A method for screening nucleic acid aptamers of broad-spectrum pyrrolizidine base and its application

Abstract

The invention belongs to the technical field of screening and application of nucleic acid aptamers, and specifically relates to a nucleic acid aptamer of a broad-spectrum pyrrolizidine alkaloid, a screening method and an application thereof. The invention mainly comprises the following steps: firstly, preparing a DNA library, then fixing the DNA library, screening and separating targets, detecting by polyacrylamide gel electrophoresis, amplifying the DNA library, collecting DNA, high-throughput sequencing and verifying affinity. The aptamer obtained by the screening method can have a high affinity with a variety of pyrrolizidine alkaloids, can be applied to detecting the concentration of pyrrolizidine base, and the aptamer has a stable structure, is easy to synthesize, is easy to modify, and has a wide range of application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of screening and application of nucleic acid aptamers, and specifically relates to a nucleic acid aptamer of a broad-spectrum pyrrolizidine alkaloid, a screening method and an application thereof. Background Art

[0002] Pyrrolizidine alkaloids (PAs) are a class of natural product toxins that are widely distributed and highly toxic. They are widely distributed in more than 6,000 flowering plants around the world. A large number of PAs are also often found in foods (such as grains, herbal teas, spices, honey, milk, etc.), Chinese herbal medicines (such as Senecio, Lithospermum officinale, Coltsfoot, Notoginseng), and pharmaceutical preparations (Children's Feireping Capsules, Chuanbei Xueli Paste, Safflower Tablets / Granules, etc.). About 50% of the more than 600 PAs with different structures discovered so far can cause severe hepatotoxicity. This type of hepatotoxic PAs is also called hepatotoxic pyrrolizidine alkaloids (HPAs). The toxicity of HPAs mainly comes from the metabolic pyrroles produced by their metabolism in the body. Metabolic pyrroles have strong electrophilicity and can quickly bind to nucleophilic enzymes, proteins, DNA and RNA in tissues, thereby causing damage to the body. In addition, HPAs also have strong lung toxicity, carcinogenicity, neurotoxicity and genotoxicity. Since there is no good antidote for HPAs, the international practice is to strictly control the intake of HPAs. Therefore, quickly identifying drugs or food products containing HPAs and issuing early warnings are effective measures to avoid HPAs poisoning incidents.

[0003] The systematic evolution of ligands by exponential enrichment (SELEX) technology is a new in vitro screening technology that can screen nucleic acid aptamers that bind to target substances with high affinity and specificity from random oligonucleotide sequence libraries. The target molecules screened by this technology are wide-ranging, including metal ions, small molecules, proteins, cells, microorganisms and other substances. The technology screens single-stranded nucleic acids, which have a smaller molecular weight than antibodies and a shorter screening cycle. The screened nucleic acid aptamers can be synthesized in vitro, are easy to modify and label, and have high stability.

[0004] Capture-SELEX technology fixes the oligonucleotide library on a matrix instead of fixing the target substance. This method can avoid the problem that small molecules are difficult to couple with solid carriers due to the lack of functional groups, and there are fewer exposed binding sites after coupling, resulting in low screening efficiency, thereby improving screening efficiency. This method has been successfully applied to the screening of a variety of small molecule targets.

[0005] The main steps of traditional SELEX technology are: 1. Fixation: fix the target substance or DNA library on a solid matrix; 2. Binding: bind the DNA library and the target; 3. Separation: separate the DNA sequence bound to the target by physical or chemical methods; 4. Elution: elute the DNA bound to the target from the unbound DNA library; 5. Amplification: amplify the DNA bound to the target by polymerase chain reaction (PCR) for subsequent screening or sequencing. 6. Sequencing: perform high-throughput sequencing on the screened aptamer library to obtain specific aptamer sequences; Traditional SELEX technology usually fixes the target on a solid matrix, but small molecules are difficult to couple with solid carriers due to the lack of functional groups, and there are fewer exposed binding sites after coupling, resulting in low screening efficiency. Therefore, there is an urgent need for a broad-spectrum recognition of pyrrolizidine alkaloid aptamers and screening methods that can screen multiple candidate aptamers and lay the foundation for the subsequent detection of traditional Chinese medicines containing HPAs and products that may contain HPAs. Summary of the invention

[0006] In view of the defects of the prior art, the present invention provides a method for screening nucleic acid aptamers of broad-spectrum pyrrolizidine alkaloids, comprising the following steps:

[0007] S1: hybridize and anneal the random ssDNA library and cDNA-bio, incubate and cool; place streptavidin agarose beads in a chromatographic column, and clean and balance the environment in the column; mix the random ssDNA library with streptavidin agarose beads to fix the random ssDNA, repeat elution, and collect eluent A; continue elution, and collect eluent B of the last elution;

[0008] S2: prepare a target solution and a reverse screening target solution, elute the reverse screening target solution through the S1 chromatographic column, collect the eluent D, then elute the target solution, collect the eluent C; wash after the elution, collect the eluent E of the last elution, and perform ultrafiltration centrifugation and concentration; perform polyacrylamide gel electrophoresis on the eluents A, B, C, D, and E to obtain the polyacrylamide gel electrophoresis results;

[0009] S3: Use PCR to amplify all DNA in the eluate C in S2, then wash the PCR product with a chromatographic column containing streptavidin agarose beads, elute with alkali to obtain a ssDNA eluate, concentrate by centrifugation to obtain a ssDNA library, and use ultra-trace nucleic acid protein detection to obtain the concentration of the ssDNA library;

[0010] S4: Perform high-throughput sequencing on the ssDNA library obtained in S3 to determine the nucleic acid aptamer sequence.

[0011] Furthermore, the incubation temperature in S1 is 95° C. and the incubation time is 10 min.

[0012] Furthermore, the molar ratio of ssDNA library to cDNA-bio in S1 was 1:5.

[0013] Furthermore, the ultrafiltration centrifuge tube used in the centrifugation process in S2 is 3 kilodaltons.

[0014] Furthermore, the specific concentrations in the PCR amplification process described in S3 are as follows: PCR Mix is ​​1X, the forward primer is 1 μM, and the reverse primer labeled with biotin at the 5' end is 1 μM.

[0015] A nucleic acid aptamer, wherein the nucleic acid aptamer sequence is S-SEN24.1, S-SEN24.2, S-SEN24.3, S-SEN24.4.

[0016] An application of a nucleic acid aptamer, wherein the nucleic acid aptamer is used in detecting pyrrolizidine base.

[0017] Technical Effects

[0018] The present invention obtains broad-spectrum pyrrolizidine alkaloid ssDNA aptamers S-SEN24.1, S-SEN24.2, S-SEN24.3, and S-SEN24.4 for the first time through the Capture-SELEX technology, and it is verified that the four aptamers have high affinity with a variety of pyrrolizidine alkaloids. The aptamer has a stable structure, is easy to synthesize, and is easy to modify, laying a foundation for subsequent methods for detecting pyrrolizidine alkaloids in related traditional Chinese medicines, pharmaceutical preparations, foods, etc., and preventing and reducing the occurrence of poisoning incidents by monitoring the concentration of pyrrolizidine bases, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is a schematic diagram of the Capture-SELEX technology process of the present invention;

[0020] Figure 2 The data graph of the polyacrylamide gel electrophoresis monitoring of the affinity and specificity (D) of the 21st round ssDNA library to senecioine (A), monocrotaline (B), and senecinecioine (C) of the present invention;

[0021] Figure 3 The data graph of the polyacrylamide gel electrophoresis monitoring of the affinity and specificity (D) of the 22nd round ssDNA library to senecioine (A), monocrotaline (B), and sedumine (C) of the present invention;

[0022] Figure 4The data graph of the polyacrylamide gel electrophoresis monitoring of the affinity and specificity (D) of the 23rd round ssDNA library to senecioine (A), monocrotaline (B), and senegiline (C) of the present invention;

[0023] Figure 5 The data graph of the affinity and specificity (D) of the 24th round ssDNA library to senecioine (A), monocrotaline (B), and sedumine (C) monitored by polyacrylamide gel electrophoresis of the present invention;

[0024] Figure 6 Schematic diagram of the secondary structure of nucleic acid aptamers S-SEN24.1, S-SEN24.2, S-SEN24.3, and S-SEN24.4 of the present invention;

[0025] Figure 7 This is a dissociation constant curve of S-SEN24.1 nucleic acid aptamer to senecioine and sedumine measured by ITC of the present invention;

[0026] Figure 8 The dissociation constant curve of S-SEN24.2 nucleic acid aptamer to senecioine, senecairine and monocrotaline measured by ITC of the present invention;

[0027] Fig. 9 The dissociation constant curve of S-SEN24.3 nucleic acid aptamer to senecioine, senecairine and monocrotaline measured by ITC of the present invention;

[0028] Fig.10 This is a dissociation constant curve diagram of the S-SEN24.4 nucleic acid aptamer to senecioine, senecairine and monocrotaline measured by ITC according to the present invention. DETAILED DESCRIPTION

[0029] The following will be combined with Example 1 of the present invention and the attached Figures 1 to 10 , the technical solution of the present invention is clearly and completely described. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] Combination Figure 1The Capture-SELEX technical process diagram and the ssDNA library sequence used in the screening of nucleic acid aptamers can be seen: the two sides are 43 bases, which are the primer binding regions; the middle is a 30-random nucleotide region: 5-CGAGCATAGGCAGAACTTACGAC-(N30)-GTCGTAAGAGCGAGTCATTC-3', where N represents any one of A, T, C, and G.

[0031] cDNA-bio: 5'-TTTTTGTCGTAAGTTCTGCCATTTT-Biotin-3';

[0032] Forward Primer (FP): 5'-CGAGCATAGGCAGAACTTAC-3';

[0033] Reverse Primer-bio (RP-bio):

[0034] 5'-Biotin-GAATGACTCGCTCTTACGAC-3'.

[0035] Example 1

[0036] S1: First, the random ssDNA library is configured. The random ssDNA library and cDNA-bio are in a molar ratio of 1:5. In the first round of screening, 1000 pmol of ssDNA library is used. In the 2nd to 4th rounds, all DNA obtained from the previous round of screening is used. From the fifth round, the amount of ssDNA library is controlled. Then, streptavidin agarose beads are added to the chromatographic column, and the agarose beads are washed with 1X SELEX bufferⅠ after standing. The ssDNA library-cDNA mixture is used to bind to streptavidin agarose. In order to fix the ssDNA library to the greatest extent, the mixture is repeatedly added for 4 times, and the eluate of the last elution (eluate A) is collected. Finally, 1X SELEX bufferⅠ is used for elution to wash away the unbound library ssDNA, and the eluate of the last elution (eluate B) is collected.

[0037] S2: Target screening and separation were then performed, and senecioine was added to the streptavidin agarose beads to which the ssDNA library had been fixed, 250 μL each time, for a total of 3 times, to obtain the eluate (eluate C); from the second round onwards, counter-screening target molecules were added, of which hyperoside, shikonin, and chlorogenic acid were group 1, quinine and berberine hydrochloride were group 2, and caffeine and matrine were group 3; before eluting with the target, the above three groups of counter-screening target molecules were first used for elution to remove non-specifically bound DNA, 250 μL each time, for a total of 3 times, and the eluate (eluate D) was collected. After each counter-screening target molecule screening, the agarose beads were washed with 1X SELEX bufferⅠ, and the eluate (eluate E) of the last wash was collected; eluates A, B, C, D, and E were taken for polyacrylamide gel electrophoresis, and the band profiles on the polyacrylamide result map were analyzed to monitor the enrichment of specific ssDNA during the screening process, and to determine whether the counter-screening target molecule and the concentration and elution times of the target should be adjusted;

[0038] S3: Then the library is amplified and ssDNA is recovered. The three eluates of the target molecule are concentrated using a 3 kilodalton ultrafiltration concentrator. After concentration, all DNA is amplified by PCR. The specific final concentration of PCR is: PCR Mix 1X, FP1μM, RP-bio 1μM, where FP is the forward primer and RP-bio is the reverse primer modified with biotin at the 5' end. The specific conditions for PCR amplification are as follows: initial denaturation at 95°C for 2 min; 11-17 cycles at 95°C for 15 s; 58°C for 30 s; 72°C for 45 s; and finally at 72°C for 5 min; stored at 12°C, and the number of cycles was monitored by agarose gel electrophoresis; the PCR product was combined with streptavidin agarose, washed with 1X SELEX bufferⅡ, and then 300 μL of 0.2 M sodium hydroxide was added, ssDNA was separated with alkali, and then concentrated using a 3 kilodalton ultrafiltration concentrator, and then the ssDNA library concentration was determined using an ultra-micro nucleic acid protein detector for use in the next round of screening or high-throughput sequencing, and stored at -20°C for future use;

[0039] The gel elution affinity and specificity of the aptamers were monitored. The aptamer libraries obtained from the 9th, 13th, 17th, 19th, 21st, 22nd, 23rd and 24th rounds of screening were amplified by PCR. The ssDNA libraries were purified by agarose gel electrophoresis. After the ssDNA was recovered, the gel elution affinity experiment was performed to monitor its affinity and specificity with pyrrolizidine alkaloids.

[0040] Gel elution affinity experiments specifically include:

[0041] First, the DNA library was fixed and packaged. The hybridized aptamer library and cDNA-bio mixture (molar ratio of 1:5) were added to the streptavidin agarose beads, rotated and incubated for 30 minutes, and the agarose beads were washed with 1X SELEX bufferⅠ (containing 0.01% Tween-20 reagent) 5 times the volume of each streptavidin agarose bead. After standing, the supernatant was aspirated and discarded. Finally, 5 times the above buffer was added, and 100 μL of agarose beads fixed with DNA library were taken into the PCR tube, and the supernatant was discarded after standing;

[0042] Secondly, target elution was performed, and 7 concentration gradients of senecithin, senecithin, and monocrotaline solutions (0, 10, 25, 50, 100, 250, 500 μM) and 500 μM solutions of hyperoside, shikonin, chlorogenic acid, quinine, berberine hydrochloride, caffeine, and matrine were prepared. 50 μL of each solution was added to the PCR tube in step (1), and the mixture was rotated and incubated for 1 hour, and then allowed to stand. 40 μL of the supernatant (sample solution G) was taken respectively;

[0043] Finally, 50 μL of 98% formamide solution was added to the ssDNA library-agarose bead conjugate, mixed and incubated at 90°C for 10 min, and then allowed to stand to take the supernatant (sample solution F); sample solution F and sample solution G were respectively subjected to polyacrylamide gel electrophoresis, and the affinity was calculated by monitoring the band profile;

[0044] S4: Combination Figure 2-Figure 5 , the aptamer library of rounds 21-24 was selected for high-throughput sequencing based on the results of polyacrylamide gel electrophoresis; based on the sequencing results, the sequences with the highest abundance were selected as candidate aptamers, and secondary structure prediction was performed using the NUPACK website. After obtaining the entire sequence, the library contained forward primer and reverse primer regions as capture regions, which were considered unnecessary for aptamer sensors. SEN24.1-SEN24.4 is the complete full sequence, and S-SEN24.1-24.4 is obtained by trimming the forward primer and reverse primer regions (retaining the 8 bases next to the random region, the secondary structure is as follows Figure 6 ), F-SEN24.1-24.4 are aptamers used for 6-FAM / BHQ-1 fluorescence analysis. The sequences of all aptamers are from 5' to 3', and the results of nucleic acid aptamers are as follows:

[0045] SEN24.1:CGAGCATAGGCAGAACTTACGACGGCATGCTGGTCGGGTAG GGAATTTTGGGCAGTCGTAAGAGCGAGTCATTC;

[0046] SEN24.2:CGAGCATAGGCAGAACTTACGGCTGGGTTTGGTGTCCTTCG TGGTGAGGGTTAGTCGTAAGAGCGAGTCATTC;

[0047] SEN24.3:CGAGCATAGGCAGAACTTACGACGGGACGGTATGTGTACCT AGTGGAACTGAAGTCGTAAGAGCGAGTCATTC;

[0048] SEN24.4:CGAGCATAGGCAGAACTTACGAACACAGCGCGGTAGGGTG GGTGGTTCATGGGGTCGTAAGAGCGAGTCATTC;

[0049] S-SEN24.1:CTTACGACGGCATGCTGGTCGGGTAGGGAATTTTGGGCAG TCGTAAG;

[0050] S-SEN24.2:

[0051] CTTACGGCTGGGTTTGGTGTCCTTCGTGGTGAGGGTTAGTCGTAAG;

[0052] S-SEN24.3:CTTACGACGGGACGGTATGTGTACCTAGTGGAACTGAAGT CGTAAG;

[0053] S-SEN24.4:CTTACGAACACAGCGCGGTAGGGTGGGTGGTTCATGGGGT CGTAAG;

[0054] F-SEN24.1:6-FAM-GGCAGAACTTACGACGGCATGCTGGTCGGGTAGGGAATTTTGGGCAGTCGTAAG;

[0055] F-SEN24.2:6-FAM-GGCAGAACTTACGGCTGGGTTTGGTGTCCTTCGTGGTGAGGGTTAGTCGTAAG;

[0056] F-SEN24.3:6-FAM-GGCAGAACTTACGACGGGACGGTATGTGTACCTAGTGGAACTGAAGTCGTAAG;

[0057] F-SEN24.4:Cy3-GGCAGAACTTACGAACACAGCGCGGTAGGGTGGTG GTTCATGGGGTCGTAAG.

[0058] For the affinity verification of nucleic acid aptamers and pyrrolizidine alkaloids, in order to further verify the affinity and specificity of nucleic acid aptamers for pyrrolizidine alkaloids, isothermal titration calorimetry (ITC) was used to detect the dissociation constant of the aptamer, and the aptamer sequences S-SEN24.1, S-SEN24.2, S-SEN24.3, and S-SEN24.4 were chemically synthesized, and their dissociation constants for the target substances were determined using an isothermal titration calorimeter.

[0059] The determination method is as follows:

[0060] First, prepare the solution. Use 1X SELEX bufferⅠ as solvent to prepare 500μM aptamer solution, heat at 95℃ for 10min, and then immediately put it on ice to cool for 5min. Use 1X SELEX bufferⅠ as solvent to prepare 1mM solutions of senecioine, senegal, and monocrotaline.

[0061] Secondly, the detection conditions were as follows: the assay was performed at 25 °C, and the target substance was titrated with the aptamer, 2.5 μL each time, with an interval of 200 s, for a total of 20 drops;

[0062] Next, data processing was performed, and the measurement results were fitted using the data processing software Origin. Nonlinear fitting was used to calculate the dissociation constant value of the aptamer according to the HILL1 formula;

[0063] Finally, the result is as follows Figure 7 to Figure 10 As shown, the obtained four nucleic acid aptamers have different affinities for senecine, sedumine and monocrotaline. The affinities of S-SEN24.1 for senecine and sedumine are 1.44μM and 14.7μM, respectively, and the affinity for monocrotaline is not obvious; the affinities of S-SEN24.2 for senecine, sedumine and monocrotaline are 1.59μM, 86.9μM and 46.3μM, respectively; the affinities of S-SEN24.3 for senecine, sedumine and monocrotaline are 2.03μM, 3.9μM and 9.94μM, respectively; the affinities of S-SEN24.4 for senecine, sedumine and monocrotaline are 14.9μM, 23.9μM and 9.45μM, respectively.

[0064] The present invention provides a broad-spectrum pyrrolizidine alkaloid nucleic acid aptamer. It has been verified that the aptamer has a high affinity with a variety of pyrrolizidine alkaloids and has structural stability and synthetic convenience. These aptamers can be used to construct a high-throughput screening platform, which lays a foundation for rapid identification and quantitative analysis of the content of pyrrolizidine alkaloids in traditional Chinese medicines, pharmaceutical preparations and foods. It can also broaden the application and be applied to the food industry to ensure that the content of pyrrolizidine alkaloids in food is controlled within a safe range, protect consumer health and reduce the occurrence of poisoning.

Claims

1. A broad-spectrum pyrrolizidine alkaloid nucleic acid aptamer, characterized in that: The sequence of the nucleic acid aptamer is S-SEN24.1, S-SEN24.2, S-SEN24.3, or S-SEN24.4, S-SEN24.1: 5'-CTTACGACGGCATGCTGGTCGGGTAGGGAATTTTGGGCAGTCGTAAG-3'; S-SEN24.2: 5'-CTTACGGCTGGGTTTGGTGTCCTTCGTGGTGAGGGTTAGTCGTAAG-3'; S-SEN24.3: 5'-CTTACGACGGGACGGTATGTGTACCTAGTGGAACTGAAGTCGTAAG-3'; S-SEN24.4: 5'-CTTACGAACACAGCGCGGTAGGGTGGGTGGTTCATGGGGTCGTAAG-3'.

2. The nucleic acid aptamer according to claim 1, characterized in that The nucleic acid aptamer is used for detecting pyrrolizidine alkaloids.

Images