Use of tetrahedral framework nucleic acid in the preparation of drugs for promoting diabetic wound healing

Abstract

The present invention provides the use of tetrahedral framework nucleic acids in the preparation of drugs for regulating cell energy metabolism and promoting diabetic wound healing, belonging to the field of medical technology. The present invention has found that tetrahedral framework nucleic acids (tFNAs) are transported to the endoplasmic reticulum and mitochondria through caveolin-mediated endocytosis, which can improve endoplasmic reticulum stress and mitochondrial function under high sugar environment, regulate cell energy metabolism and promote ATP generation. The energy metabolism regulation of tFNAs promotes cell proliferation, migration and differentiation, and ultimately promotes the healing of diabetic chronic wounds. Using tFNAs as active ingredients to regulate energy metabolism will become a potential therapeutic strategy for treating metabolic diseases such as diabetes.

Description

Technical Field

[0001] The invention belongs to the field of medical technology, and in particular relates to the use of tetrahedral framework nucleic acid in preparing a medicine for promoting diabetic wound healing. Background Art

[0002] There are two key energy production pathways in cells: glycolysis and oxidative phosphorylation. Environmental changes prompt cells to adapt by alternating between these pathways. As the main site of energy metabolism, mitochondrial dynamic homeostasis controls the ultrastructure and function of mitochondria, which is characterized by constant fission, fusion and transport. This dynamic balance is essential for adaptation to metabolic perturbations. The endoplasmic reticulum and mitochondria are interconnected (MAM) to form an inner membrane network. Pathological stress, including infection, continuous high glucose stimulation, oxidative stress and disruption of calcium homeostasis, leads to an imbalance between protein folding demand and endoplasmic reticulum protein folding capacity, ultimately leading to endoplasmic reticulum stress (ERS). ERS increases mitochondrial Ca through MAM. 2+ levels and induce mitochondrial dysfunction, which together disrupt the cellular energy metabolism process.

[0003] Current studies have confirmed that systemic diseases such as diabetes, hypertension, gout, and cardiovascular disease all have a certain degree of metabolic abnormalities. Among them, diabetes is a major global concern, with 536 million people suffering from the disease. Chronic non-healing wounds are one of the main complications of diabetes, such as diabetic foot ulcers, which often lead to amputation and increase the socioeconomic burden. Current treatments for diabetic wound healing mainly focus on delivering cells or growth factors to promote tissue healing or performing surgical debridement to eliminate infection and stimulate regeneration. However, these methods do not address the cell dysfunction induced by diabetic metabolic abnormalities. In addition, the abnormal and slow proliferation of local angiogenic cells is also an important factor in the challenge of wound healing.

[0004] The rapid development of DNA nanotechnology has led to the development of various DNA nanostructures for applications in biosensing and drug delivery. Among these structures, tetrahedral framework nucleic acids (tFNAs) have attracted considerable interest due to their simple design, strong stability, structural rigidity, and biocompatibility. tFNAs exhibit excellent cell permeability, allowing rapid cellular uptake, but their delivery pathway in organelles after intracellular administration has not been elucidated. In addition, there is a lack of detailed studies on the effects of tFNAs on mitochondrial function and energy metabolism. Whether tFNAs can improve cellular energy metabolism under high glucose and thus promote the healing of chronic wounds in diabetes remains to be explored. Summary of the invention

[0005] The purpose of the present invention is to provide the use of tetrahedral framework nucleic acid in preparing medicine for promoting diabetic wound healing.

[0006] The present invention provides the use of tetrahedral framework nucleic acid in preparing medicine for promoting diabetic wound healing.

[0007] Furthermore, the tetrahedral framework nucleic acid is a tetrahedral framework nucleic acid formed by base complementary pairing of DNA single strands as described in SEQ ID NOs. 1 to 4.

[0008] Furthermore, the molar ratio of the four DNA single strands as described in SEQ ID NOs. 1 to 4 is 1:1:1:1.

[0009] Furthermore, the method for preparing the tetrahedral framework nucleic acid comprises the following steps: maintaining the four DNA single strands at 85-105° C. for 5-15 min, and then maintaining them at 2-8° C. for 20-30 min.

[0010] Furthermore, the method for preparing the tetrahedral framework nucleic acid comprises the following steps: maintaining the four DNA single strands at 95° C. for 10 minutes, and then maintaining them at 4° C. for 20 minutes.

[0011] Furthermore, the drug is a drug for restoring mitochondrial function and / or regulating mitochondrial energy metabolism.

[0012] Further, the drug is a drug that eliminates oxidative stress in mitochondria and cells;

[0013] Preferably, the drug is a drug that scavenges oxidative free radicals induced by high sugar.

[0014] Furthermore, the drug is a drug that promotes cell proliferation, migration, and differentiation;

[0015] And / or, the drug is a drug that promotes angiogenesis.

[0016] Furthermore, the drug is a preparation prepared with tetrahedral framework nucleic acid as an active ingredient and pharmaceutically acceptable excipients.

[0017] Furthermore, the preparation is an external preparation.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention found that tetrahedral framework nucleic acids (tFNAs) are transported to the endoplasmic reticulum and mitochondria through caveolin-mediated endocytosis, which can improve endoplasmic reticulum stress and mitochondrial function under high-sugar environment, regulate cellular energy metabolism and promote ATP production. The energy metabolism regulation of tFNAs promotes cell proliferation, migration and differentiation, and ultimately promotes the healing of chronic wounds in diabetes. Using tFNAs as active ingredients to regulate energy metabolism will become a potential therapeutic strategy for the treatment of metabolic diseases such as diabetes.

[0020] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0021] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The figures are the characterization results of tetrahedral framework nucleic acids (tFNAs): A is the high performance capillary electrophoresis (HPCE) result of tFNAs; B is the polyacrylamide gel electrophoresis (PAGE) result; C is the particle size and zeta potential results of tFNAs; D is the UV scanning analysis spectrum; E is the transmission electron microscope (TEM) image; and F is the atomic force microscope (AFM) image.

[0023] Figure 2 Results of tFNAs intracellular entry and intracellular organelle delivery. A is a fluorescence staining image of tFNAs co-localized with lysosomes; B is a fluorescence staining image of tFNAs co-localized with mitochondria; C is a fluorescence staining image of tFNAs co-localized with endoplasmic reticulum; D is the flow cytometry analysis result of tFNAs intracellular entry after treatment with various intracellular entry inhibitors; E is a fluorescence co-localization image of tFNAs-Cy5 with endoplasmic reticulum, lysosome and mitochondria after inhibiting clathrin- and caveolin-mediated endocytosis, respectively.

[0024] Figure 3 The results of tFNAs maintaining mitochondrial dynamic balance and stimulating mitochondrial energy metabolism: A is a diagram of the mechanism of tFNAs in mitochondrial dynamic balance and energy metabolism; B is the result of co-localization of mitochondria and endoplasmic reticulum; C is the result of mitochondrial tracking staining; D is the immunofluorescence image of dynamin-related protein 1 (Drp 1) and optic atrophy during fusion process 1 (OPA 1); E is the fluorescence quantitative analysis of Drp 1 in each group; F is the fluorescence quantitative analysis of OPA 1 in each group; G is the result of WB detection of Drp 1 expression level in each group; H is the result of oxygen consumption rate (OCR) in cell metabolism; I is the result of extracellular acidification rate (ECAR); J is the level of adenosine triphosphate (ATP); K is the ECAR curve in cell glycolysis; L is the basal glycolysis level; M is the glycolysis reserve level; N is the cell OCR result; O is the result of respiratory level; in the figure, *, ψ, # respectively indicate that the group is compared with Con, HG, and HG+ssDNA, p<0.05.

[0025] Figure 4Results of tFNAs eliminating cellular and mitochondrial oxidative stress: A is the fluorescence image of mitochondrial membrane potential; B is the fluorescence image of mitochondrial oxidative free radicals (mtROS); C is the quantitative analysis of the fluorescence image of mitochondrial membrane potential; D is the flow cytometric detection of mitochondrial membrane potential; E is the quantitative analysis of the flow cytometric detection of mitochondrial membrane potential; F is the quantitative analysis of the fluorescence image of mitochondrial oxidative free radicals (mtROS); G is the qRT-PCR detection result of thioredoxin interacting protein (TXNIP) and superoxide dismutase 2 (SOD 2); H is the fluorescence image of intracellular oxidative free radicals; I is the quantitative analysis result of the fluorescence image of intracellular oxidative free radicals; J is the flow cytometric analysis result of intracellular oxidative free radicals; K is the qRT-PCR detection result of catalase (CAT); In the figure, *, ψ, # respectively indicate that the group is compared with Con, HG, and HG+ssDNA, p<0.05.

[0026] Figure 5 Figure 2 is the result of tFNAs promoting cell proliferation, migration and differentiation: A is the flow cytometry detection diagram of the cell cycle of each group of cells; Figure B is the role model diagram of keratinocyte migration and differentiation in the healing of diabetic chronic wounds; C is the expression result of keratin differentiation-related genes analyzed by qRT-PCR; D is the image of keratinocyte scratch experiment healing over time; E is the analysis result of scratch area over time in keratinocyte scratch experiment; F is the crystal violet staining image of HUVEC cells after transwell migration and the quantitative analysis result of migrating cells; G is the typical image of HUVEC cells forming tubes on matrix gel and the quantitative analysis result.

[0027] Figure 6 The results of tFNAs promoting chronic diabetic wound healing: A is a representative picture of wound healing in rats in each group; B is a line graph of weight changes in rats in each group; C is the result of glycated serum protein in rats in each group; D is the random blood glucose level in rats in each group; E is the quantitative detection result of SOD in the new skin tissue of each group; F is a line graph of the percentage of wound area in rats in each group; G is the quantitative detection result of glutathione peroxidase (GSH-PX) in the new skin tissue of each group; H is the HE staining result of the local wound of each group on the 16th day after trauma; I is the Masson staining result of the local wound of each group on the 16th day after trauma; J is a quantitative analysis of the width of granulation tissue, skin scar thickness and collagen deposition in the sections of each group; K is a fluorescent staining picture of Drp1 in the local wound sections of each group on the 16th day after trauma; L is a fluorescent staining picture of ATF4 in the local wound sections of each group on the 16th day after trauma. DETAILED DESCRIPTION

[0028] The raw materials and equipment used in the specific embodiments of the present invention are all known products and are obtained by purchasing commercially available products.

[0029] Example 1. Synthesis of tetrahedral framework nucleic acids (tFNAs)

[0030] 1. Synthesis method

[0031] The four DNA single strands (S1, S2, S3, S4) were dissolved in TM Buffer (10mM Tris-HCl, 50mM MgCl2, pH=8.0) to a final concentration of 1000nM. After being fully mixed, they were rapidly heated to 95°C and maintained for 10 minutes, and then rapidly cooled to 4°C and maintained for more than 20 minutes to obtain tetrahedral framework nucleic acids tFNAs.

[0032] The sequences of the four DNA single strands (5′→3′) are as follows:

[0033] S1:

[0034] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGA ACATTCCTAAGTCTGAA(SEQID NO.1)

[0035] S2:

[0036] ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTC AGACTTAGGAATGTTCG(SEQID NO.2)

[0037] S3:

[0038] ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGG GAAGAGCATGCCCATCC(SEQID NO.3)

[0039] S4:

[0040] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGA TGGGCATGCTCTTCCCG(SEQID NO.4)

[0041] 2. Identification

[0042] Polyacrylamide gel electrophoresis (PAGE), high-performance capillary electrophoresis (HPCE), transmission electron microscopy (TEM), atomic force microscopy (AFM), and ultraviolet spectroscopy were used to verify whether tFNAs were successfully synthesized and the size and shape of tFNAs. Dynamic light scattering DLS (Nano ZS, Malvern, England) was used to measure the particle size and zeta potential of tFNAs.

[0043] Figure 1 A and 1B are the results of high performance capillary electrophoresis (HPCE) and polyacrylamide gel electrophoresis (PAGE), which verify the successful synthesis of tFNAs. The results show that the molecular weight of tFNAs is about 200 bp and the yield is very high.

[0044] Figure 1 C is the particle size and zeta potential characterization of tFNAs detected by dynamic light scattering (DLS). The results show that tFNAs appear as nanoparticles with an average size of about 13.15 nm and a zeta potential of -8.66 mV.

[0045] Figure 1 D, 1E and 1F are the UV scanning analysis spectra, transmission electron microscopy (TEM) and atomic force microscopy (AFM) images, respectively, and a single peak representing tFNAs was observed at 258 nm. Under TEM and AFM, tFNAs exhibited a unique tetrahedral morphology.

[0046] The beneficial effects of the present invention are demonstrated below through specific test examples.

[0047] Experimental Example 1: Cytosolic and intracellular delivery of tFNAs of the present invention

[0048] 1. Experimental methods

[0049] The Cy5 fluorescent group was connected to the S1 DNA single strand, and then tFNAs (tFNAs-Cy5) connected to the Cy5 fluorescent group were prepared according to the method described in Example 1 to achieve fluorescence tracking of tFNAs. After 6, 12, 24 and 48 hours of co-culture of human immortalized keratinocytes (HaCaT) growing in the logarithmic phase with tFNAs-Cy5 (the concentration of tFNAs-Cy5 was 250nM), the cells were stained with 75nM Lysotracker Green, 1μM E-Tracker Green and 150nM Mitotracker Green fluorescent dyes. The cells were photographed using a confocal laser scanning microscope. The excitation wavelengths of Lysotracker Green and ER-TrackerGreen were 504nm, Mitotracker Green was 490nm, and tFNAs-Cy5 was 647nm. ImageJ software (NIH, Bethesda, MD, USA) was used to quantify and measure the corresponding fluorescence co-localization intensity.

[0050] HaCaT cells growing in logarithmic phase were incubated with 8 cytosolic inhibitors (Dynasore, Nocodazole, Methyl-β-cyclodextrin, Nystatin, Chlorpromazine Hydrochloride, Pitstop2, Amiloride Hydrochloride, LY294002) for 1 hour, and then fresh medium containing tFNAs-Cy5 (250 nM) was added for 12 or 24 hours. Fluorescence colocalization intensity was measured by flow cytometry and CLSM.

[0051] 2. Experimental results

[0052] Figure 2 A. Figure 2 B and Figure 2 C shows the co-localization fluorescence staining images of tFNAs with cell lysosomes, mitochondria and endoplasmic reticulum, respectively. The results show that the co-localization of tFNAs with lysosomes gradually weakened with time within 24 hours, while the co-localization with endoplasmic reticulum was most obvious between 12 and 24 hours and then decreased. At the same time, the co-localization with mitochondria increased over time and could last up to 48 hours.

[0053] Figure 2 D is the flow cytometry analysis of tFNAs endocytosis after treatment with various endocytosis inhibitors. The results show that tFNAs endocytosis is regulated by clathrin and caveolin.

[0054] Figure 2 E is the fluorescence colocalization image of tFNAs-Cy5 with the endoplasmic reticulum, lysosomes, and mitochondria after inhibiting clathrin- and caveolin-mediated endocytosis, respectively. The results showed that inhibition of caveolin-mediated endocytosis caused tFNAs to colocalize mainly with lysosomes, and the colocalization signal of tFNAs with mitochondria was significantly weakened at 24h. However, after inhibiting clathrin-mediated endocytosis, the colocalization of tFNAs with lysosomes was greatly reduced. In contrast, tFNAs were highly concentrated around the endoplasmic reticulum at 12h and mostly colocalized with mitochondria at 24h.

[0055] In summary, during the cytosolic process of tFNAs, the caveolin-mediated endocytosis pathway is the main pathway for their lysosomal escape, and tFNAs are more delivered to the endoplasmic reticulum and mitochondria. Lysosomes and clathrin-coated vesicles transfer tFNAs to lysosomes. The affinity of tFNAs for mitochondrial outer membrane proteins and the hydrophilicity of tFNAs promote the dispersion of tFNAs in the cytoplasm and potential mitochondrial aggregation effects. The complex pathway of tFNAs endocytosis is revealed, which may be of great significance for enhancing drug delivery and improving intracellular targeting methods, thereby fully utilizing the biomedical potential of tFNAs.

[0056] Experimental Example 2: tFNAs of the present invention regulate mitochondrial energy metabolism

[0057] 1. Experimental methods

[0058] The tFNAs used in this test example were prepared according to the method described in Example 1.

[0059] (1) Mitochondrial-endoplasmic reticulum colocalization analysis

[0060] HaCaT cells were plated at 1 × 10 4 The cells were inoculated into confocal dishes at a density of 100 cells / mL. Each group was treated with 1.5 mL of normal culture medium (RPMI-1640 culture medium containing 10% fetal bovine serum and 1% double antibody, normal group, Con), 1.5 mL of high glucose culture medium (33 mM anhydrous glucose, HG, was added to the above normal culture medium), 1.5 mL of high glucose culture medium with 250 nM ssDNA (HG+ssDNA) (ssDNA is S1 single-stranded DNA), and 1.5 mL of high glucose culture medium with 250 nM tFNAs (HG+tFNAs). After 72 h of treatment, ER-tracker Red (1 μM) and Mitotracker Green (150 nM) were used to stain mitochondria and ER membranes. Fluorescence colocalization intensity was measured by CLSM.

[0061] (2) Mitochondrial morphology observation

[0062] HaCaT cells were plated at 1 × 10 4 The cells were inoculated into confocal dishes at a density of 100 cells / mL. Each group was treated with 1.5 mL of normal culture medium (RPMI-1640 culture medium containing 10% fetal bovine serum and 1% double antibody, normal group, Con), 1.5 mL of high glucose culture medium (33 mM anhydrous glucose, HG, was added to the above normal culture medium), 1.5 mL of high glucose culture medium with 250 nM ssDNA (HG+ssDNA) (ssDNA is S1 single-stranded DNA), and 1.5 mL of high glucose culture medium with 250 nM tFNAs (HG+tFNAs). After 72 h of treatment, the cells were incubated at 37 ° C for 30 min in pre-warmed serum-free RPMI-1640 containing 100 nM Mitotracker Red. After gently rinsing and fixing with 4% PFA, the cells were observed with CLSM, and the mitochondrial morphology and network were quantitatively evaluated using the tool set MiNA (mitochondrial network analysis) and MitoAnalyzer plug-in on ImageJ.

[0063] (3) Immunofluorescence staining

[0064] HaCaT cells were plated at 1 × 10 4Cells were seeded into confocal dishes at a density of 100 cells per well and allowed to adhere. Each group was treated with 1.5 mL of normal culture medium (RPMI-1640 culture medium containing 10% fetal bovine serum and 1% double antibody, normal group, Con), 1.5 mL of high glucose culture medium (33 mM anhydrous glucose, HG, was added to the above normal culture medium), 1.5 mL of high glucose culture medium with 250 nM ssDNA (HG+ssDNA) (ssDNA is S1 single-stranded DNA), and 1.5 mL of high glucose culture medium with 250 nM tFNAs (HG+tFNAs) for 72 h, and then fixed with 4% PFA. Cells were treated with 0.5% Triton-100 for 10 minutes and treated with 5% goat serum (Solarbio, Beijing, China) at 37°C for 30 minutes. Samples were incubated with primary antibodies against ATF 4, Drp 1, and OPA 1 (HUABIO, China) at 4°C overnight, and then incubated with secondary antibodies (Abcam) at room temperature for 1 hour. After rinsing with PBS, the nuclei were stained with DAPI for 10 min and the cytoskeleton was stained with phalloidin for 30 min. Subsequently, the cells were observed with CLSM and quantified with ImageJ software.

[0065] (4) Energy metabolism analysis

[0066] ATP generation rate, oxygen consumption rate (OCR), and extracellular acidification rate (ECAR) were measured using a Seahorse XFe24 analyzer to measure ATP rate, cellular Mito stress, and glycolysis rate in real time. The instructions provided by the manufacturer were strictly followed.

[0067] HaCaT cells (1×10 4Each group was treated with 0.5 mL of normal culture medium (RPMI-1640 medium containing 10% fetal bovine serum and 1% double antibody, normal group, Con), 0.5 mL of high glucose medium (33 mM anhydrous glucose, HG, was added to the above normal culture medium), 0.5 mL of high glucose medium with 250 nM ssDNA (HG+ssDNA) (ssDNA is S1 single-stranded DNA), and 0.5 mL of high glucose medium with 250 nM tFNAs (HG+tFNAs) for 72 h, and the cells were washed with hippocampus buffer and replaced with Agilent hippocampus XF DMEM medium supplemented with 1 mM sodium pyruvate, 2 mM glutamine and 1 mM d-glucose. The cells were cultured in a 37°C incubator for 1 hour, and 1.5 μM oligomycin and 0.5 μM rotenone / antimycin A were added to measure the ATP generation rate, oxygen consumption rate (OCR), and extracellular acidification rate (ECAR) in real time using a Seahorse XFe24 analyzer. The ECAR curve, basal glycolysis, and glycolytic reserve levels in cell glycolysis were determined by sequentially adding 0.5 μM rotenone / antimycin A and 50 mM 2-deoxyglucose (glycolysis inhibitor). Cellular OCR and respiration levels were measured by sequentially adding 1.5 μM oligomycin, 1.0 μM trifluoromethoxyphenylhydrazone carbonyl cyanide (FCCP), and 0.5 μM rotenone / antimycin A. Real-time ATP generation rate, OCR, and ECAR were normalized according to the number of cells. Data analysis was performed using Seahorse Wave software.

[0068] 2. Experimental results

[0069] Figure 3 The schematic diagram of A shows that the hyperglycemic environment leads to aggravated ER stress and increased MAMs, which promotes mitochondrial fragmentation and ultimately destroys mitochondrial energy metabolism, while tFNAs simultaneously increase OCR and ECAR, leading to an increase in the ATP production rate and a decrease in ROS generation, thereby restoring normal cellular physiological functions.

[0070] Figure 3 B shows the colocalization of mitochondria and endoplasmic reticulum using fluorescent markers. Compared with the normal group, the number of colocalization signals increased under hyperglycemia; the colocalization signals in the ssDNA treatment group decreased, and the colocalization signals were the least after tFNAs treatment. The results showed that after tFNAs treatment, mitochondria and endoplasmic reticulum gradually separated, and this effect of reducing the contact between mitochondrial and endoplasmic reticulum membranes was better than ssDNA.

[0071] Figure 3C is the detection of ultrastructure by mitochondrial tracking staining. The average aspect ratio, shape factor, sphericity and surface area of ​​mitochondria reflect their morphology, while the average branching and branch connection of each mitochondria reflect the complexity of the mitochondrial network. The results showed that high glucose leads to increased mitochondrial fragmentation, shorter, rounder, more fragmented mitochondrial morphology and decreased network continuity. In contrast, after tFNAs treatment, mitochondria improved to normal rod-shaped mitochondria, more slender and formed a complex network system, and these changes were better than those of the ssDNA group.

[0072] Figure 3 D-3G is an immunofluorescence image, fluorescence quantitative analysis and Western blot analysis, showing the expression of mitochondrial fission and fusion-related proteins. The results confirmed that tFNAs can downregulate Dynamin-related protein 1 (Drp 1) involved in the fission process, and upregulate Optic atrophy 1 (OPA 1) involved in the fusion process, indicating that tFNAs eliminate hyperglycemia-induced excessive mitochondrial fragmentation and promote mitochondrial fusion.

[0073] Figure 3 H, 3I and 3J used oligomycin and a mixture of rotenone / antimycin A to detect the oxygen consumption rate (OCR), extracellular acidification rate (ECAR) and adenosine triphosphate (ATP) levels in cell metabolism, respectively. The results showed that after tFNAs treatment, the cell OCR and ECAR increased, and glycolysis and mitochondrial ATP production were upregulated.

[0074] Figure 3 K, 3L and 3M are the ECAR curve, basal glycolysis and glycolytic reserve levels in cell glycolysis measured using a mixture of rotenone, antimycin A and 2-deoxy-d-glucose, respectively. The results showed that both basal glycolysis and glycolytic reserve levels were upregulated after tFNAs treatment.

[0075] Figure 3 N and 3O were oligomycin, the original carrier carbonyl cyanide-trifluoromethoxyphenylhydrazine (FCCP) and a mixture of rotenone / antimycin A to measure the cell OCR and respiration levels. The results showed that the aerobic respiration level of cells was upregulated after tFNAs treatment. The above results indicate that tFNAs can efficiently restore mitochondrial respiration and optimize energy metabolism.

[0076] Experimental Example 3: tFNAs of the present invention eliminate mitochondrial and cellular oxidative stress

[0077] 1. Experimental methods

[0078] The tFNAs used in this test example were prepared according to the method described in Example 1.

[0079] (1) Mitochondrial function

[0080] HaCaT cells were plated at 1 × 10 4 The cells were inoculated into confocal dishes at a density of 100 cells / mL and allowed to adhere. Each group was treated with 1.5 mL of normal culture medium (RPMI-1640 culture medium containing 10% fetal bovine serum and 1% double antibody, normal group, Con), 1.5 mL of high glucose culture medium (33 mM anhydrous glucose, HG, was added to the above normal culture medium), 1.5 mL of high glucose culture medium with 250 nM ssDNA (HG+ssDNA) (ssDNA is S1 single-stranded DNA), and 1.5 mL of high glucose culture medium with 250 nM tFNAs (HG+tFNAs) for 72 h. The mitochondrial membrane potential was evaluated by incubating the cells at 37°C for 30 minutes with 150 nM TMRM and 150 nM Mitotracker Green. Mitochondrial ROS was detected by incubating the cells at 37°C for 30 minutes with 2.5 μM MitoSOX Red and 150 nM MitoSOX Green. Fluorescence images were taken using CLSM, and fluorescence expression was detected using FLowSight imaging flow cytometer.

[0081] (2) Intracellular free radical detection

[0082] HaCaT cells were plated at 1 × 10 5 The cells were seeded into confocal dishes at a density of 100 cells / mL and allowed to adhere. Each group was treated with 1.5 mL of normal culture medium (RPMI-1640 culture medium containing 10% fetal bovine serum and 1% double antibody, normal group, Con), 1.5 mL of high glucose culture medium (33 mM anhydrous glucose, HG, was added to the above normal culture medium), 1.5 mL of high glucose culture medium with 250 nM ssDNA (HG+ssDNA) (ssDNA is S1 single-stranded DNA), and 1.5 mL of high glucose culture medium with 250 nM tFNAs (HG+tFNAs) for 72 h. The cells were incubated with 2',7'-dichlorodihydrofluorescein (DCFH-DA) (10 μM; Thermo Scientific) at 37 ° C for 1 hour to evaluate the level of intracellular free radicals. Fluorescence images were taken using CLSM, and fluorescence expression was detected using FLowSight imaging flow cytometer.

[0083] (3) Real-time quantitative RT-PCR (qRT-PCR) analysis

[0084] HaCaT cells were plated at 1 × 10 6The cells were inoculated into a 6-well plate at a density of 100 cells / mL and allowed to adhere. Each group was treated with 1.5 mL of normal culture medium (RPMI-1640 culture medium containing 10% fetal bovine serum and 1% double antibody, normal group, Con), 1.5 mL of high-glucose culture medium (33 mM anhydrous glucose, HG, was added to the above normal culture medium), 1.5 mL of high-glucose culture medium with 250 nM ssDNA (HG+ssDNA) (ssDNA is S1 single-stranded DNA), and 1.5 mL of high-glucose culture medium with 250 nM tFNAs (HG+tFNAs) for 72 h. Total RNA was extracted using an RNA extraction kit (TAKARA, Japan), and the quality of RNA was certified using NanoDrop (ThermoScientific). After cDNA was synthesized using the PrimeScriptTMRT kit (TAKARA), the cDNA was analyzed using QuantStudio TM 6Flex Real-Time PCR System (Applied Biosystems, Inc., USA) PremixEx Taq TM qRT-PCR was performed using TAKARA II. The relative quantification of genes was determined using the 2-ΔΔCT method.

[0085] 2. Experimental results

[0086] Figure 4 A and Figure 4 C is the fluorescence image and quantitative analysis of mitochondrial membrane potential. Figure 4 D and Figure 4 E is the flow cytometry detection and quantitative analysis of mitochondrial membrane potential. The results show that the TMRM fluorescence in the tFNAs group was the highest, and the ratio to mitochondrial green fluorescence was the highest, both close to the control group, indicating that tFNAs can maintain the polarized state of mitochondrial membrane potential under high glucose conditions.

[0087] Figure 4 B and 4F are the fluorescence images and quantitative analysis of mitochondrial oxidative free radicals (mtROS). The results showed that the MitSOX fluorescence in the tFNAs group was the lowest, indicating that tFNAs can eliminate excessive mitochondrial oxidative free radicals induced by high glucose.

[0088] Figure 4 G is the qRT-PCR detection of thioredoxin interacting protein (TXNIP) and superoxide dismutase 2 (SOD 2). The results showed that tFNAs downregulated the expression of TXNIP induced by high glucose and upregulated the expression of SOD 2, indicating that tFNAs can enhance the resistance of mitochondria to oxidative stress.

[0089] Figure 4 H. Figure 4 I and Figure 4 J is the fluorescence image, image quantitative analysis and flow cytometry analysis of intracellular oxidative free radicals. The results showed that the DCFH fluorescence in the tFNAs group was the lowest, indicating that tFNAs can eliminate excessive intracellular oxidative free radicals induced by high glucose.

[0090] Figure 4 K is the qRT-PCR detection of catalase (CAT), and the results showed that tFNAs upregulated the expression of CAT, indicating that tFNAs can enhance the resistance of cells to oxidative stress.

[0091] Experimental Example 4: Regulation of mitochondrial energy metabolism by tFNAs of the present invention promotes cell proliferation, migration and differentiation

[0092] 1. Experimental methods

[0093] The tFNAs used in this test example were prepared according to the method described in Example 1.

[0094] (1) Cell cycle

[0095] HaCaT cells were plated at 1 × 10 5 The cells were inoculated at a density of 10 cells / mL in a 12-well plate. Each group was treated with 1.5 mL of normal culture medium (RPMI-1640 culture medium containing 10% fetal bovine serum and 1% double antibody, normal group, Con), 1.5 mL of high glucose culture medium (33 mM anhydrous glucose, HG, was added to the above normal culture medium), 1.5 mL of high glucose culture medium with 250 nM ssDNA (HG+ssDNA) (ssDNA is S1 single-stranded DNA), and 1.5 mL of high glucose culture medium with 250 nM tFNAs (HG+tFNAs) for 24 h. HaCaT cells were collected with 0.25% trypsin, fixed with 70% ethanol at 4°C for 2 h, and then stained with staining agents (propidium iodide 0.05 mg / ml, RNase A 1 mg / ml, 0.3% Triton X-100) at 37°C in the dark for 30 min. DNA content (intensity of benzyl iodide) was quantified by FlowSight imaging flow cytometer (EMD Biosciences / Millipore, Billerica, MA, USA) to distinguish cells in different cell cycle phases and subsequently analyzed using IDEAS software (Amnis Technology, EMD Millipore, Billerica, MA, USA).

[0096] (2) Cell scratch healing assay

[0097] HaCaT cells were plated at 2 × 10 5The cells were inoculated into 6-well plates at a density of 100 cells / mL. The control group was pretreated with 1.5 mL of ordinary culture medium (RPMI-1640 culture medium containing 10% fetal bovine serum and 1% double antibody, normal group, Con), and all experimental groups were pretreated with 1.5 mL of high glucose culture medium (33 mM anhydrous glucose, HG, was added to the ordinary culture medium) for 24 hours. The cells were scratched with a sterile p200 pipette, and then washed with PBS to remove unattached cells. The cells in the HG, HG+ssDNA, and HG+tFNA groups were incubated with RPMI-1640 containing 1% FBS and 33 mM glucose. The HG+ssDNA and HG+tFNA groups were treated with ssDNA (250 nM, ssDNA is S1 single-stranded DNA) and tFNAs (250 nM), respectively. The control group was treated with RPMI-1640 containing 1% FBS. Photos were taken under an Olympus (Japan) optical microscope after 0, 6, 12, 24, and 36 hours. The scratch area was measured by ImageJ software, and the percentage was calculated from the ratio of the scratch area at each time point to the original scratch area at 0 h.

[0098] (3) Transwell migration assay

[0099] HUVECs were plated at 2 × 10 per well. 5 The density of cells was inoculated into the upper chamber of a 24-well Transwell. RPMI-1640 containing 20% ​​FBS was added to the lower chamber of the control group (Con). High-glucose RPMI-1640 (containing 33mM anhydrous glucose) containing 20% ​​FBS was added to the lower chambers of the other groups, and ssDNA (250nM) and tFNAs (250nM) were additionally added to the lower chambers of the HG+ssDNA and HG+tFNA groups. After 24 hours, the chambers were fixed with 4% PFA for 15 minutes. The migrated cells were then stained with crystal violet solution for 15 minutes. The non-migrated cells remaining on the surface of the screen were removed with a cotton swab. The number of migrated cells was photographed and counted under an Olympus (Japan) optical microscope.

[0100] (4) Tube forming experiment

[0101] 200 μl of Matrigel (BD, USA) was placed into each well of a pre-cooled 24-well plate and then incubated at 37°C for 1 h. HUVECs were plated at 1×10 5The cells were seeded at a density of 100 cells / mL in the 24-well plate. Each group was treated with 1.5 mL of normal culture medium (RPMI-1640 culture medium containing 10% fetal bovine serum and 1% double antibody, normal group, Con), 1.5 mL of high glucose culture medium (33 mM anhydrous glucose, HG, was added to the above normal culture medium), 1.5 mL of high glucose culture medium and 250 nM ssDNA (HG+ssDNA) (ssDNA is S1 single-stranded DNA), and 1.5 mL of high glucose culture medium and 250 nM tFNAs (HG+tFNAs). After treating the cells for 6 h, images were collected using an Olympus optical microscope and quantified using ImageJ software.

[0102] 2. Experimental results

[0103] Figure 5 A is the use of flow cytometry to explore the cell cycle. The results show that after the application of tFNAs, the number of cells in the proliferation phase (G2-M phase) increased significantly, while the number of cells in the presynthesis phase (G0 / G1 phase) decreased, indicating that tFNAs improved cell mitosis inhibited by hyperglycemia.

[0104] Figure 5 B: Impaired vascular remodeling and keratinocyte differentiation are a defining feature of diabetic chronic wounds. Figure 5 C is qRT-PCR analysis of the expression of keratin differentiation-related genes. Administration of tFNAs upregulated the expression of keratin differentiation-related genes Involucrin, Keratin 1, Loricrin and Transglutaminase (TGM) 1, indicating that tFNAs improved keratinocyte differentiation under hyperglycemia conditions.

[0105] Figure 5 D and 5E are the healing images and scratch area analysis of the keratinocyte scratch experiment. The results showed that after 36 hours of continuous observation, the scratches in the high sugar and ssDNA treatment groups were not completely healed, while those in the tFNAs treatment group were completely healed, indicating that tFNAs promote keratinocyte migration to promote wound healing.

[0106] Figure 5 F is the crystal violet staining image of HUVEC cells after transwell migration and quantitative analysis of migrating cells. The results showed that more cells migrated after the application of tFNAs, indicating that tFNAs promote endothelial cell migration to promote angiogenesis.

[0107] Figure 5 G is a typical image and quantitative analysis of HUVEC cells forming tubes on matrix gel. The results show that HUVEC cells are more likely to form blood vessels and have more vascular connections after the application of tFNAs, indicating that tFNAs improve the angiogenesis ability of HUVECs in hyperglycemic patients and contribute to vascular reconstruction of chronic wounds in diabetes.

[0108] Experimental Example 5: tFNAs of the present invention accelerate the healing of chronic wounds in diabetes

[0109] 1. Experimental methods

[0110] (1) Establishment of diabetic rat model

[0111] Healthy male Sprague Dawley (SD) rats aged 6 weeks were housed in a specific pathogen-free (SPF) animal facility with a 12-hour light-dark cycle per day. After receiving a high-fat, high-sugar diet for three weeks, streptozotocin (45 mg / kg, Sigma) was injected intraperitoneally. Non-fasting blood glucose levels (BGL) were monitored weekly by collecting tail vein blood samples using an electronic blood glucose meter (Accu-Check Performa, Roche Diagnostics, USA). Rats with blood glucose levels exceeding 16.7 mmol / L were considered to have successfully established the model.

[0112] (2) Animal grouping

[0113] Rats were anesthetized under sterile conditions, and a full-thickness skin wound with a diameter of 15 mm was inoculated on the back of each rat. The rats were divided into a normal control group (Con), a diabetes group (DM), a diabetes combined with ssDNA (ssDNA is S1 single-stranded DNA) group (DM+ssDNA), a diabetes combined with tFNAs (tFNAs prepared according to the method described in Example 1) group (DM+tFNAs) and a positive control group (positive) (the positive control group was treated with recombinant bovine basic fibroblast growth factor). The wounds of diabetic rats were treated with 200 μL TM buffer, 200 μL ssDNA (250 nM), 200 μL tFNAs (250 nM) or 200 μL recombinant bovine basic fibroblast growth factor (4200 IU / mL) for 16 days.

[0114] (3) Wound healing assessment and gross observation of biopsy

[0115] Digital photographs of the injured area were taken on the day of surgery and every other day after surgery. A ruler was placed next to the wound to calibrate the distance between the wound and the camera. ImageJ software was used to quantify wound healing. Wound tissues were collected on the 16th day after surgery, fixed, dehydrated, embedded, and sectioned, and stained for HE, Masson, Drp 1, ATF4, and CD31, respectively. Fresh tissues were quickly frozen in liquid nitrogen for in vivo RT-PCR and antioxidant enzyme concentration detection.

[0116] 2. Experimental results

[0117] Figure 6 A and Figure 6F is a representative picture of wound healing in each group of rats and a line graph of the percentage of wound area. The results show that the wound healing speed after application of tFNAs was significantly faster than that of the wounds treated with ssDNA and the diabetic control group. The healing rate reached 80% on the 8th day, while the healing rate of the ssDNA and diabetes (DM) groups was 60%. On the 16th day, the wound area was completely closed, similar to the healing speed of the non-diabetic group.

[0118] Figure 6 B. Figure 6 C and Figure 6 D is a line graph of weight changes, glycosylated serum protein and random blood glucose levels of rats in each group. The results show that except for the control group, the weight gain of all rats slowed down significantly, serum protein was glycosylated and the blood glucose level was too high, indicating that the diabetes model was successfully established for animal experiments.

[0119] Figure 6 E and Figure 6 G is the quantitative detection of SOD and glutathione peroxidase (GSH-PX) in the new skin tissue of each group. The results showed that the expression of SOD and GSH-PX was upregulated after the application of tFNAs, indicating that tFNAs can increase the local anti-oxidative stress capacity of the skin.

[0120] Figure 6 H, 6I and Figure 6 J is the HE, Masson staining and quantitative analysis of the wounds on the 16th day after trauma in each group. The results showed that the epithelium of the acute wounds in each group was almost completely reconstructed, but the epithelium in the DM group was significantly thickened, with subcutaneous hemorrhage and inflammatory cell infiltration; after tFNAs treatment, the width of the skin granulation tissue was significantly reduced and had a multi-layer epithelial structure, healthy subepithelial tissue, and increased new blood vessels. tFNAs treatment can reduce the width of granulation tissue and the thickness of skin scars after diabetic wound healing, and can promote collagen deposition. All of the above indicate that tFNAs treatment can promote the healing of chronic diabetic wounds.

[0121] Figure 6 K and Figure 6 L is the fluorescence staining picture of Drp1 and ATF4 in the local wound sections of each group on the 16th day after trauma. The results showed that the fluorescence of Drp1 and ATF4 in the tFNAs treatment group was significantly reduced, indicating that tFNAs can promote wound healing by alleviating ERS, reestablishing mitochondrial dynamic homeostasis, and enhancing local oxidative stress resistance in chronic diabetic wounds.

[0122] In summary, the present invention found that tetrahedral framework nucleic acids (tFNAs) are transported to the endoplasmic reticulum and mitochondria through caveolin-mediated endocytosis, which can improve endoplasmic reticulum stress and mitochondrial function under high sugar environment, regulate cellular energy metabolism and promote ATP production. The energy metabolism regulation of tFNAs promotes cell proliferation, migration and differentiation, and ultimately promotes the healing of chronic wounds in diabetes. Using tFNAs as active ingredients to regulate energy metabolism will become a potential therapeutic strategy for the treatment of metabolic diseases such as diabetes.

Claims

1. Use of tetrahedral framework nucleic acid in the preparation of drugs for promoting diabetic wound healing; The tetrahedral framework nucleic acid is a tetrahedral framework nucleic acid formed by base complementary pairing of a single-stranded DNA sequence such as SEQ ID NO. 1 to 4; The molar ratio of the four DNA single strands whose sequences are as described in SEQ ID NOs. 1 to 4 is 1:1:1:1; The method for preparing the tetrahedral framework nucleic acid comprises the following steps: The four DNA single strands were maintained at 85-105°C for 5-15 min, and then maintained at 2-8°C for 20-30 min.

2. The use according to claim 1, characterized in that: The method for preparing the tetrahedral framework nucleic acid comprises the following steps: maintaining four DNA single strands at 95° C. for 10 minutes and then maintaining them at 4° C. for 20 minutes.

3. The use according to claim 1 or 2, characterized in that: The drug is a drug for restoring mitochondrial function and / or regulating mitochondrial energy metabolism.

4. The use according to claim 3, characterized in that: The drug is a drug that eliminates oxidative stress in mitochondria and cells.

5. The use according to claim 4, characterized in that: The drug is a drug for removing oxidative free radicals induced by high sugar.

6. The use according to claim 4, characterized in that: The drug is a drug that promotes cell proliferation, migration, and differentiation; And / or, the drug is a drug that promotes angiogenesis.

7. The use according to claim 1 or 2, characterized in that: The medicine is a preparation prepared by taking tetrahedral framework nucleic acid as active ingredient and adding pharmaceutically acceptable auxiliary materials.

8. The use according to claim 7, characterized in that: The preparation is an external preparation.

Images