A PCR amplification method and kit thereof

Abstract

The present invention provides a PCR amplification method and a kit thereof. In the method, when preparing a PCR amplification reaction system, a salt containing metal ions is premixed with a DNA polymerase solution used for PCR amplification, so that the metal ions bind to the DNA polymerase, occupy the binding site of magnesium ions and the DNA polymerase, block the polymerization activity of the DNA polymerase, and add magnesium ions to compete for binding to the DNA polymerase during PCR amplification. The present invention provides a new method for improving the specific amplification of DNA polymerase. Compared with the prior art, the method is simple and low in cost.

Description

Technical Field

[0001] The present invention relates to the field of nucleic acid amplification, and in particular to a PCR amplification method and a kit thereof. Background Art

[0002] The polymerase chain reaction (PCR) technology was born in the mid-1980s. It was proposed by Kary Mullis in the United States in 1985 and quickly developed into a rapid and highly sensitive method for in vitro analysis of nucleic acids. It is one of the most important technological inventions in the field of molecular biology. 2+ ), specific primers, and templates, DNA polymerase completes the process of amplifying the specified DNA fragment in vitro in a suitable buffer, that is, specifically amplifying and enriching specific nucleic acid fragments through enzymatic reactions.

[0003] The general PCR reaction procedure includes the steps of pre-denaturation-denaturation-annealing-extension (sometimes annealing and extension can be combined), and the reaction temperature is above 55°C. Therefore, heat-resistant DNA polymerase is the core component of the PCR reaction system, and its performance determines the sensitivity, specificity and amplification success rate of PCR detection.

[0004] All thermostable DNA polymerases discovered so far belong to group A or group B. Group A comes from true bacteria, such as Taq (Thermusaquaticus), Tth (Thermus themmophilus), Tfl (Thermus flavus), and Tfi (Thermusfilfomis). Group B thermostable DNA polymerases come from archaea, including Pfu (Prococcus furiosus), KOD (Thermococcus kodakaraensis), and Tgo (Thermococcus gorgonarius). Thermoresistant DNA polymerase is most active at higher temperatures, but the polymerization activity of DNA polymerase still exists at lower temperatures. This will result in primer mismatches or non-specific pairing of primers and templates in the initial stage of the PCR reaction, as the amount of primers is much higher than the amount of template. During the heating process of the instrument, primers are extended under the action of DNA polymerase to form primer dimers and non-specific products. These non-specific products can be used as templates to continue amplification in the PCR cycle. The continuous amplification and accumulation of non-specific products will seriously interfere with the amplification of the target fragment, resulting in low amplification efficiency of the target product or even failure to amplify it.

[0005] To solve the above problems, the existing technology modifies DNA polymerase by wax isolation, gene mutation, chemical modification, antibody modification, nucleic acid aptamer or covalent bond binding, that is, inhibiting or reducing the activity of DNA polymerase under low temperature conditions, thereby overcoming the shortcomings of the original DNA polymerase. Among them, the use of hot-start DNA polymerase for amplification is the main method to improve the specificity of PCR amplification and enhance the sensitivity of amplification. At low temperatures (generally below 55°C), antibodies specifically bind to DNA polymerase and block its activity; at high temperatures, antibodies and enzymes undergo irreversible dissociation, releasing the activity. The activity of DNA polymerase at room temperature is blocked by DNA polymerase antibodies, thereby avoiding nonspecific amplification caused by primer mismatch and improving amplification specificity.

[0006] However, the binding of antibodies and enzymes is easily affected by the environment, and ineffective blocking may occur easily. In addition, there are many types of DNA polymerase mutants, and it is difficult to find antibodies that are suitable and can effectively block. At the same time, antibody production requires a series of processes such as animal immunization, breeding, protein extraction and purification, which has a long cycle and high cost, resulting in increased PCR reaction costs.

[0007] In PCR amplification, magnesium ions (Mg 2+ ) as a cofactor for DNA polymerase activity, helping DNA polymerase bind to dNTP. Magnesium ions (Mg) at the enzyme active site 2+ ) can catalyze the formation of a phosphodiester bond between the 3′-OH of the primer and the phosphate group of the dNTP. In addition, Mg 2+ It can stabilize the negative charge on the phosphate backbone, thereby promoting the formation of a complex between the primer and the DNA template, helping the DNA polymerase to bind, thereby promoting the polymerization activity of the DNA polymerase. 2+ ), or DNA polymerase with magnesium ions (Mg 2+ ) cannot combine and polymerization reaction will not occur.

[0008] Chelating agents, also known as metal blocking agents, water softeners, etc., are ligands with two or more electron-donating atoms in their structures. Chelating agents are roughly divided into: complex metal chelating agents (ethylenediaminetetraacetic acid (EDTA), ethylene glycol tetraacetic acid (EGTA), aminotriacetic acid (also known as nitrilotriacetic acid NTA), diethylenetriaminepentaacetic acid (DTPA), citric acid (CA), tartaric acid (TA) and gluconic acid (GA), etc.), organic polyphosphonic acid and inorganic polyphosphate. Chelating agents have a sequential chelation of metal ions. Any reaction between metal ions and chelating agents to form chelates is a displacement reaction, that is, the surrounding water molecules coordinated with the metal ions are replaced by the chelating agent. The stability constant of the chelate is the main basis for determining the order of the chelation reaction. In a solution containing only one chelating agent but multiple metal ions, the chelation reaction usually occurs preferentially between the chelating agent and the metal ion with a large chelate stability constant. If a chelating agent with a larger stability constant is added to a solution that already contains a metal chelate, the metal ions will be displaced. Conversely, if the stability constant of the newly added chelating agent is smaller than that of the original chelating agent, the displacement reaction will not occur. Summary of the invention

[0009] In order to solve the above technical problems, the present invention provides a PCR amplification method. When preparing a PCR amplification reaction system, a salt containing metal ions is first premixed with a DNA polymerase solution used for PCR amplification, so that the metal ions bind to the DNA polymerase, occupy the binding site of the magnesium ions and the DNA polymerase, and block the polymerization activity of the DNA polymerase. During PCR amplification, magnesium ions are added to compete for binding to the DNA polymerase, thereby restoring the activity of the DNA polymerase for PCR amplification; the order in which the metal ions bind to the DNA polymerase is lower than the order in which the magnesium ions bind to the DNA polymerase.

[0010] In one embodiment, the metal ion is at least one of copper ion, zinc ion, nickel ion, calcium ion, manganese ion, cobalt ion, iron ion or ferrous ion, and / or the DNA polymerase is at least one of Taq DNA polymerase, Tth DNA polymerase, Tfl DNA polymerase, Tfi DNA polymerase, pfu DNA polymerase, KOD DNA polymerase or Tgo DNA polymerase.

[0011] In one embodiment, the DNA polymerase and the metal ions are mixed in a reaction ratio of: 10 U / μL DNA polymerase: 50 mM to 300 mM gold ions.

[0012] In one embodiment, the DNA polymerase is Taq DNA polymerase, the metal ion is calcium ion, and the ratio of the DNA Taq DNA polymerase to the calcium ion is 10 U / μL:80-100 mM.

[0013] In one embodiment, the molar ratio of the calcium ions to the magnesium ions is no greater than 1:1.

[0014] In one embodiment, the molar ratio of the calcium ions to the magnesium ions is 1:1-1:2.

[0015] In one embodiment, a metal chelator is also added during PCR amplification, and the order in which the chelator chelates with the metal ions is superior to the order in which the chelator chelates with the magnesium ions.

[0016] In one embodiment, the chelating agent is at least one of ethylenediaminetetraacetic acid, ethylene glycol tetraacetic acid, aminotriacetic acid, diethylenetriaminepentaacetic acid, citric acid, tartaric acid, gluconic acid, organic polyphosphonic acid, and inorganic polyphosphate.

[0017] In one embodiment, the metal ion is a calcium ion, the chelating agent is EGTA, and the molar ratio of the calcium ion to the chelating agent is no greater than 1:2.5.

[0018] In one embodiment, the molar ratio of the calcium ion to the chelating agent is 1:1-1:1.5.

[0019] In one embodiment, the present invention provides a PCR amplification kit for use in the above method.

[0020] In the present invention, the mixed reaction ratio of DNA polymerase and metal ions can be any one of the following: 10 U / μL: 50 mM, 10 U / μL: 80 mM, 10 U / μL: 100 mM, 10 U / μL: 150 mM, 10 U / μL: 250 mM, 10 U / μL: 300 mM; magnesium ions (Mg 2+ ) The source is selected from one of magnesium chloride, magnesium sulfate, and magnesium acetate, and the dosage is one of 5 mM, 10 mM, 20 mM, 30 mM, and 40 mM.

[0021] Premix the metal salt with DNA polymerase in a certain ratio to occupy magnesium ions (Mg 2+ ) and the binding site of DNA polymerase, blocking its polymerization activity and inhibiting its amplification under low temperature conditions. Metal ion chelators are added to the PCR reaction buffer. During the PCR amplification cycle, the metal ion chelators chelate other metal ions bound to the DNA polymerase to deblock and achieve specific amplification of the template.

[0022] The present invention proposes that the chelating agent for chelating metal ions added during PCR amplification contains at least one of the following: complex metal chelating agents (ethylenediaminetetraacetic acid (EDTA), ethylene glycol tetraacetic acid (EGTA), aminotriacetic acid (also known as nitrilotriacetic acid NTA), diethylenetriaminepentaacetic acid (DTPA), citric acid (CA), tartaric acid (TA) and gluconic acid (GA), etc.), organic polyphosphonic acid and inorganic polyphosphate. The ratio of metal salt to chelating agent is one of 1:1, 1:1.5, 1:2, 1:2.5, 1:3 and 1:4.

[0023] In the present invention, the magnesium ion (Mg 2+ ) can only exert the polymerization activity of DNA polymerase by binding to DNA polymerase, as well as the sequential chelation of different metal ions by chelators, in order to find a low-cost and easy-to-use method to improve the specific amplification of DNA polymerase, so as to improve the specificity and sensitivity of PCR reactions.

[0024] The present invention provides a new method for improving the specific amplification of DNA polymerase. Compared with the prior art, the method is simple and low in cost. The polymerization activity of DNA polymerase can be blocked by premixing metal salt with DNA polymerase in a certain ratio. During PCR amplification, a certain amount of magnesium ions (Mg 2+ ) compete with DNA polymerase to block, or use chelating agents to chelate metal ions used to block polymerization activity to block, so that specific amplification occurs and the probability of nonspecific amplification is reduced. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0026] Figure 1 After the CaCl2 used in the present invention is premixed with Taq DNA polymerase, during PCR amplification, Mg 2+ The result of amplification after competitive binding to Taq DNA polymerase. The control group Taq sample is Taq DNA polymerase directly added into the system for PCR amplification. The experimental groups Taq-Ca1, Taq-Ca2, Taq-Ca3, Taq-Ca4, and Taq-Ca5 samples are Taq DNA polymerase incubated with CaCl2 to block the activity of Mg 2+ Remove the block and proceed with PCR amplification;

[0027] Figure 2 After the CaCl2 used in the present invention was premixed with Taq DNA polymerase, different concentrations of Mg were added during PCR amplification. 2+ The result of amplification after competitive binding to Taq DNA polymerase. The control group Taq sample is Taq DNA polymerase directly added to the system for PCR amplification, and the experimental group Taq-Ca1 + different concentrations of MgCl2 samples are Taq DNA polymerase and CaCl2 incubated to block the activity with different concentrations of Mg 2+ PCR amplification was performed after removing the block;

[0028] Figure 3 After the CaCl2 used in the present invention is premixed with Taq DNA polymerase, EGTA is added to chelate Ca during PCR amplification. 2+ Schematic diagram of amplification after removal of blocking, in which the control group Taq samples are Taq DNA polymerase directly added to the system for PCR amplification, and the experimental group Taq-Ca1 + different concentrations of EGTA samples are Taq DNA polymerase and CaCl2 incubated to block the activity and then chelated by EGTA 2+ After removing the blocking layer, PCR amplification was performed. DETAILED DESCRIPTION

[0029] In order to make those skilled in the art better understand the technical solutions in the present application, the present invention will be further described below in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without making creative work should belong to the scope of protection of the present application. In the following embodiments, unless otherwise specified, they are all conventional methods in the art.

[0030] Example 1

[0031] After the Taq DNA polymerase polymerization activity is blocked by metal ions, magnesium ions (Mg 2+ ) competition to block and then amplify, set different Taq DNA polymerase and calcium ion (Ca 2+ ) Mixing ratio comparison test:

[0032] The PCR reaction system was prepared by mixing Taq DNA polymerase and calcium chloride at 25°C in a ratio of 10 U / μL:50 mM (referred to as Taq-Ca1), 10 U / μL:80 mM (referred to as Taq-Ca2), 10 U / μL:100 mM (referred to as Taq-Ca3), 10 U / μL:120 mM (referred to as Taq-Ca4), and 10 U / μL:150 mM (referred to as Taq-Ca5). The mixture was allowed to stand for 30 min and then the PCR reaction system was prepared. The reaction system formula is as follows:

[0033]

[0034] Select λDNA as the template:

[0035] Primer I: CCGTCTGGTTATCTGCATCA (SEQ ID No. 1);

[0036] Primer II: TCACGCAGAGCATCATTTTC (SEQ ID No. 2);

[0037] The PCR reaction conditions are as follows:

[0038]

[0039] The samples after the reaction were characterized by agarose electrophoresis. Figure 1 , Figure 1 The different concentrations of Ca 2+ After binding to Taq DNA polymerase, during PCR amplification, Mg 2+ The result of amplification after competitive binding to Taq DNA polymerase. The control group Taq sample is Taq DNA polymerase directly added to the system for PCR amplification, and the experimental group Taq-Ca1, Taq-Ca2, Taq-Ca3, Taq-Ca4, and Taq-Ca5 samples are Taq DNA polymerase and CaCl2 incubated to block active Mg 2+ After removing the blockade, PCR amplification was performed. It can be clearly seen in the figure that the experimental group achieved specific amplification, while the control group without blocking the polymerization activity had non-specific amplification. The ratio of Taq DNA polymerase and calcium ions was 10 U / μL:80-100mM, and the specificity was significantly better than that of other experimental groups. Within this range, no non-specific amplification appeared in the result graph, and the target band signal was strong. Although no non-specific amplification appeared in the results of 10U / μL:120 mM and 10 U / μL:150 mM, the target band signal was weak until it disappeared. At the same time, Taq-Ca3 had the best specificity and strong signal intensity, so Taq DNA polymerase and Ca 2+ The mixing ratio is preferably 10U / μL:100 mM.

[0040] Example 2

[0041] After the Taq DNA polymerase polymerization activity is blocked by metal ions, magnesium ions (Mg 2+ ) after competitive deblocking and amplification, setting different magnesium ions (Mg 2+ )Comparison test of adding amount:

[0042] Mix Taq DNA polymerase and calcium chloride at a ratio of 10 U / μL:100 mM (referred to as Taq-Ca1) at 25°C and let stand for 30 min before preparing the PCR reaction system. The reaction system formula is as follows:

[0043]

[0044] Select λDNA as the template:

[0045] Primer I: CCGTCTGGTTATCTGCATCA (SEQ ID No. 1);

[0046] Primer II: TCACGCAGAGCATCATTTTC (SEQ ID No. 2);

[0047] The PCR reaction conditions are as follows:

[0048]

[0049] The samples after the reaction were characterized by agarose electrophoresis. Figure 2 , Figure 2 The Ca 2+ After binding to TaqDNA polymerase, different concentrations of Mg 2+ The result of amplification after competitive binding to Taq DNA polymerase. The control group Taq sample is Taq DNA polymerase directly added to the system for PCR amplification, and the experimental group Taq-Ca3 + different concentrations of MgCl2 samples are Taq DNA polymerase and CaCl2 incubated to block the activity with different concentrations of Mg 2+ After removing the block, PCR amplification was performed. Samples 4 to 13 were added with 5 mM (4, 5), 10 mM (6, 7), 20 mM (8, 9), 30 mM (10, 11), and 40 mM (12, 13) MgCl2, respectively. It can be clearly seen from the figure that non-specific amplification occurred in the control group without blocking the polymerization activity. At the same time, the amplification effects were similar when the MgCl2 addition amount was 20 mM, 30 mM, and 40 mM, and the specificity was significantly better than 5 mM and 10 mM. The comprehensive specific product amount was better when the MgCl2 addition amount was 20 mM, so MgCl2 2+ The optimal addition amount is 20 mM. That is, the molar ratio of calcium ions to magnesium ions is not greater than 1:1. When the molar ratio of calcium ions to magnesium ions is 1:1-1:2, the target band signal is strong and no non-specific signal appears; and when it is below 1:1 (5 mM, 10 mM), although no non-specific signal appears, there is almost no target band signal.

[0050] Example 3

[0051] After metal ions block the polymerization activity of Taq DNA polymerase, metal chelators are used to chelate the metal ions to deblock and amplify:

[0052] Mix Taq DNA polymerase and calcium chloride at a ratio of 10 U / μL:100 mM at 25°C (referred to as Taq-Ca3), let stand for 30 min, and prepare the PCR reaction system. The reaction system formula is as follows:

[0053]

[0054] The template of the system was λDNA;

[0055] Primer I: CCGTCTGGTTATCTGCATCA (SEQ ID No. 1);

[0056] Primer II: TCACGCAGAGCATCATTTTC (SEQ ID No. 2);

[0057] The PCR reaction conditions are as follows:

[0058]

[0059] The samples after the reaction were characterized by agarose electrophoresis. Figure 3 , Figure 3 The Ca 2+ After binding with TaqDNA polymerase, EGTA is added to chelate Ca during PCR amplification. 2+ Schematic diagram of amplification after unblocking, where the control group Taq sample is Taq DNA polymerase directly added to the system for PCR amplification, and the experimental group Taq-Ca3+ different concentrations of EGTA samples are Taq DNA polymerase and CaCl2 incubated to block the activity and then unblocked with different concentrations of EGTA for PCR amplification. Samples 4 to 9 are added with 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, and 80 mM EGTA, respectively. It can be clearly seen that the experimental group partially achieved specific amplification, while the control group without blocking the polymerization activity had non-specific amplification. It can be seen from the figure that the molar ratio of calcium ions to the chelating agent EGTA is not greater than 1:2.5. If this ratio is exceeded, the non-specific signal is significantly enhanced. The molar ratio of calcium ions to the chelating agent EGTA is 1:1-1:1.5. Within this ratio range, non-specific amplification is significantly reduced. 2+ The optimal ratio with EGTA is 1:1.

[0060] It should be understood that the disclosed invention is not limited only to the specific method, scheme and material of description, because these all can change.It should also be understood that the terminology used herein is only for the purpose of describing specific embodiment scheme, rather than being intended to limit the scope of the present invention, and the scope of the present invention is only limited to the appended claims.

[0061] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are also intended to be encompassed by the appended claims.

Claims

1. A PCR amplification method, characterized in that: When preparing a PCR amplification reaction system, a salt containing metal ions is first premixed with a DNA polymerase solution used for PCR amplification, so that the metal ions bind to the DNA polymerase, occupy the binding site of the magnesium ions and the DNA polymerase, and block the polymerization activity of the DNA polymerase. During PCR amplification, magnesium ions are added to compete for binding to the DNA polymerase bound to the metal ions, thereby restoring the activity of the DNA polymerase for PCR amplification; the order of binding of the metal ions to the DNA polymerase is lower than the order of binding of the magnesium ions to the DNA polymerase; the DNA polymerase is Taq DNA polymerase, the metal ions are calcium ions, the ratio of the Taq DNA polymerase to the calcium ions is 10 U / μL:80-100 mM, and the molar ratio of the calcium ions to the magnesium ions is not greater than 1:

1.

2. The method according to claim 1, characterized in that The molar ratio of the calcium ions to the magnesium ions is 1:1-1:

2.

3. The method according to any one of claims 1-2, characterized in that: A metal chelator is also added during PCR amplification, and the order in which the chelator chelates with the calcium ion is superior to the order in which the chelator chelates with the magnesium ion.

4. The method according to claim 3, characterized in that: The metal ion is a calcium ion, the chelating agent is EGTA, and the molar ratio of the calcium ion to the chelating agent is not less than 1:2.

5.

5. The method according to claim 4, characterized in that: The molar ratio of the calcium ion to the chelating agent is 1:1-1:1.5.

Images