meat product after fermentation by the Staphylococcus cohnii S129 is 5 times or more than the fatty acid content of the meat product after fermentation itself.

[0012] Optionally, the total aldehyde content of the meat product after fermentation itself is 1.5 times or more of the total aldehyde content of the fermented meat product after fermentation by the Staphylococcus cohnii S129.

[0013] Optionally, the residual nitrite content of the meat product after fermentation by the Staphylococcus cohnii S129 is ≤5 mg / kg, and the number of enterobacteriaceae in the meat product after fermentation by the Staphylococcus cohnii S129 is 3.28 lg CFU / g to 4.09 lg CFU / g.

[0014] Optionally, the meat product comprises sausage.

[0015] The above technical solution provided by the embodiment of the present application has the following advantages compared with the prior art:

[0016] The embodiment of the present application provides a Staphylococcus cohnii S129 that promotes fat hydrolysis and has high antioxidant activity. By screening out Staphylococcus cohnii S129 with high fat hydrolysis ability and high antioxidant activity belonging to Staphylococcus cohnii in fermented meat products, the Staphylococcus cohnii S129 can effectively promote fat hydrolysis, thereby hydrolyzing the fat in the meat product into diglycerides, monoglycerides and free fatty acids. The intracellular SOD activity of the Staphylococcus cohnii S129 is 1077.58 (U / mg prot), and the antioxidant activity is equivalent to the antioxidant capacity of 5 mg / mL Vc. Therefore, the present application provides a Staphylococcus cohnii S129 with high fat hydrolysis ability and high antioxidant activity, which solves the defect of poor antioxidant property of current staphylococci. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the present application and, together with the description, serve to explain the principles of the present application.

[0018] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 The Gram staining result of Staphylococcus cohnii CCTCC M 2024084 provided in the examples of the present application;

[0020] Figure 2 This is a result diagram of the colony morphology of Staphylococcus cohnii CCTCC M 2024084 provided in the examples of the present application;

[0021] Figure 3 The 16r sRNA phylogenetic tree of Staphylococcus cohnii CCTCC M 2024084 provided in the examples of the present application;

[0022] Figure 4 This is a graph showing the hemolysis results of Staphylococcus cohnii CCTCC M 2024084 provided in the examples of the present application;

[0023] Figure 5This is a graph of plasma coagulase test results of Staphylococcus aureus CCTCC M 2024084 provided in the examples of the present application, wherein + in the graph represents a positive reference strain Staphylococcus aureus ATCC 43300; – represents sterile saline as a negative control; and the middle represents Staphylococcus aureus CCTCC M 2024084;

[0024] Figure 6 The electrophoresis diagram of the PCR amplification of the thermostable nuclease gene of Staphylococcus cohnii CCTCC M 2024084 provided in the examples of the present application, wherein lane 1 is the positive control standard strain Staphylococcus aureus ATCC 43300, lane 2 is the 2000 bp Marker, lane 3 is the blank control, lane 4 is the negative control standard strain Listeria monocytogenes ATCC 19111, and lane 5 is Staphylococcus cohnii CCTCC M 2024084;

[0025] Figure 7 This is a graph showing the acid resistance test results of Staphylococcus cohnii CCTCC M 2024084 provided in the examples of the present application, in which from left to right are the positive control, Staphylococcus cohnii CCTCC M2024083 and the negative control;

[0026] Figure 8 This is a graph of the sodium chloride resistance test results of Staphylococcus cohnii CCTCC M 2024084 provided in the examples of the present application, in which from left to right are the positive control, Staphylococcus cohnii CCTCC M2024083 and the negative control;

[0027] Fig. 9 This is a graph of the low temperature resistance test results of Staphylococcus cohnii CCTCC M 2024084 provided in the examples of the present application, in which from left to right are the positive control, Staphylococcus cohnii CCTCC M2024083 and the negative control;

[0028] Fig.10 This is a graph of the nitrite resistance test results of Staphylococcus cohnii CCTCC M 2024084 provided in the examples of the present application, in which from left to right are the positive control, Staphylococcus cohnii CCTCC M2024083 and the negative control;

[0029] Fig.11 This is a graph showing the results of a lipase hydrolysis experiment of Staphylococcus cohnii CCTCC M 2024084 provided in the examples of the present application;

[0030] Fig.12This is a total ion current chromatogram of fatty acids in a meat simulation medium inoculated with Staphylococcus cohnii CCTCC M 2024084 provided in an embodiment of the present application after fermentation for 48 hours, in which 1 is (C11:0), 2 is (C12:0), 3 is (C14:0), 4 is (C16:0), 5 is (C18:0), 6 is (C20:0), 7 is (14:1), 8 is (C15:1), 9 is (C17:1), 10 is (C18:1n9t), 11 is (C18:1n9c), 12 is (C18:2n6c), 13 is (C18:2n6t), 14 is (C20:1), 15 is (C18:3n3), and 16 is (C20:2);

[0031] Fig.13 This is a cooked sausage slice diagram provided in the embodiment of the present application. The left side of the figure is a blank control, and the middle is a 1×10 5 CFU / g fermented sausage of Staphylococcus cohnii CCTCC M 2024084, the right side shows the inoculum size of 1×10 7 CFU / g of fermented sausages containing Staphylococcus cohnii CCTCC M 2024084;

[0032] Fig.14 The total ion current chromatogram of 37 kinds of fatty acid methyl ester mixed standards provided in the embodiment of the present application, in which 1 is (C4:0), 2 is (C6:0), 3 is (C8:0), 4 is (C10:0), 5 is (C11:0), 6 is (C12:0), 7 is (C13:0), 8 is (C14:0), 9 is (C14:1), 10 is (C15:0), 11 is (C15:1), 12 is (C16:0), 13 is (C16:1), 14 is (C17:0), 15 is (C17:1), 16 is (C18:0), 17 is (C18:1), 18 is (C18:1 T), 19 is (C18:2), 20 is (C18:2TT), 21 is (C18:3), 22 is (C18:3), 23 is (C20:0), 24 is (C20:1), 25 is (C21:0), 26 is (C20:2), 27 is (C22:0), 28 is (C22:1), 29 is (C20:3), 30 is (C20:3), 31 is (C20:4), 32 is (C23:0), 33 is (C22:2), 34 is (C24:0), 35 is (C20:5), 36 is (C24:1), and 37 is (C22:6);

[0033] Fig.15 The inoculation provided in the present application example is 1×10 7CFU / g Total ion current chromatogram of fatty acids in sausage fermented for 15 days with Staphylococcus cohnii CCTCC M 2024084, in which 1 is (C10:0), 2 is (C11:0), 3 is (C12:0), 4 is (C14:0), 5 is (C15:0), 6 is (C16:0), 7 is (C17:0), 8 is (C18:0), 9 is (C20:0), 10 is (C15: 1), 11 is (C16:1), 12 is (C17:1), 13 is (C18:1n9t), 14 is (C18:1n9c), 15 is (C22:1n9), 16 is (C24:1), 17 is (C18:2n6c), 18 is (C18:3n3), 19 is (C20:4n6), and 20 is (C22:2). DETAILED DESCRIPTION

[0034] In order to make the purpose, technical solution and advantages of the embodiments of the present application clearer, the technical solution in the embodiments of the present application will be clearly and completely described below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of this application.

[0035] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in this application can be purchased from the market or prepared by existing methods.

[0036] An embodiment of the present application provides a Staphylococcus cohnii S129 that promotes fat hydrolysis and has high antioxidant activity. The preservation number of the Staphylococcus cohnii S129 is CCTCC NO.M 2024084; the preservation unit of the Staphylococcus cohnii S129 is: China Center for Type Culture Collection, the preservation name of the Staphylococcus cohnii S129 is Staphylococcus cohnii S129, and the preservation time of the Staphylococcus cohnii S129 is January 11, 2024.

[0037] In some optional embodiments, the 16S rRNA sequence of Staphylococcus cohnii S129 is as shown in SEQ ID NO.1; in these embodiments, refining the specific 16S rRNA sequence of Staphylococcus cohnii S129 can further clarify that Staphylococcus cohnii S129 does belong to the genus of Staphylococcus cohnii.

[0038] In some optional embodiments, the homology between Staphylococcus cohnii S129 and Staphylococcus cohnii Tr05I is ≥99.8%; in these embodiments, it is clear that the homology between Staphylococcus cohnii and Staphylococcus cohnii Tr05I is ≥99.8%, which can be combined with the 16S rRNA sequence of Staphylococcus cohnii to determine that Staphylococcus cohnii S129 does belong to the genus of Staphylococcus cohnii.

[0039] In some optional embodiments, the total intracellular reducing power of the Staphylococcus cohnii S129 is ≥80%, and the total reducing power of the bacterial solution of the Staphylococcus cohnii S129 is ≥95%; in these embodiments, the total intracellular reducing power of Staphylococcus cohnii S129 may be ≥80%, and the total reducing power of the bacterial solution may be ≥95%, which indicates that the Staphylococcus cohnii S129 has good antioxidant properties.

[0040] It should be noted that, it is precisely because the Staphylococcus cohnii S129 has good antioxidant properties that it can inhibit the oxidation of fatty acids in the process of fat hydrolysis to positively regulate fat hydrolysis, thereby enabling the Staphylococcus cohnii S129 to promote fat hydrolysis.

[0041] Based on a general inventive concept, an embodiment of the present application provides an application of Staphylococcus cohnii S129 that promotes fat hydrolysis and has high antioxidant activity, wherein the application includes using the Staphylococcus cohnii S129 in meat product fermentation.

[0042] The application is realized based on the above-mentioned Staphylococcus cohnii S129. The specific information of the Staphylococcus cohnii S129 can be referred to the above-mentioned embodiment. Since the application adopts part or all of the technical solutions of the above-mentioned embodiment, it has at least all the beneficial effects brought by the technical solutions of the above-mentioned embodiment, which will not be described one by one here.

[0043] In some optional embodiments, the amount of Staphylococcus cohnii S129 added is ≥ 1×10 7 CFU / g; in these embodiments, the amount of Staphylococcus cohnii S129 added can be ≥1×10 7 CFU / g, the meat products can be effectively fermented by the Staphylococcus cohnii S129. In addition, the Staphylococcus cohnii S129 can also promote the hydrolysis of fat in the fermentation stage of meat products and has good antioxidant properties, ultimately obtaining fermented meat products with unique flavor and good antioxidant quality.

[0044] In some optional embodiments, the fatty acid content of the meat product after fermentation by the Staphylococcus cohnii S129 is 5 times or more than the fatty acid content of the meat product after fermentation itself; in these embodiments, when the fatty acid content of the meat product after fermentation by Staphylococcus cohnii S129 can be 5 times or more than the fatty acid content of the meat product after fermentation itself, it can be indicated that Staphylococcus cohnii S129 can promote the hydrolysis of fat in the meat product.

[0045] In some optional embodiments, the total aldehyde content of the meat product after fermentation itself is 1.5 times or more than the total aldehyde content of the fermented meat product after fermentation by the Staphylococcus cohnii S129; in these embodiments, since most of the lipids in the meat product are aldehydes after oxidation, the total aldehyde content after fermentation by Staphylococcus cohnii S129 is clarified, and it can be determined that the Staphylococcus cohnii S129 has a high antioxidant activity.

[0046] In some optional embodiments, the residual nitrite content of the meat product after fermentation with the Staphylococcus cohnii S129 is ≤5 mg / kg, and the number of Enterobacteriaceae in the meat product after fermentation with the Staphylococcus cohnii S129 is 3.28 lg CFU / g to 4.09 lg CFU / g; in these embodiments, it is clear that the residual nitrite content in the meat product after fermentation with Staphylococcus cohnii S129 can be ≤5 mg / kg, and the number of Enterobacteriaceae can be 3.28 lg CFU / g to 4.09 lg CFU / g, which can indicate that the Staphylococcus cohnii S129 can be safely and harmlessly used in meat foods.

[0047] In some optional embodiments, the meat product includes sausage; in these embodiments, the specific type of the meat product can be identified to determine the best meat product for which Staphylococcus cohnii S129 is suitable.

[0048] The present application will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are intended only to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are usually measured according to industry standards. If there is no corresponding industry standard, then the conditions recommended by the manufacturer are followed.

[0049] Example 1

[0050] Conduct experiments with different bacterial species, as follows:

[0051] 1. Materials:

[0052] 1. Strains used: Listeria monocytogenes ATCC 19111, Staphylococcus aureus ATCC 43300 and Staphylococcus cohnii CCTCC M 202408.

[0053] 2. Reagents:

[0054] (1) Experimental reagents are shown in Table 1.

[0055] Table 1 Experimental reagents

[0056] name Manufacturer Tributyrin Agar Base Beijing Solable Technology Co., Ltd. Tributyrin Yuanye Biotechnology Co., Ltd. Polyvinyl alcohol Yuanye Biotechnology Co., Ltd. Beef Noodles Thermo Fisher Scientific Peptone Thermo Fisher Scientific MRSA agar medium Qingdao Haibo Biotechnology Co., Ltd. MRSB medium Qingdao Haibo Biotechnology Co., Ltd. MSA medium Qingdao Haibo Biotechnology Co., Ltd. TSB medium Qingdao Haibo Biotechnology Co., Ltd. PCA medium Qingdao Haibo Biotechnology Co., Ltd. VRBGA Medium Qingdao Haibo Biotechnology Co., Ltd. Blood (agar) plate culture medium Qingdao Haibo Biotechnology Co., Ltd. Lyophilized rabbit plasma Qingdao Haibo Biotechnology Co., Ltd. hydrochloric acid Chengdu Cologne Chemicals Co., Ltd. Sodium Nitrite Chengdu Kelong Chemical Reagent Factory ascorbic acid Chengdu Cologne Chemicals Co., Ltd. glucose Fuchen (Tianjin) Chemical Reagent Co., Ltd. sucrose Chengdu Cologne Chemicals Co., Ltd. Sodium chloride Chengdu Kelong Chemical Reagent Factory 1,1-Diphenyl-2-trinitrophenylhydrazine Yuanye Biotechnology Co., Ltd. Ferric chloride Yuanye Biotechnology Co., Ltd. pyrogallic acid Yuanye Biotechnology Co., Ltd. Potassium ferrocyanide Yuanye Biotechnology Co., Ltd. Superoxide dismutase (SOD) kit Beijing Solable Technology Co., Ltd. Catalase (CAT) Kit Beijing Solable Technology Co., Ltd.

[0057] (2) Instruments and equipment are shown in Table 2.

[0058] Table 2 Instruments and equipment

[0059] Instruments and Equipment Manufacturer High temperature and high pressure sterilizer Japan Sanyo Electric Co., Ltd. Constant temperature culture oscillator Shanghai Zhicheng Analytical Instrument Manufacturing Co., Ltd. Digital constant temperature water bath Guohua (Changzhou) Instrument Manufacturing Co., Ltd. UV-Vis Spectrophotometer Shanghai Youke Instrument Co., Ltd. Multiskan FC Microplate Reader Meigu Molecular Instruments (Shanghai) Co., Ltd. Fluorescence spectrophotometer Nako Office Trace DSQ Gas Chromatography-Mass Spectrometer Thermo Corporation Trace ISQ Gas Chromatography-Mass Spectrometer Thermo Corporation PCR instrument Hangzhou Biori Technology Co., Ltd. pH Meter Sichuan Zhiboyun Technology Co., Ltd. Electric constant temperature incubator Shanghai Qixin Scientific Instrument Co., Ltd. Analytical Balance Mettler-Toledo Instruments Ltd. Chemical Safety Cabinets Shanghai Youke Instrument Co., Ltd. Amino solid phase extraction cartridge Shanghai Anpu Laboratory Technology Co., Ltd.

[0060] 3. Experimental methods:

[0061] 1. Activation of strains and preparation of fresh bacterial solution:

[0062] Activation of strains: Take out the Staphylococcus cohnii CCTCC M 2024084 strain preserved at -80°C, thaw it at room temperature, aspirate 100 μL of the preserved bacterial solution, and inoculate it into TSB broth medium at a 2% inoculation rate, then culture at 37°C with shaking at 150 rpm for 18 h, aspirate the fresh bacterial solution and streak it onto MSA medium, culture at 37°C for 24 h until a single colony grows on the MSA medium, and set aside.

[0063] Preparation of fresh bacterial culture: Pick a single colony and inoculate it into TSB broth medium, then culture it at 37°C with shaking at 150 rpm for 18 h to obtain fresh bacterial culture in the logarithmic growth phase.

[0064] 2. Preparation of culture medium:

[0065] (1) Acid resistance test medium:

[0066] The pH value of the TSB medium was adjusted to between 4.8 and 5.0 with 0.1% HCl, and then sterilized by high pressure at 121° C. for 15 min.

[0067] (2) Low temperature resistance test medium:

[0068] The TSB medium was sterilized by autoclaving at 121°C for 15 min.

[0069] (3) Sodium chloride resistant medium:

[0070] Add 6% by mass of NaCl to TSB medium and sterilize by high pressure at 121°C for 15 min.

[0071] (4) Nitrite-resistant culture medium:

[0072] Add 150 mg / kg of NaNO2 to TSB medium and sterilize by high pressure at 121°C for 15 min.

[0073] (5) Tributyrin basal medium:

[0074] Weigh 4g of tributyrin agar basal culture, add it to 200mL of distilled water, heat and boil to dissolve, and sterilize it under high pressure at 121℃ for 15min. Because tributyrin is insoluble in water, polyvinyl alcohol is used as an emulsifier. The mass ratio of tributyrin: polyvinyl alcohol = 1:3 is used to homogenize and emulsify tributyrin. When the tributyrin basal culture medium is cooled to 60℃, add 2mL of sterilized tributyrin polyvinyl alcohol emulsion to each 200mL of culture medium, shake well, and pour into a plate for later use.

[0075] 3. Morphology and identification of strains:

[0076] (1) Gram staining and cell morphology observation experiment:

[0077] Gram staining experiment was performed, and then the cell morphological characteristics of Staphylococcus cohnii CCTCC M 2024084 were observed and recorded under an optical microscope.

[0078] (2) Colony morphology observation experiment:

[0079] Streak fresh bacterial liquid of Staphylococcus cohnii CCTCC M 2024084 onto MSA medium and culture at 37°C for 24 h to grow single colonies on MSA medium. Observe and record the morphological characteristics of the colonies.

[0080] (3) 16S rRNA homology analysis:

[0081] DNA extraction: Add 500 μL of DNA extraction solution (final concentration is 20 mM Tris; 2 mM EDTA; 1% Triton X-100; 0.1 M NaOH) to a 1.5 mL centrifuge tube, pick a single colony in the extraction solution, disperse it evenly, boil it for 13 minutes, then ice bath it for 5 to 10 minutes, and then centrifuge it at 12000 rpm for 3 minutes. The supernatant is the DNA solution.

[0082] PCR reaction system and conditions: The extracted DNA was amplified using the universal primers 27F: 5'-AGAGTTTGATCCTGGCTCAG-3' and 1492R: 5'-GGTTACCTTGTTACGACTT-3' of the bacterial 16S rRNA gene, and the fragments were sent to Shanghai Biotechnology Co., Ltd. for sequencing (Shanghai, China). The gene sequences of the sequencing results were entered into the nucleic acid database of the National Center for Biotechnology Information (NCBI) for BLAST analysis, homology analysis was performed based on similarity and coverage, and phylogenetic tree analysis was performed using MEGA6 software to construct a phylogenetic tree.

[0083] 4. Safety test methods:

[0084] (1) Hemolysis test:

[0085] Pick a single colony and streak it on a blood plate, invert and culture it at 37℃ for 24h, observe whether it is hemolyzed, and use β-hemolytic Staphylococcus aureus ATCC 43300 as a positive control. If a transparent hemolytic zone appears around the colony, it is judged as β-hemolysis, which is a positive result; if no hemolytic zone appears, it is judged as γ-hemolysis (i.e., no hemolysis), which is a negative result.

[0086] (2) Plasma coagulase test:

[0087] Add 500 μL of sterile saline to the vial containing freeze-dried rabbit plasma and shake until dissolved. Add 300 μL of fresh bacterial solution, mix well, and culture at 37°C. Observe every 30 minutes. If coagulation occurs, it is considered a positive result, otherwise it is a negative result. The vial inoculated with Staphylococcus aureus ATCC 43300 is used as the positive control, and the vial inoculated with sterile water is used as the negative control.

[0088] (3) Thermostable nuclease gene detection experiment:

[0089] The DNA of the samples was extracted by boiling method, the positive control was Staphylococcus aureus ATCC 43300, the negative control was Listeria monocytogenes ATCC 19111, and sterile saline was used as blank control. The information of the thermostable nuclease gene primers, PCR reaction system and reaction procedure used are shown in Table 3, Table 4 and Table 5, respectively.

[0090] Table 3 Thermostable nuclease primer information

[0091]

[0092] Table 4 PCR reaction system

[0093] Components volume <![CDATA[Taq PCR Master Mix(2 x ,blue dye)]]> 10μL 10μM 0.4μL 10μM 0.4μL DNA template 1μL <![CDATA[dd H2O]]> 8.2μL

[0094] Table 5 PCR reaction program

[0095]

[0096] 5. Production adaptability experimental methods

[0097] (1) Acid resistance test:

[0098] Pick a single colony and inoculate it in an acid-resistant culture medium (pH 4.9-5.0), and culture it at 37°C and 150 rpm for 24-48 hours. The acid resistance of the strain is defined according to the turbidity of the culture medium, with positive "+, ++, +++" and negative "-". The bacterial solution cultured at the initial pH of 6.5 is used as the positive control, and the acid-resistant culture medium inoculated with sterile water is used as the negative control.

[0099] (2) Low temperature resistance test:

[0100] Pick a single colony and inoculate it in the corresponding low-temperature resistant culture medium, and culture it at 10℃ and 150rpm for 24-48h. The degree of low-temperature resistance of the strain is defined according to the turbidity of the culture medium, with positive "+, ++, +++" and negative "-". The bacterial solution cultured at 37℃ is used as the positive control, and the culture inoculated with sterile water at 10℃ is used as the negative control.

[0101] (3) Salt tolerance test:

[0102] Pick a single colony and inoculate it in a salt-tolerant medium, and culture it at 37°C at 150 rpm for 24-48 hours. The salt tolerance of the strain is defined by the turbidity of the medium, with positive values ​​of "+, ++, +++" and negative values ​​of "-". The bacterial solution cultured at 37°C without adding NaCl is used as the positive control, and the salt-tolerant medium inoculated with sterile water is used as the negative control.

[0103] (4) Nitrite resistance test:

[0104] Pick a single colony and inoculate it in a nitrite-resistant culture medium, and culture it at 37°C at 150rpm for 24-48h. The turbidity of the culture medium is used to define the salt tolerance of the strain, with positive results being "+, ++, +++" and negative results being "-". The bacterial solution cultured at 37°C without adding NaNO2 is used as the positive control, and the nitrite-resistant culture medium inoculated with sterile water is used as the negative control.

[0105] 6. Lipase hydrolysis of bacterial strains and antioxidation test methods of bacterial liquid:

[0106] (1) Strain lipase hydrolysis experiment:

[0107] A single colony of Staphylococcus cohnii CCTCC M 2024084 was picked and inoculated on a lipase culture medium. It was cultured at 37°C for 3 to 4 days, and the formation of a transparent zone was observed. The center of the colony was taken as the center of the circle, and the colony radius and the transparent zone radius (unit: cm) were measured respectively. The difference between the two radii was used to define the lipase activity of the strain: when 0≤difference≤0.1, the lipase activity of the strain was defined as "+", when the difference was 0.2, the lipase activity of the strain was defined as "++", when the difference was 0.3, the lipase activity of the strain was defined as "+++", when the difference was 0.4, the lipase activity of the strain was defined as "++++", when the difference was ≥0.5, the lipase activity of the strain was defined as "+++++", when the difference was ≥0.6, the lipase activity of the strain was defined as "++++++", and the lipase activity of the strain without a transparent zone was defined as "-".

[0108] (2) Determination of the antioxidant capacity of bacterial liquid in vitro:

[0109] 1) DPPH free radical scavenging ability determination:

[0110] According to the method of the prior art, the determination was performed as follows: 1 mL of 0.2 mmol / L DPPH anhydrous ethanol solution was added to 1 mL of fresh bacterial liquid, mixed thoroughly, and reacted at room temperature in the dark for 30 min, then centrifuged at 6000 rpm for 10 min, and the absorbance of the supernatant was measured at 517 nm. At the same time, 5 mg / mL V C and 10 mg / mL V C As a positive control. The clearance rate calculation formula is as follows:

[0111] DPPH free radical scavenging rate = [1-(A1-A2) / A0] × 100

[0112] Wherein, A1 is the absorbance of a solution containing 1 mL of DPPH and 1 mL of fresh bacterial solution, A2 is the absorbance of a solution containing 1 mL of anhydrous ethanol and 1 mL of fresh bacterial solution, and A0 is the absorbance of a solution containing 1 mL of DPPH and 1 mL of anhydrous ethanol.

[0113] 2) Superoxide anion free radical (·O 2- ) Determination of the removal capacity:

[0114] According to the method of the prior art, the determination was carried out as follows: 3.4 mL of Tris-HCl (50 mmoL / L, pH = 8.2) and 0.5 mL of pyrogallol solution (150 mmoL / L) were added to 1 mL of fresh bacterial solution, mixed and reacted at 25°C for 4 min, then 0.1 mL of HCl solution (8 mmoL / L) was added to terminate the reaction, and the absorbance was measured at 325 nm. At the same time, 5 mg / mL V C and 10 mg / mL VC As a positive control, the clearance rate was calculated as follows:

[0115] Superoxide anion clearance rate (%) = [1-(A3-A2) / (A1-A0)] × 100

[0116] Where A0 is the OD under the condition without sample and pyrogallol. 325 A1 is the OD value without sample and with pyrogallol. 325 A2 is the OD under the condition of containing sample but not containing pyrogallol. 325 A3 is the OD under the condition of sample and pyrogallol 325 value.

[0117] 3) Total reducing capacity determination:

[0118] According to the method of the prior art, the determination is performed as follows: 0.5 mL of PBS (0.2 mol / L, pH=6.6) and 0.5 mL of potassium ferricyanide (mass fraction 1%) are added to 0.5 mL of fresh bacterial liquid, mixed and placed in a water bath at 50°C for 20 min, cooled rapidly after the reaction, and then 0.5 mL of trichloroacetic acid (mass fraction 10%) is added, centrifuged at 4000 rpm for 10 min, 1 mL of the supernatant is taken, 1 mL of distilled water and 1 mL of ferric chloride (mass fraction 0.1%) are added, mixed and allowed to stand for 10 min, and the absorbance value A1 is measured at 700 nm. The higher the absorbance value, the stronger the reducing ability. At the same time, 5 mg / mL V C and 10 mg / mL V C As a positive control, distilled water A0 was used as a blank control. The total reducing power was calculated as follows:

[0119] Total reducing power (%) = [(A1-A0) / A1] × 100

[0120] (3) Determination of intracellular antioxidant capacity and antioxidant enzymes:

[0121] 1) Determination of intracellular antioxidant capacity:

[0122] The method for determining antioxidant capacity is the same as in step 6 (2).

[0123] 2) Determination of intracellular antioxidant enzymes and antioxidant capacity:

[0124] Preparation of cell-free extract (CFE): Transfer the fresh bacterial solution to a 50mL centrifuge tube, centrifuge at 8000rpm for 5min at 4℃, and discard the supernatant. Resuspend with PBS buffer and centrifuge at 8000rpm for 5min at 4℃, discard the supernatant, and repeat this step 2-3 times. Finally, freeze the bacteria at -80℃ for 30min, and then freeze-dry them in vacuum for 6-8h. The dried samples are stored at -80℃ for later use. Take 20mg of the sample and grind it in a mortar with liquid nitrogen, then dissolve the sample with buffer, and centrifuge at 8000rpm for 5min at 4℃ to obtain CFE. Among them, the intracellular antioxidant system is determined by using PBS buffer (pH=7.0) to dissolve the ground sample; the intracellular antioxidant enzyme is determined by using SOD or CAT extract to dissolve the ground sample.

[0125] The activities of superoxide dismutase (SOD) and catalase (CAT) were determined using SOD and CAT kits, respectively. The protein concentration of the filtrate was determined using a Bradford protein concentration assay kit.

[0126] 4. Meat simulation culture medium fermentation experiment:

[0127] Meat simulation medium: prepare 200mL system, which contains 1.76g beef extract, 2.2g peptone, 0.44g yeast powder, 0.2mL Tween 80, 0.0076g manganese sulfate pentahydrate, 1.224g calcium lactate pentahydrate, 8g sodium chloride. After mixing, sterilize at 121℃ for 15min, add 0.013g / mL glucose solution after filtration and sterilization, and then add the emulsified and sterilized substrate triglyceride and phospholipid, and the ratio of triglyceride to phospholipid is 4:1, add 1.6g triglyceride and 0.4g phospholipid.

[0128] Staphylococcus cohnii CCTCC M 2024084 was inoculated into the meat simulation culture medium, and fermented at 37°C and 150 rpm for 48 hours. Samples at three time points, 0, 24 and 48 hours, were taken for subsequent experimental determination.

[0129] 1. Determination of free fatty acids:

[0130] Fatty acids were determined according to the method in GB 5009.168-2016 National Food Safety Standard Determination of Fatty Acids in Foods. The reference conditions of the chromatographic column are as follows:

[0131] Chromatographic column: TR-FAME 70% cyanopropyl polysiloxane capillary column (100m×0.25mm×0.20μm);

[0132] Inlet temperature: 270°C, split ratio: 5:1, injection volume: 1 μL, detector temperature: 280°C, carrier gas: helium, programmed temperature rise mode: initial temperature 100°C for 13 min; 100-180°C, heating rate 20°C / min, hold for 6 min; 180-200°C, heating rate 1°C / min, hold for 20 min; 200-230°C, heating rate 10°C / min, hold for 2 min.

[0133] 2. Determination of volatile aldehydes from fat oxidation:

[0134] GC-MS conditions: interface temperature 210 °C, transfer line temperature 230 °C, voltage 1.2 KV, full scan mode, mass scan range 40-500 m / z, scan time 2 s, ion source temperature 250 °C, EI ion source, electron energy 70 eV.

[0135] Qualitative analysis: The results were qualitatively analyzed by computer automatic retrieval (NIST 08) and manually compared with the Xcalibur software system. The matching degree (SI) and reverse matching degree (RSI) were required to be greater than 800 and the probability was greater than 80%.

[0136] Quantitative analysis: The internal standard method was used for quantitative analysis. Based on the relationship between the concentration of the added internal standard, the chromatographic peak area, and the chromatographic peak area of ​​the unknown component, the concentration of each volatile component can be calculated according to the following formula. Cyclohexanone was selected as the internal standard and deionized water was selected as the internal standard solvent with a concentration of 0.475 μg / μL.

[0137]

[0138] Where M is the concentration of the unknown component (mg / kg), S1 is the chromatographic peak area of ​​the unknown component, S2 is the chromatographic peak area of ​​the internal standard, m1 is the mass of the internal standard compound (μg), and m2 is the sample weight (g).

[0139] 5. Fermented sausage experiment:

[0140] 1. Preparation and sampling of fermented sausages:

[0141] (1) Formula of fermented pork sausage: mince pork hind leg meat according to the fat-to-lean ratio of 4:1, add 25 g / kg salt, 10 g / kg white sugar, 0.5 g / kg ascorbic acid, 70 mg / kg sodium nitrate and 70 mg / kg sodium nitrite, and fermentation agent (inoculation amount is 1×10 7 CFU / g and 1×10 5 CFU / g).

[0142] (2) Process: Dice and mince the fat and lean meat, marinate at 4°C for 12-15h, and add the starter culture at 1×10 7 CFU / g and 1×10 5 CFU / g were inoculated into the sausages, mixed thoroughly, and then enema, vented, and fermented (temperature was 25°C, humidity was 70%-75%, and time was 3 days), and then dried and matured for 12 days at a temperature of 15-16°C and a humidity of 65-70%, for a total of 15 days. Process samples were taken from each group at 0, 3, and 15 days for the determination of subsequent indicators. The fermented sausages were divided into three groups: the control group (no starter was added), the inoculation group 1 (the inoculation amount of Staphylococcus cohnii CCTCC M 2024084 was 1×10 5 CFU / g), inoculation group 2 (Staphylococcus cohnii CCTCC M 2024084 inoculation amount was 1×10 7 CFU / g).

[0143] 2. Sensory evaluation and determination of physical, chemical and microbiological indicators:

[0144] (1) Sensory evaluation:

[0145] The evaluation and analysis were conducted based on the national standards GB / T 22210-2008 Meat and Meat Products Sensory Evaluation Specification, GB 2730-2015 Food Safety National Standard - Cured Meat Products and GB / T 23493-2009 Chinese Sausage with slight modifications. 10 well-trained students majoring in food science and engineering were selected to score the sensory quality of the sausages. Each sample was evaluated three times and the average value was taken as the final result. The specific sensory scoring table is as follows:

[0146] Table 6 Sausage sensory evaluation score table

[0147]

[0148] (2) Determination of physical, chemical and microbiological indicators:

[0149] 1) Determination of microbial indicators:

[0150] The method for determining the total colony count shall refer to "GB 4789.2-2022-National Food Safety Standard-Determination of the total colony count for food microbiological examination"; the method for determining the number of suspected lactic acid bacteria shall refer to "GB 4789.35-2016-National Food Safety Standard-Food Microbiological Examination-Lactic Acid Bacteria Examination"; the method for determining the number of suspected Staphylococci is to dilute the sample in a gradient manner and spread it on MSA medium, and then count the samples after incubation at 37°C for 48 hours to obtain the number of suspected Staphylococci; Enterobacteriaceae shall be detected in accordance with "GB4789.41-2016 National Food Safety Standard-Food Microbiological Examination-Enterobacteriaceae Examination".

[0151] 2) Determination of pH value:

[0152] The determination was carried out according to the method of GB 5009.237-2016 National Food Safety Standard - Food - Determination of pH Value. Three samples were taken at each time point and the average value was taken after the determination.

[0153] 3) Determination of moisture content:

[0154] Take 1g of meat sample from each sample and put it in a moisture test plate, and use HR83 moisture content tester to test its moisture content. Take three samples at each time point and take the average value after testing.

[0155] 4) Determination of peroxide value:

[0156] The peroxide value of oil oxidation was determined by the second method colorimetric method in the national standard "GB / T 5009.227-2016 National Food Safety Standard-Determination of Peroxide Value in Food". Three samples were taken at each time point and the average value was taken after the measurement.

[0157] 5) Determination of nitrite content:

[0158] The determination was carried out according to the method of GB 5009.33-2016 National Food Safety Standard - Determination of Nitrite and Nitrate in Food. Three samples were taken at each time point and the average value was taken after the determination.

[0159] 6) Determination of thiobarbituric acid (TBARS) value:

[0160] The determination was carried out according to the national standard "GB 5009.181-2016 National Food Safety Standard - Determination of Malondialdehyde in Food". Three samples were taken at each time point and the average value was taken after the determination.

[0161] 7) Determination of chromaticity value:

[0162] After peeling and cutting the sample, spread it on a flat plate and press it into a slice with a thickness of about 1 cm. Select 6 different parts and use the colorimeter CHROMA METER CR-400 for measurement. * Indicates the brightness of the sample, a * Indicates the redness and greenness of the sample, b * Indicates the yellow-blue degree of the sample. Three samples were taken at each time point and the average value was taken after measurement.

[0163] (3) Determination of lipid separation and decomposition products:

[0164] 1) Separation of lipids:

[0165] ① Extraction of lipids: Weigh 10g of minced meat sample, soak it in chloroform:methanol solution (mass ratio is 2:1) for one night, filter it through a G3 funnel, and dry the extract using a rotary evaporator. Calculate its content by weighing.

[0166] ② Separation of lipids: Determine with reference to the existing technology, use amino solid phase extraction cartridges to adsorb the extracted lipids, and separate phospholipids, neutral lipids, and free fatty acids from total lipids. Take 5 mL of chloroform solution to activate the column, dissolve 100 mg of the extracted lipids in 1 mL of chloroform solution and load into the column for elution. Use 3 mL of chloroform: isopropanol (mass ratio 2:1), 3 mL of 25% (w / w) acetic acid / ether and 3 mL of methanol to elute neutral lipids, free fatty acids, and phospholipids, respectively. Collect the eluate and blow dry with nitrogen, and quantify the content of neutral lipids, free fatty acids, and phospholipids in the sample by weighing. The content of neutral lipids and phospholipids is expressed as g / 100g.

[0167] 2) Determination of lipid decomposition products:

[0168] ① Determination of diglyceride:

[0169] Diacylglycerol ELISA kit was used for determination.

[0170] ②Determination of monoglyceride and free glycerol:

[0171] Quantitative determination was carried out according to the method of "GB / T 22328-2008 Determination of Monoglyceride and Free Glycerol Content in Animal and Vegetable Oils and Fats 1".

[0172] 3) Determination of free fatty acids:

[0173] Fatty acid determination was performed according to the method described in GB 5009.168-2016 National Food Safety Standard Determination of Fatty Acids in Food

[67] . The chromatographic column and determination conditions were referenced to the determination of fatty acids in “IV”. 4) Determination of volatile aldehydes from fat oxidation

[0174] (4) Determination of volatile aldehydes from fat oxidation:

[0175] The method is the same as the determination of volatile aldehydes from fat oxidation in "IV".

[0176] Related results and data:

[0177] 1. Strain identification results:

[0178] (1) Gram staining and cell morphology test results, such as Figure 1 As shown, the Gram staining result of Staphylococcus cohnii CCTCC M 2024084 is purple, and the cell morphology is spherical and aggregated.

[0179] (2) Colony morphology test results, such as Figure 2 As shown, it was observed that the colony morphology of Staphylococcus cohnii CCTCC M 2024084 was characterized by medium size, round, light yellow, raised, neat edges, smooth surface, opaque and shiny.

[0180] (3) 16S rRNA homology analysis results:

[0181] The PCR products were sequenced and the resulting sequences were compared in the NCBI BLAST database to find similar strains and construct a phylogenetic tree. Figure 3 In addition, the 16S rRNA sequencing results of Staphylococcus cohnii CCTCC M 2024084 have a homology of ≥99.8% with Staphylococcus cohnii Tr05I in the Gene Bank database. The 16S rRNA sequence of Staphylococcus cohnii CCTCC M 2024084 obtained by sequencing and splicing is:

[0182] GCGTGGCGGCGTGCTATACATGCAGTCGAGCGAACAGATAAGGAGCTTGCTCCTTT

[0183] GACGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTACCTATAAGACTGGAA

[0184] TAACTCCGGGAAACCGGGGCTAATGCCGGATAACATTTAGAACCGCATGGTTCTAA

[0185] AGTGAAAGATGGTTTTGCTATCACTTATAGATGGACCCGCGCCGTATTAGCTAGTTG

[0186] GTAAGGTAACGGCTTACCAAGGCAACGATACGTAGCCGACCTGAGAGGGTGATCGG

[0187] CCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTAGGGAATC

[0188] TTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTC

[0189] GGATCGTAAAACTCTGTTATTAGGGAAGAACAAATGTGTAAGTAACTATGCACGTC

[0190] TTGACGGTACCTAATCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTAAT

[0191] ACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTT

[0192] TCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGG

[0193] GAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATGTGTAGCGGTGAAATGCGC

[0194] AGAGATATGGAGGAACACCAGTGGCGAAGGCGACTTTCTGGTCTGTAACTGACGCT

[0195] GATGTGCGAAAGCGTGGGGATCAAACAGGATTAGATACCCTGGTAGTCCACGCCGT

[0196] AAACGATGAGTGCTAAGTGTTAGGGGGTTTCCGCCCCTTAGTGCTGCAGCTAACGC

[0197] ATTAAGCACTCCGCCTGGGGAGTACGACCGCAAGGTTGAAACTCAAAGGAATTGAC

[0198] GGGGACCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAAC

[0199] CTTACCAAATCTTGACATCCTTTGACAACTCTAGAGATAGAGCCTTCCCCTTCGGGG

[0200] GACAAAGTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTTGGGTT

[0201] AAGTCCCGCAACGAGCGCAACCCTTAAACTTAGTTGCCAGCATTAAGTTGGGCACT

[0202] CTAAGTTGACTGCCGGTGACAAACCGGAGGAAGGTGGGGATGACGTCAAATCATCA

[0203] TGCCCCTTATGATTTGGGCTACACACGTGCTACAATGGACAATACAAAGGGCAGCT

[0204] AAACCGCGAGGTCATGCAAATCCCATAAAGTTGTTCTCAGTTCGGATTGTAGTCTGC

[0205] AACTCGACTACATGAAGCTGGAATCGCTAGTAATCGTAGATCAGCATGCTACGGTG

[0206] AATACGTTCCCGGGTCTTGTACACACCGCCCGTCACACCACGAGAGTTTGTAACACCCGAAGCCGGTGGAGTAACCATTTATGGAGCTAGCCGTCGAAGTGATCAACG (SEQ ID NO. 1).

[0207] 2. Results of strain safety experiments:

[0208] (1) Hemolysis test results Figure 4 As shown, the hemolysis result of Staphylococcus cohnii CCTCC M 2024084 is γ hemolysis, that is, no hemolysis occurs, indicating that its hemolysis result is negative.

[0209] (2) Plasma coagulase test results Figure 5 As shown, this indicates that Staphylococcus cohnii CCTCC M 2024084 did not undergo plasma coagulation and did not produce plasma coagulase.

[0210] (3) The results of the thermostable nuclease gene test are as follows Figure 6 As shown, the staphylococcal thermostable nuclease gene (nuc) was amplified and identified by PCR. No 279 bp product band was amplified from Staphylococcus cohnii SCCTCC M 2024084, which was determined to be thermostable nuclease gene negative.

[0211] 3. Production adaptability test results:

[0212] (1) Acid resistance test results Figure 7As shown, according to the turbidity degree of the culture, it can be seen that Staphylococcus cohnii SCCTCCM2024084 has a strong acid resistance, which is recorded as "+++".

[0213] (2) Sodium chloride resistance test results are as follows Figure 8 As shown, according to the turbidity of the culture, it can be seen that Staphylococcus cohnii SCCTCCM2024084 has a strong salt tolerance, which is recorded as "+++".

[0214] (3) The results of low temperature resistance test are as follows Fig. 9 As shown, according to the turbidity degree of the culture, it can be known that Staphylococcus cohnii CCTCCM2024084 has a certain ability to resist low temperatures, which is recorded as "+".

[0215] (4) Sodium nitrite resistance test results are as follows Fig.10 As shown, according to the turbidity of the culture medium, it can be seen that Staphylococcus cohnii CCTCC M 2024084 has a strong resistance to nitrite, which is recorded as "+++".

[0216] 4. Results of the strain's fat hydrolysis and antioxidant tests:

[0217] (1) The results of lipase hydrolysis by strains are as follows Fig.11 As shown, it can be seen that the lipase hydrolysis ability of Staphylococcus cohnii CCTCC M 2024084 is very strong, which is recorded as "+++++".

[0218] (2) Antioxidant capacity and antioxidant enzyme test results: Superoxide dismutase (SOD) can rapidly catalyze the highly active superoxide anion O 2- And disproportionately into H2O2 with weaker activity, which can be further decomposed by catalase (CAT) and glutathione peroxidase (GPx). The specific results are shown in Table 7.

[0219] Table 7 Antioxidant results of Staphylococcus cohnii CCTCC M 2024084

[0220]

[0221] As can be seen from Table 7, the antioxidant capacity of Staphylococcus cohnii CCTCC M 2024084 was evaluated by measuring the DPPH radical scavenging rate, the superoxide anion radical scavenging rate and the total reducing power. As can be seen from Table 7, the intracellular DPPH radical scavenging rate of Staphylococcus cohnii CCTCC M 2024084 was 35.53%, the superoxide anion radical scavenging rate was 25.80% and the total reducing power was 81.63%; the bacterial liquid DPPH radical scavenging rate of Staphylococcus cohnii CCTCC M 2024084 was as high as 86.92%, the superoxide anion radical scavenging rate was as high as 73.29%, and the total reducing power was as high as 95.28%; these results showed that the antioxidant capacity of Staphylococcus cohnii CCTCC M 2024084 was equivalent to that of 5 mg / mL Vc. At the same time, it can be seen from Table 7 that the intracellular antioxidant enzyme activity of the strain is relatively high. Based on this, it is speculated that the high antioxidant activity of the bacterial solution may be related to its higher intracellular antioxidant enzyme activity and the possible existence of extracellular antioxidant active substances.

[0222] 5. Effects of strains in meat simulation medium on fat hydrolysis and oxidation:

[0223] Staphylococcus cohnii CCTCC M 2024084 was inoculated in meat simulation medium, and the fatty acids and volatile aldehydes produced were measured to reveal the influence of the strain on lipid hydrolysis and oxidation. The results are as follows Fig.12 and as shown in Table 8.

[0224] Table 8 Determination results of polyunsaturated fatty acids and volatile aldehydes in simulated meat culture medium inoculated with Staphylococcus cohnii CCTCC M 2024084

[0225]

[0226] Note: KB is the blank control without adding bacteria.

[0227] As shown in Table 8, four polyunsaturated fatty acids, C18:2n6t, C18:2n6c, C18:3n3 and C20:2, were detected in the fermentation samples, and their total content gradually accumulated with the extension of fermentation time, indicating that the oxidation of polyunsaturated fatty acids was properly inhibited during the fermentation process, which may be related to the high antioxidant enzyme activity of Staphylococcus cohnii CCTCC M 2024084. Due to the high activity of superoxide dismutase and the enhanced ability to scavenge oxygen free radicals, the unsaturated fatty acids in the matrix are slowly oxidized.

[0228] Among the volatile compounds produced by lipid oxidation, aldehydes are the most abundant, and the main aldehydes produced by lipid oxidation include normal aldehydes, trans-2-enal, 4-hydroxy-trans-2-enal and malondialdehyde, among which hexanal is considered to be the most representative indicator of lipid oxidation. Existing studies have shown that some volatile aldehyde compounds have high specificity for the oxidation of specific fatty acids. For example, hexanal and valeraldehyde are specific indicators of the oxidation of meat and meat products rich in n-6 polyunsaturated fatty acids, while for the oxidation of n-3 polyunsaturated fatty acids, propionaldehyde may be a better indicator. The content of these aldehydes has a strong positive correlation with TBARS and sensory scores, which also confirms the applicability of these compounds as lipid oxidation markers. Other aldehydes including 4-heptenal, 2-4-heptenal, 2-octenal, 2-nonenal or 4-hydroxy-trans-2-nonenal may also be markers of lipid oxidation, but saturated aldehydes (propionaldehyde, valeraldehyde and hexanal) are usually used because they are more stable than unsaturated aldehydes. Therefore, according to the types of aldehydes actually detected in the samples, hexanal, trans-2-enal (trans-2-hexenal, trans-2-heptenal, trans-2-octenal, trans-2-decenal, trans, trans-2,4-heptadienal, trans-2,4-decadienal, trans, trans-2,4-nonadienal), and total aldehydes were selected to evaluate the degree of lipid oxidation. Fig.12 From the results, the contents of hexanal, trans-2-alkenal and total aldehydes showed a trend of first increasing and then decreasing during the fermentation stage. At 0h, the contents of trans-2-alkenal and total aldehydes in the Staphylococcus cohnii CCTCC M 2024084 group were slightly lower than those in the blank group. At the end of 48h of fermentation, the contents of hexanal, trans-2-alkenal and total aldehydes in the Staphylococcus cohnii CCTCC M 2024084 group were significantly lower than those in the blank group (p < 0.05), which indicates that Staphylococcus cohnii CCTCC M 2024084 has a significant inhibitory effect on lipid oxidation.

[0229] 6. Fermented sausage application test results:

[0230] (1) The sensory evaluation results are shown in Table 9.

[0231] Table 9 Sensory evaluation results of fermented sausage

[0232]

[0233]

[0234] As shown in Table 9, the appearance, overall flavor, rancidity and overall acceptability scores of the blank control group were significantly lower than those of the inoculated group (p<0.05), and the 1×10 7 The appearance, overall flavor, and overall acceptability of the sausages in the inoculated group were the highest, with 1×10 5The highest rancidity score of the sausages in the CFU / g inoculated group was 7.55, which was significantly higher than that of the other groups (p<0.05). From the sensory evaluation results of the rancidity, the inoculated groups all showed a slight rancidity, while the uninoculated groups showed a clear rancidity, indicating that inoculation is beneficial to reducing the rancidity caused by excessive lipid oxidation. Fig.13 The sausage slice diagram shows that 1×10 5 CFU / g inoculated group and 1×10 7 The color of the inoculated group was more ruddy than that of the blank group. Therefore, the sensory evaluation results of the sausage inoculated with Staphylococcus cohnii CCTCC M 2024084 were relatively excellent, among which 1×10 7 The overall acceptability of the sensory evaluation of the CFU / g inoculated group was more prominent, and its total score was significantly higher than that of the other groups (p<0.05).

[0235] (2) The results of the physical, chemical and microbiological indexes of fermented sausages are shown in Table 10.

[0236] Table 10 Results of determination of physicochemical and microbiological indicators of fermented sausages

[0237]

[0238]

[0239] Note: Different lowercase (uppercase) letters within (between) groups indicate significant differences (p<0.05), while the same lowercase (uppercase) letters indicate insignificant differences (p>0.05).

[0240] Judging from the results of nitrite determination, since there are clear regulations on the residual nitrite in fermented meat products: the final residual nitrite in fermented meat products is required to be <30 mg / kg, it can be seen from Table 10 that all groups meet the requirements.

[0241] In addition, the peroxide value increased first and then decreased as the fermentation progressed. The upward trend from 0 to 3 days may be due to the fact that the production rate of lipid peroxides was greater than the decomposition rate at the beginning of the fermentation, and a lot of peroxides accumulated. The downward trend in the later period may be due to the fact that the production rate of peroxides was less than the decomposition rate. At 3 days, the peroxide value of the inoculated group was significantly lower than that of the blank group, which may be related to the antioxidant enzyme activity and free radical scavenging ability of the inoculated Staphylococcus cohnii CCTCC M 2024084. The TBARS value gradually increased as the fermentation progressed, but the TBARS content of the inoculated group was significantly lower than that of the blank group at 15 days, which may be due to the antioxidant activity in Staphylococcus cohnii CCTCC M 2024084, which played a good antioxidant role and inhibited lipid peroxidation. And as the fermentation progressed, the pH showed a trend of decreasing first and then increasing, and dropped to the lowest at the end of the fermentation, and the moisture content dropped from the initial 44.70% to 49.27% ​​to the final 11.85% to 14.21%. From the bacterial count results, it can be seen that the number of all bacteria gradually increased with the progress of fermentation. 7 The total number of colonies and suspected Staphylococci in the inoculated group were significantly higher than those in the 1×10 5 CFU / g inoculated group and blank group, blank group and 1×10 5 The number of Enterobacteriaceae in the inoculated group increased first and then decreased as the fermentation progressed. 7 The number of Enterobacteriaceae in the CFU / g inoculated group showed a gradual upward trend, and finally the number of Enterobacteriaceae in all samples was between 3.28lg CFU / g and 4.09lg CFU / g.

[0242] Table 11 Determination results of lipid composition and decomposition products of fermented sausage

[0243]

[0244]

[0245] Note: Different lowercase (uppercase) letters within (between) groups indicate significant differences (p<0.05), while the same lowercase (uppercase) letters indicate insignificant differences (p>0.05).

[0246] Because the neutral lipids in the sausage are hydrolyzed into diglycerides, monoglycerides and free fatty acids under the action of lipase. As shown in Table 11, during the fermentation process from 0 to 3 days, the content of neutral lipids increased, while the content decreased from 3 to 15 days. This change trend was affected by the continuous decrease in the moisture content in the sausage. At the same time, the phospholipids in the sausage were hydrolyzed into free fatty acids under the action of phospholipases. The phospholipid content showed a gradual downward trend with the increase of fermentation time. Combined with the change trend of free fatty acids, it can be seen that during the period from 0 to 3 days, inoculation of Staphylococcus cohnii CCTCC M 2024084 can significantly promote the release of free fatty acids (p < 0.05), and inoculation of 1×10 7 CFU / g of Staphylococcus cohnii CCTCC M 2024084 can better promote the release of free fatty acids, which shows that Staphylococcus cohnii CCTCC M 2024084 can significantly promote the hydrolysis of fat.

[0247] The content of diglyceride in all groups showed a trend of first decreasing and then increasing, indicating that diglyceride was easily hydrolyzed in the first 3 days of fermentation. The content of monoglyceride in each group gradually increased with the progress of fermentation and reached the highest level at 15 days, indicating that hydrolysis products continued to accumulate during the entire fermentation process. The content of free glycerol showed an increasing trend with the progress of fermentation, and at 15 days, 1×10 7 The free glycerol content of the inoculated group was the highest, at 4.14%, indicating that the inoculation of 1×10 7 The Staphylococcus cohnii CCTCC M 2024084 with a CFU / g value had the strongest effect on the degree of fat hydrolysis.

[0248] The total free fatty acid content of the blank group gradually increased with the fermentation progress, while the free fatty acid content of the inoculated group showed a trend of first increasing and then decreasing with the fermentation progress. 5 The free fatty acid content of the inoculated group was the highest, which was 11.00 g / 100 g. At 3d and 15d, the free fatty acid content of the inoculated group was 1×10 7 The free fatty acid content of the inoculated group was the highest, which was 26.84 g / 100 g and 24.84 g / 100 g, respectively. This indicates that compared with the uninoculated group, the inoculated group can promote fat hydrolysis and accumulate more fatty acids. 7 The degree of fat hydrolysis in sausages with higher CFU / g was higher, and the amount of fatty acid accumulation was greater.

[0249] Table 12 Composition and content of free fatty acids in fermented sausages

[0250]

[0251]

[0252]

[0253]

[0254] Note: Different lowercase (uppercase) letters within (between) groups indicate significant differences (p<0.05), while the same lowercase (uppercase) letters indicate insignificant differences (p>0.05).

[0255] From the composition and content changes of free fatty acids in different groups in Table 12, it can be seen that the results of saturated fatty acid determination show that C14:0, C16:0, and C18:0 are the fatty acid types with the highest content in saturated fatty acids. The saturated fatty acid content in the blank group gradually decreased with the progress of fermentation. 5 CFU / g and 1×10 7 The saturated fatty acid content of the CFU / g inoculated group showed a trend of first increasing and then decreasing, and reached the highest level at 3 days. At the end of fermentation, 1×10 7 The saturated fatty acid content of the inoculated group was significantly higher than that of the other groups (p<0.05). 7 CFU / g Staphylococcus cohnii CCTCC M 2024084 can significantly promote the release and accumulation of saturated fatty acids.

[0256] in addition, Fig.14 and Fig.15 In the results shown, it can be seen from the determination results of monounsaturated fatty acids that C16:1 and C18:1n9c are the fatty acid types with the highest content in monounsaturated fatty acids. The content of monounsaturated fatty acids in the blank group gradually decreases with the progress of fermentation. 5 CFU / g and 1×10 7 The content of monounsaturated fatty acids in the CFU / g inoculated group showed a trend of first increasing and then decreasing, and reached the highest level at 3 days and reached 1×10 7 The content of monounsaturated fatty acids in the inoculated group was significantly higher than that in the other groups (p<0.05). 5 The content of monounsaturated fatty acids in the inoculated group was significantly higher than that in the blank group (p<0.05). 5 CFU / g and 1×10 7 CFU / g Staphylococcus cohnii CCTCC M2024084 can significantly promote the release and accumulation of monounsaturated fatty acids, and 1×10 7 The accumulation of CFU / g is higher than 1×10 5 CFU / g.

[0257] The results of polyunsaturated fatty acids show that C18:2n6c is the main type of polyunsaturated fatty acids. As the fermentation progresses, the content of polyunsaturated fatty acids in the blank group gradually increases, while 1×10 5 CFU / g and 1×10 7 The polyunsaturated fatty acid content of the inoculated group increased first and then decreased, reaching the highest level on the 3rd day. 7 The content of polyunsaturated fatty acids in the CFU / g inoculated group was 5.5594 g / 100 g, which was significantly higher than that in the other groups (p<0.05). 7 The polyunsaturated fatty acid content of the CFU / g inoculated group was also the highest, at 4.5600 g / 100 g, significantly higher than that of the other groups (p<0.05). 7 CFU / g Staphylococcus cohnii CCTCC M 2024084 can significantly promote the release and accumulation of polyunsaturated fatty acids.

[0258] Table 13 Results of volatile aldehydes produced by fat oxidation in fermented sausages

[0259]

[0260]

[0261] Note: Different lowercase (uppercase) letters within (between) groups indicate significant differences (p<0.05), while the same lowercase (uppercase) letters indicate insignificant differences (p>0.05).

[0262] As shown in Table 13, nonanal and hexanal are the main aldehydes produced. At the same time, the content of nonanal shows that as the fermentation progresses, the content of nonanal gradually increases and reaches the highest at the end of the fermentation. 7 The content of nonanal in the inoculated group was significantly lower than that in the other groups (p<0.05), which was 636.77 mg / kg. From the results of hexanal, it can be seen that the content of hexanal also gradually increased with the progress of fermentation and reached the maximum value at 15 days, among which 1×10 7 The hexanal content of the inoculated group was significantly lower than that of the other groups (p<0.05), which was 94.47 mg / kg. From the results of total aldehyde determination, the total aldehyde content showed a trend of first increasing and then decreasing with the progress of fermentation. At 0h, the total aldehyde content of the blank group was significantly higher than that of the inoculated group (p<0.05). At 15d, the total aldehyde content of 1×10 7 The total aldehyde content of the inoculated group was significantly lower than that of the blank group and 1×10 5 CFU / g inoculated group (p<0.05). Combined with the TBARS value results, at 15 days, 1×10 7The TBARS value of the CFU / g inoculated group was 0.23 mg / kg, which was significantly lower than that of the other groups, indicating that 1×10 7 CFU / g inoculated group had better antioxidant effect. 5 The total content of aldehydes in the inoculated group was higher than that in the blank group, which might be due to the 1×10 5 CFU / g inoculum lacks competitive advantage and fails to show antioxidant activity, which also shows that in the production and processing of fermented meat products, the inoculum amount will affect the oxidative quality of sausages. 7 The antioxidant effect of CFU / g inoculum is better than that of 1×10 5 CFU / g and uninoculated.

[0263] In summary, the Staphylococcus cohnii that promotes fat hydrolysis and has high antioxidant activity provided in the embodiments of the present application can effectively hydrolyze fat in meat products into diglycerides, monoglycerides and free fatty acids. At the same time, the Staphylococcus cohnii has an antioxidant capacity equivalent to 5 mg / mL of Vc, and can therefore promote the slow oxidation of unsaturated fatty acids in meat products.

[0264] Various embodiments of the present application may be presented in the form of a range; it should be understood that the description in the form of a range is only for convenience and brevity, and should not be understood as a rigid limitation on the scope of the present application; therefore, the range description should be considered to have specifically disclosed all possible sub-ranges and single numerical values ​​within the range. For example, the range description from 1 to 6 should be considered to have specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as single numbers within the range, such as 1, 2, 3, 4, 5 and 6, which apply regardless of the range. In addition, whenever a numerical range is indicated herein, it is meant to include any cited number (fractional or integer) within the indicated range.

[0265] In the present application, in the absence of any contrary description, the directional words used, such as "upper" and "lower", are specifically the directions of the drawings in the accompanying drawings. In addition, in the description of the present specification, the terms "including", "comprising", etc. refer to "including but not limited to". In this article, relational terms such as "first" and "second" are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply that there is any such actual relationship or order between these entities or operations. In this article, "and / or" describes the association relationship of the associated objects, indicating that there may be three relationships, for example, A and / or B, which can represent: A exists alone, A and B exist at the same time, and B exists alone. Wherein A, B can be singular or plural. In this article, "at least one" refers to one or more, and "plural" refers to two or more. "At least one", "at least one of the following" or similar expressions refer to any combination of these items, including any combination of singular or plural items. For example, "at least one of a, b, or c", or "at least one of a, b and c", can both mean: a, b, c, ab (i.e. a and b), ac, bc or abc, where a, b, c can be single or plural, respectively.

[0266] The above description is only a specific implementation of the present application, so that those skilled in the art can understand or implement the present application. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to the embodiments shown herein, but will conform to the widest range consistent with the principles and novel features applied for herein.

Claims

1. A Staphylococcus cohnii S129 that promotes fat hydrolysis and has high antioxidant activity, characterized in that: The preservation number of the Staphylococcus cohnii S129 is CCTCCNO.M 2024084; the preservation unit of the Staphylococcus cohnii S129 is: China Center for Type Culture Collection, the preservation name of the Staphylococcus cohnii S129 is Staphylococcus cohnii S129, and the preservation time of the Staphylococcus cohnii S129 is January 11, 2024.

2. The Staphylococcus cohnii S129 according to claim 1, characterized in that The 16S rRNA sequence of Staphylococcus cohnii S129 is shown in SEQ ID NO.

1.

3. The Staphylococcus cohnii S129 according to claim 1, characterized in that The homology between the Staphylococcus cohnii S129 and Staphylococcus cohnii Tr05I is ≥99.8%.

4. The Staphylococcus cohnii S129 according to claim 1, characterized in that The total intracellular reducing power of the Staphylococcus cohnii S129 is ≥80%, and the total bacterial liquid reducing power of the Staphylococcus cohnii S129 is ≥95%.

5. An application of Staphylococcus cohnii S129 that promotes fat hydrolysis and has high antioxidant activity, characterized in that: The application comprises using the Staphylococcus cohnii S129 as claimed in any one of claims 1 to 4 in the fermentation of meat products; Wherein, the meat product is sausage; The amount of Staphylococcus cohnii S129 added is ≥ 1×10 7 CFU / g.

6. The use according to claim 5, characterized in that: The fatty acid content of the meat product after fermentation by the Staphylococcus cohnii S129 is 5 times or more than the fatty acid content of the meat product after fermentation itself.

7. The use according to claim 5, characterized in that: The total aldehyde content of the meat product after fermentation itself is 1.5 times or more of the total aldehyde content of the fermented meat product after fermentation by the Staphylococcus cohnii S129.

8. The use according to claim 5, characterized in that: The residual nitrite content of the meat product after fermentation by the Staphylococcus cohnii S129 is ≤5mg / kg, and the number of enterobacteriaceae in the meat product after fermentation by the Staphylococcus cohnii S129 is 3.28lg CFU / g to 4.09lg CFU / g.

Images