Application of miR1868 in regulating rice tillering and virus resistance

Abstract

The present invention discloses the application of miR1868 in regulating rice tillering and anti-virus. This scheme provides the application of genes Osa-miR1868 (referred to as miR1868) and Pre-miR1868 (miR1868 precursor) in regulating plant tillering and resistance to viral diseases; this scheme introduces a DNA molecule encoding Pre-miR1868 into a target plant to obtain a transgenic plant, wherein the transgenic plant has less tillering than a recipient plant, but has higher disease resistance than the recipient plant. It is shown that overexpression of Pre-miR1868 reduces plant tillering, but increases plant tolerance to viral diseases. Pre-miR1868 has the function of regulating plant tillering and virus resistance, and is of great value for cultivating antiviral plants and increasing plant yield.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of miR1868 in regulating rice tillering and anti-virus. Background Art

[0002] Rice (Oryza sativa L.) originated in tropical and subtropical regions. It is an important food crop in the world and is the staple food of nearly half of the world's population. Therefore, the high and stable yield of rice is related to the national economy and people's livelihood. The yield of rice is closely related to agronomic traits such as plant height, tillering, panicle type, grain size and 1000-grain weight. Among them, moderate tillering number, reasonable plant height, large panicle and many grains are the ideal attributes of high yield and high quality of super rice. Reasonable control of the number of rice tillers is conducive to increasing the number of effective panicles and panicle weight of rice, increasing the lodging resistance and stress resistance of rice, and thus increasing the overall yield of rice. Rice domestication has gone through the green revolution, hybrid rice and other processes, and has now entered the molecular design breeding stage. Cultivating rice with moderate tillering from genetics and molecular biology is an important indicator for achieving the "ideal plant type". For example, if the abundance of SPL14 protein is increased within a reasonable range, the number of rice tillers will be slightly lower, but the yield of rice will be increased, and the tolerance of rice to adversity will be improved. It is also called the ideal plant type gene IPA1, which is also the core gene for breeding super rice. Therefore, finding and isolating genes that control tillering traits in rice is of great significance for guiding molecular breeding and variety improvement.

[0003] The stable yield of rice is threatened by a variety of biological and abiotic stresses, among which pests and diseases are important factors affecting rice yield and quality. Breeding pest-resistant rice varieties is an efficient prevention and control strategy to control pests and diseases at the source. Once a rice virus disease breaks out, there is almost no effective prevention and control measure, which brings great harm. Most of these viral diseases are transmitted by vector insects, which increases the difficulty of prevention and control of viral diseases. Rice ragged stunt virus (RRSV) belongs to the genus Oryzavirus of the family Reoviridae. Rice infected with RRSV is stunted, has increased tillering, has dark green leaves, twisted leaves, and has serrated notches. It often cannot produce heading, resulting in rice crop failure, which poses a great threat to rice production. So far, no rice varieties with significant resistance to RRSV have been promoted in agricultural production. Studies have found that transgenic rice expressing the viral components of RRSV in rice and activating RNA interference (RNAi) can achieve very significant antiviral effects.

[0004] Small RNA (microRNA, miRNA) is an important component in the RNAi pathway. They bind to AGO proteins, bind to targets through complementary base pairing, regulate the transcription of target genes, and inhibit the cleavage and translation of post-transcriptional mRNA. MiRNA widely regulates multiple physiological and biochemical processes of plant growth and development and response to biological and abiotic stresses. During the growth and development period of rice, both the morphological construction of plants, the transition of developmental periods, and the processes of disease resistance and stress resistance are regulated by miRNA. At present, the research on species and functional conservative miRNA is relatively in-depth, and the research on some species and functional specific miRNA is relatively lagging behind. There are few reports on the functional research of miRNA in the interaction between viruses and rice. The functional research of miR1868 induced by virus infection in the interaction between rice and viruses has not been reported. The present invention screened miR1868 in the miRNA that responds to virus infection, and further revealed the function of miR1868 in rice development and antiviral, which is of great significance for the improvement of rice tillering and antiviral traits. Summary of the invention

[0005] In view of this, the purpose of the present invention is to propose a reliable and flexible application of miR1868 in regulating rice tillering and anti-virus.

[0006] In order to achieve the above technical objectives, the technical solution adopted by the present invention is:

[0007] A miRNA, set as miR1868, which has the following miRNA a1) or a2):

[0008] a1) the nucleotide sequence of the miRNA is shown in SEQ ID NO.1;

[0009] a2) A miRNA having the same function or more than 75% identity with the RNA molecule shown in a1) is obtained by substituting and / or deleting and / or adding nucleotides to the nucleotide sequence shown in SEQ ID NO.1.

[0010] A miRNA precursor, set as miR1868 precursor, having the following miRNA precursor sequence b1) or b2):

[0011] b1) the nucleotide sequence is the miRNA precursor sequence shown in SEQ ID NO.2;

[0012] b2) A miRNA precursor sequence having the same function or more than 75% identity with the RNA molecule shown in b1) obtained by substituting and / or deleting and / or adding nucleotides to the nucleotide sequence shown in SEQ ID NO.2.

[0013] Based on the above, the present solution also provides the use of up-regulating the expression of miRNA and / or miRNA precursor in reducing plant tillering and / or enhancing plant resistance to sawtooth leaf dwarf virus, wherein the plant is rice, and the miRNA is the following miRNA a1) or a2):

[0014] a1) the nucleotide sequence of the miRNA is shown in SEQ ID NO.1;

[0015] a2) a miRNA having the same function or more than 75% identity with the RNA molecule shown in a1) obtained by replacing and / or deleting and / or adding nucleotides of the nucleotide sequence shown in SEQ ID NO.1;

[0016] The miRNA precursor has the following miRNA precursor sequence b1) or b2):

[0017] b1) the nucleotide sequence is the miRNA precursor sequence shown in SEQ ID NO.2;

[0018] b2) A miRNA precursor sequence having the same function or more than 75% identity with the RNA molecule shown in b1) is obtained by substituting and / or deleting and / or adding nucleotides to the nucleotide sequence shown in SEQ ID NO.2.

[0019] Based on the above, the present solution also provides the use of a biological material comprising the miRNA or the miRNA precursor described above in regulating plant tillering and / or plant resistance to sawtooth leaf dwarf virus.

[0020] As a preferred embodiment, preferably, the biomaterial described in this solution is any one of the following A1) to A12):

[0021] A1) a nucleic acid molecule encoding the miRNA or the miRNA precursor;

[0022] A2) an expression cassette containing the nucleic acid molecule described in A1);

[0023] A3) a recombinant vector containing the nucleic acid molecule described in A1);

[0024] A4) a recombinant vector containing the expression cassette described in A2);

[0025] A5) a recombinant microorganism containing the nucleic acid molecule described in A1);

[0026] A6) a recombinant microorganism containing the expression cassette described in A2);

[0027] A7) a recombinant microorganism containing the recombinant vector described in A3);

[0028] A8) a recombinant microorganism containing the recombinant vector described in A4);

[0029] A9) a transgenic plant cell line containing the nucleic acid molecule described in A1);

[0030] A10) a transgenic plant cell line containing the expression cassette described in A2);

[0031] A11) a transgenic plant cell line containing the recombinant vector described in A3);

[0032] A12) A transgenic plant cell line containing the recombinant vector described in A4).

[0033] As a preferred embodiment, preferably, the nucleic acid molecule described in scheme A1) is as follows 1), 2) or 3):

[0034] 1) Its precursor sequence is the genomic DNA molecule shown in positions 129-297 of the sequence shown in SEQ ID NO.3;

[0035] 2) a genomic DNA molecule that has a nucleotide sequence that is 75% or more identical to the genomic DNA molecule defined in 1) and encodes the miRNA or the miRNA precursor described above;

[0036] 3) A genomic DNA molecule that hybridizes with the nucleotide sequence of the genomic DNA molecule defined in 1) or 2) under stringent conditions and encodes the miRNA or the miRNA precursor described above.

[0037] Based on the above, the present solution also provides the use of the miRNA or the miRNA precursor described above or the biological material containing the miRNA or the miRNA precursor described above in cultivating disease-resistant plants or breeding.

[0038] The plant is a monocot or a dicot. The monocot can be rice, such as rice variety "Zhonghua 11, ZH11"

[0039] As a preferred embodiment, preferably, the cultivation of disease-resistant plants or breeding described in this scheme is to cultivate plants or plant seeds with reduced tillering and enhanced resistance to rice sawtooth leaf dwarf virus.

[0040] As a preferred embodiment, the tillering reduction in this embodiment is to investigate the number of effective tillers at the booting stage, and the enhanced resistance of the cultivated transgenic plants to rice sawtooth leaf dwarf virus is manifested as any one of the following (1)-(3) being higher than that of the recipient plant:

[0041] (1) After infection with the virus, the amount of virus accumulated in the transgenic plant is lower than that in the recipient plant;

[0042] (2) The transgenic plants develop milder symptoms after being infected with the virus than the recipient plants;

[0043] (3) The transgenic plants have a lower incidence rate after being infected with viruses than the recipient plants

[0044] Based on the above, the present solution also provides a method for cultivating antiviral transgenic plants, wherein the transgenic plants contain the miRNA and / or the miRNA precursor described above, and the method comprises increasing the expression level of the miRNA or the miRNA precursor in the recipient plant;

[0045] Wherein, the miRNA is set to miR1868, and the upregulation of its expression is achieved by introducing a vector overexpressing Pre-miR1868 into the recipient plant;

[0046] The vector for overexpressing Pre-miR1868 uses the constitutive promoter ACTIN1 to drive the expression of a sequence containing Pre-miR1868, and the sequence containing Pre-miR1868 is the sequence shown in SEQ ID NO.3.

[0047] In the above method, the method for increasing the expression level of Osa-miR1868 (abbreviated as miR1868) or the Osa-miR1868 (abbreviated as miR1868) precursor sequence in the recipient plant is to overexpress the Osa-miR1868 precursor sequence in the recipient plant; the overexpression method is to introduce the Osa-miR1868 precursor sequence into the recipient plant; the Osa-miR1868 precursor sequence is the genomic DNA molecule shown in positions 129-297 of sequence 3.

[0048] In one embodiment of the present scheme, the Osa-miR1868 precursor sequence is introduced into the recipient plant via the recombinant vector pCAMBIA2300-ACTIN1-Pre-miR1868, wherein the recombinant vector pCAMBIA2300-ACTIN1-Pre-miR1868 is a vector obtained by inserting the DNA molecule shown in sequence 4 (SEQ ID NO.4) between the restriction endonuclease cutting sites of the two restriction endonucleases XbaⅠ and PstⅠ of the pCAMBIA2300-ACTIN1 vector, and keeping the other sequences of the pCAMBIA2300-ACTIN1 vector unchanged.

[0049] By adopting the above-mentioned technical scheme, the present invention has the following beneficial effects compared with the prior art: This scheme provides the application of genes Osa-miR1868 (referred to as miR1868) and Pre-miR1868 (miR1868 precursor) in regulating plant tillering and resistance to viral diseases. This scheme introduces a DNA molecule encoding Pre-miR1868 into the target plant to obtain a transgenic plant, wherein the transgenic plant has fewer tillers than the recipient plant, but has higher disease resistance than the recipient plant. This indicates that overexpression of Pre-miR1868 reduces plant tillering, but increases plant tolerance to viral diseases. Pre-miR1868 has the function of regulating plant tillering and virus resistance, and is of great value for cultivating virus-resistant plants and increasing plant yields. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0051] Figure 1 RRSV induced the expression of miR1868; qRT-PCR was used to analyze the accumulation of miR1868 in rice after infection with RRSV. Compared with the control, the accumulation of miR1868 in rice was significantly increased after infection with RRSV, indicating that RRSV infection induced the expression of miR1868.

[0052] Figure 2 qRT-PCR was used to detect the accumulation of miR1868 in OX1868 and MIM1868 transgenic rice; Figure 2 A shows that in transgenic rice overexpressing Pre-miR1868, the accumulation of miR1868 increased significantly; Figure 2 B shows that the accumulation of miR1868 was significantly reduced in the transgenic rice with silenced miR1868, indicating that miR1868 in the transgenic rice was regulated.

[0053] Figure 3 The developmental phenotype and tiller number statistics of miR1868 transgenic rice; Figure 3 A is the growth and development phenotype of wild type, OX1868 and MIM1868 at the booting stage; Figure 3 B is the statistical results of tiller numbers of wild type, OX1868 and MIM1868; the results showed that the tiller number in OX1868 was significantly reduced.

[0054] Figure 4 Analysis of virus disease resistance of miR1868 transgenic rice; Figure 4 A is a comparison of the symptoms of wild-type rice, OXmiR1868, and MIM1868 after infection with RRSV; Figure 4 B is the accumulation of viral nucleic acid in the aerial tissues of wild-type, OX1868, and MIM1868 transgenic rice after infection with RRSV; Figure 4 C is the accumulation of viral coat protein in the aerial tissues of wild-type, OX1868, and MIM1868 transgenic rice after infection with RRSV; Figure 4 D is the statistical ratio of the severity of symptoms among wild-type, OX1868, and MIM1868 transgenic rice infected with RRSV. DETAILED DESCRIPTION

[0055] The present invention will be further described in detail below in conjunction with the accompanying drawings and examples. It is particularly noted that the following examples are only used to illustrate the present invention, but are not intended to limit the scope of the present invention. Similarly, the following examples are only partial embodiments of the present invention rather than all embodiments, and all other embodiments obtained by those of ordinary skill in the art without creative work are within the scope of protection of the present invention.

[0056] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. The method for constructing the MIM vector of miRNA is referred to Yan, J., Gu, Y., Jia, X., Kang, W., Pan, S., Tang, X., Chen, X., and Tang, G. (2012). Effective small RNA destruction by the expression of ashort tandemtarget mimic in Arabidopsis. Plant cell 24, 415-427.

[0057] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0058] Example 1. Discovery and verification of Osa-miR1868 (referred to as miR1868)

[0059] Total RNA was extracted from RNA samples of the aerial parts of Zhonghua 11 rice infected with RRSV, and a high-throughput sequencing library of small molecule RNAs that respond to virus infection was constructed. A miRNA induced by RRSV was analyzed and screened, and its name was Osa-miR1868 or simply miR1868. The mature sequence of this miRNA is sequence 1 (SEQ ID NO.1). Using the extracted total RNA as a template, on the basis of the reverse transcription kit, the specific reverse transcription primer miR1868-RT of Osa-miR1868 was additionally added, and cDNA was obtained by reverse transcription using the neck loop reverse transcription method, which was diluted 5 times as the cDNA template for fluorescent quantitative PCR. Fluorescent quantitative primers miR1868-qF and miR1868-qR were used, and the U6 gene in rice was used as the internal reference gene for fluorescent quantitative PCR detection. The primer sequences used for detection are as follows:

[0060] miR1868-RT (SEQ ID NO.6):

[0061] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGCTGmiR1868-Qf (SEQ IDNO.7): CGTCACGGAAAACGAGGGAG

[0062] miR1868-qR (SEQ ID NO.8): AGTGCAGGGTCCGAGGTATT

[0063] U6-qF (SEQ ID NO.9): CGATAAAATTGGAACGATACAGA

[0064] U6-qR(SEQ ID NO.10):ATTTGGACCATTTCTCGATTTGT

[0065] qRT-PCR results Figure 1 The results showed that the accumulation of mature Osa-miR1868 in rice infected with RRSV was higher than that in the control, indicating that viral infection activated the accumulation of Osa-miR1868.

[0066] Example 2 Cloning of miR1868 precursor sequence

[0067] Primer design

[0068] The keyword Osa-miR1868 (referred to as miR1868) was searched on the miRBase (https: / / www.mirbase.org / ) website, and the accession number MI0008270 was obtained, and its precursor sequence Pre-miR1868 (as shown in sequence 1 (SEQ ID NO.1)) was obtained. The size of the precursor sequence is 169 bp. The base U in the precursor sequence of Pre-miR1868 was replaced with T, and the BLAST function was used as a template on the NCBI (https: / / www.ncbi.nlm.nih.gov / ) website to compare and analyze its position in rice. The results showed that Pre-miR1868 was located at 19715448-19715616 on chromosome 4 of the rice variety Nipponbare genome. In this interval, 200bp were extended upstream and downstream respectively to obtain the nucleic acid sequence of Chr4:19715248-19715816. All sequences in this interval were downloaded and used as a template to design the cloning primers of Pre-miR1868 using Primer Premier 5.0. Finally, an interval extending 128bp upstream and 132bp downstream of Pre-miR1868 was selected. The primer sequences are as follows:

[0069] Pre-miR1868-F(SEQ ID NO.11):GTTGCCTCCGTGGCCTATT

[0070] Pre-miR1868-R(SEQ ID NO.12):AATCAAAAGGTGGGCTGAGCT

[0071] Cloning of Pre-miR1868

[0072] The genome of the rice variety Nipponbare was extracted and used as the amplification template of Pre-miR1868. The PCR amplification reaction was performed with Pre-miR1868-F and Pre-miR1868-R primers and a high-fidelity enzyme to obtain a PCR product. The PCR amplification product was 429 bp in size, and sequencing proved that the fragment contained the precursor sequence Pre-miR1868 of Osa-miR1868 (Sequence 3 (SEQ ID NO.3) 129-297).

[0073] Example 3: Construction of vector for overexpression of miR1868 in plants

[0074] 1. Using the genomic template in Example 2, OXPre-miR1868-F and OXPre-miR1868-R primers were designed to construct a vector for overexpressing Pre-miR1868, and the restriction sites (lowercase letters) of XbaⅠ and PstⅠ and the corresponding protective bases (underlined) were added to the front and back primers, respectively, to obtain the primer sequences as follows:

[0075] OXPre-miR1868-F(SEQ ID NO.13):

[0076] GC tctagaGTTGCCTCCGTGGCTCTATT

[0077] OXPre-miR1868-R(SEQ ID NO.14):

[0078] AA ctgcagAATCAAAAGGTGGGCTGAGCT

[0079] 2. Double digest the pCAMBIA2300-ACTIN1 vector and the Pre-miR1868 fragment obtained in step 1 with restriction endonucleases XbaⅠ and PstⅠ, incubate at 37℃ for 3 hours, and recover the target fragment. Incubate the digested vector and fragment at 16℃ for 8 hours in a reaction solution containing T4 ligase, heat-shock transform E. coli DH5α, screen the positive single clone containing pCAMBIA2300-ACTIN1-Pre-miR1868 by colony PCR, extract the plasmid after shaking amplification, and send it for sequencing.

[0080] 3. The sequencing results showed that the recombinant binary expression vector pCAMBIA2300-ACTIN1-Pre-miR1868 inserted the DNA molecule shown in sequence 3 between the restriction sites of XbaⅠ and PstⅠ, and kept the other sequences of the pCAMBIA2300-ACTIN1 vector unchanged.

[0081] Example 4 Construction of vector for silencing Osa-miR1868 (referred to as miR1868) function

[0082] 1. Primer Design

[0083] The sequence shown in sequence 1 (SEQ ID NO.1) was used as a template to obtain its reverse complementary sequence, and cta was added between the 14th and 15th nucleotides in the reverse complementary sequence, and the adapter sequence overlapping with the 48nt backbone sequence and the restriction endonuclease site were added to the front and back primers respectively, the restriction endonuclease of the front primer was XbaI (lowercase letters), the restriction endonuclease of the back primer was PstI (lowercase letters), the protection bases (capital letters underlined), and the overlapping sequence with the universal backbone (lowercase letters italic). The primer sequences obtained are as follows:

[0084] MIM1868-F (SEQ ID NO.15):

[0085] GC tctagaTGGCTGCTCCCTCG cta TTTTCCGTGAgttgttgttgttatg

[0086] MIM1868-R (SEQ ID NO. 16):

[0087] AA ctgcagTCACGGAAAAtagCGAGGGAGCAGCCAattcttcttctttag

[0088] 2. A fragment of 118 bp of backbone and incomplete complementary sequence of miR1868 was obtained by fusion PCR amplification. The PCR product fragment and pCAMBIA2300-ACTIN1 vector were double-digested with restriction endonucleases XbaⅠ and PstⅠ, fully incubated at 37℃ for 3 hours, and the target fragment was recovered. The digested vector and fragment were incubated at 16℃ for 8 hours in a reaction solution containing T4 ligase, and heat-shocked to transform Escherichia coli DH5α. The positive single clone containing pCAMBIA2300-ACTIN1-Pre-miR1868 was screened by colony PCR. After shaking amplification, the plasmid was extracted and sent for sequencing.

[0089] 3. The sequencing results showed that the recombinant binary expression vector pCAMBIA2300-ACTIN1-MIM1868 had the DNA molecule represented by sequence 5 (SEQ ID NO.5) inserted between the restriction sites of XbaⅠ and PstⅠ, and kept the other sequences of the pCAMBIA2300-ACTIN1 vector unchanged.

[0090] Example 5 Acquisition and identification of OX1868 and MIM1868 transgenic rice

[0091] 1. Bio-Tech used Agrobacterium (strain EHA105) to mediate genetic transformation and obtained more than 20 T0 transgenic strains.

[0092] 2. Total RNA of T0 transgenic rice was extracted, and reverse transcribed to synthesize cDNA according to the operation in Example 1. The accumulation of mature miR1868 was detected by fluorescence quantitative analysis using cDNA as a template.

[0093] 3. The positive materials of the four strains of OX1868 and MIM1868 were self-pollinated respectively, and T1 generation seeds were harvested from individual plants. The positive plants of T1 generation seeds were identified according to the fluorescent quantitative PCR method in step 2. They were also self-pollinated, and T2 generation seeds were harvested from individual plants. The plants grown from T2 generation seeds were identified according to the fluorescent quantitative PCR method in step 2. T3 generation rice seeds were harvested from the homozygous T2 generation plants for subsequent disease resistance analysis.

[0094] The results of fluorescence quantification are as follows Figure 3 As shown in the figure, the accumulation of Osa-miR1868 (referred to as miR1868) in the two OX1868 strains (OX1868#3 and OX1868#18) was significantly higher than that in the wild type; the accumulation of Osa-miR1868 in the two MIM1868 (MIM1868#15, MIM1868#23) was significantly lower than that in the wild type.

[0095] Example 6 Analysis of virus resistance of miR1868 transgenic rice

[0096] 1. Select plump seeds of wild-type rice Zhonghua 11 (WT), T3 generation OX1868 and MIM1868 transgenic rice homozygous strains, and culture them in a greenhouse with a light period of 12 hours at 28°C and a dark period of 12 hours at 25°C for about 2 weeks after germination. At this time, the rice is in the three-leaf stage. After the rice is fed by brown planthoppers carrying RRSV, it is cultured for 8 weeks. The first four weeks are cultured in the greenhouse. After obvious symptoms are observed, the seeds are transplanted to the field, the severity of the symptoms is observed, and the incidence of rice is counted. At the same time, in the fourth week, the above-ground tissues of no less than 6 independent plants are selected to extract RNA and protein to detect the accumulation of viral capsid protein at the RNA and protein levels.

[0097] The results are as follows Figure 4 As shown in the figure, it can be seen that the rice with excessive accumulation of Osa-miR1868 (referred to as miR1868) has milder symptoms ( Figure 4 A), less virus accumulation ( Figure 4 B and C), the proportion of severe symptoms was lower ( Figure 4 D); however, the transgenic rice with reduced Osa-miR1868 accumulation showed more severe symptoms ( Figure 4 A), higher virus accumulation ( Figure 4 B and C), the proportion of patients with severe symptoms was higher ( Figure 4 D); The results showed that overexpression of Pre-miR1868 enhanced the resistance of rice to RRSV.

[0098] The above descriptions are only some embodiments of the present invention, and are not intended to limit the protection scope of the present invention. Any equivalent device or equivalent process transformation made using the contents of the present invention specification and drawings, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. Use of up-regulating the expression of miRNA and / or miRNA precursor in reducing plant tillering and / or enhancing plant resistance to sawtooth leaf dwarf virus, characterized in that: The plant is rice, and the miRNA is the following miRNA a1): a1) the nucleotide sequence of the miRNA is shown in SEQ ID NO.1; The miRNA precursor has the following miRNA precursor sequence b1): b1) The nucleotide sequence is the miRNA precursor sequence shown in SEQ ID NO.

2.

2. Use of miRNA or miRNA precursor biomaterials in reducing plant tillering and / or enhancing plant resistance to sawtooth leaf dwarf virus, characterized in that: The plant is rice; The miRNA is the miRNA of a1): a1) the nucleotide sequence of the miRNA is shown in SEQ ID NO.1; The miRNA precursor has the following miRNA precursor sequence b1): b1) The nucleotide sequence is the miRNA precursor sequence shown in SEQ ID NO.

2.

3. The use according to claim 2, characterized in that The biological material is any one of the following A1) to A12): A1) a nucleic acid molecule encoding the miRNA according to claim 1 or the miRNA precursor according to claim 2; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) a recombinant microorganism containing the recombinant vector described in A4); A9) a transgenic plant cell line containing the nucleic acid molecule described in A1); A10) a transgenic plant cell line containing the expression cassette described in A2); A11) a transgenic plant cell line containing the recombinant vector described in A3); A12) A transgenic plant cell line containing the recombinant vector described in A4).

4. The use according to claim 3, characterized in that The nucleic acid molecule described in A1) is as follows: 1) Its precursor sequence is the genomic DNA molecule shown in the sequence 129-297 shown in SEQ ID NO.

3.

5. Application of miRNA or miRNA precursor or biological material containing miRNA or miRNA precursor in cultivating disease-resistant rice or rice breeding; The miRNA is the miRNA of a1): a1) the nucleotide sequence of the miRNA is shown in SEQ ID NO.1; The miRNA precursor has the following miRNA precursor sequence b1): b1) The nucleotide sequence is the miRNA precursor sequence shown in SEQ ID NO.

2.

6. A method for cultivating a virus-resistant transgenic plant, wherein the transgenic plant contains a miRNA with a nucleotide sequence of SEQ ID NO.1 and / or a miRNA precursor with a nucleotide sequence of SEQ ID NO.2, characterized in that: The method comprises increasing the expression level of the miRNA or the miRNA precursor in a recipient plant; Wherein, the miRNA is set to miR1868, and the upregulation of its expression is achieved by introducing a vector overexpressing Pre-miR1868 into the recipient plant; The vector for overexpressing Pre-miR1868 is achieved by using the constitutive promoter ACTIN1 to drive the expression of a sequence containing Pre-miR1868, and the sequence containing Pre-miR1868 is the sequence shown in SEQ ID NO.3; The plant is rice.

Images