Engineering bacterium for improving yield of lipopeptide, construction method and application

Abstract

The invention discloses an engineering bacterium for improving the yield of lipopeptide and a construction method and application thereof, and the construction method comprises the following steps: eliminating endogenous plasmids of bacillus amyloliquefaciens to obtain an engineering bacterium 1 for improving the yield of lipopeptide; compared with the bacillus amyloliquefaciens without eliminating endogenous plasmids, the engineering bacterium 1 for improving the yield of lipopeptide, disclosed by the invention, has the advantages that cells can produce more lipopeptide substances such as surfactin, fengmycin and iturinA in a culture process.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to an engineering bacterium for increasing lipopeptide production, a construction method and an application thereof. Background Art

[0002] 80% of the losses caused by harmful organisms are caused by plant pathogenic fungi. Pesticides are an indispensable means of production for humans to obtain food and ensure agricultural stability and high yield. However, while pesticides have made great contributions to human civilization, due to the limitations of cognition, highly toxic and highly residual pesticides have also brought negative impacts on the environment on which humans depend for survival. With the progress of society and the improvement of civilization, people are required to live in harmony with nature, and people have also put forward higher requirements for pesticides. Therefore, the research and development of green pesticides with high efficiency, low toxicity, easy degradation, safety and good environmental compatibility has become the mainstream and direction of pesticide research today. The use of biological pesticides is considered to be the most promising, more reasonable and safe crop management method. Compared with traditional chemical pesticides, biological pesticides have the advantages of safety for humans, animals and non-target organisms, good environmental compatibility, not easy to produce resistance, easy to protect biodiversity, and a wide range of sources. Therefore, the development and application of high-efficiency biological pesticides are of great significance to human health, environmental protection and sustainable development of agriculture. Among them, Bacillus is a commonly used microorganism, 4% to 5% of the genes in its genome are related to the synthesis of antibiotics, and it has the potential to produce more than 20 antibacterial compounds with diverse structures. Among these antibacterial compounds, the surfactin, iturin and fengycin families in lipopeptides have recognized application potential in the fields of biotechnology and biopharmaceuticals due to their superior surface activity properties. At present, the research work on lipopeptides is mainly focused on the following aspects: 1) screening and transformation of high-yield strains; 2) improvement of fermentation culture methods; 3) optimization of culture conditions; 4) selection and application of cheap fermentation raw materials. For a long time, the problems of high by-product content, high cost and low yield have seriously restricted the microbial production and application of lipopeptides. There is an urgent need to construct genetically engineered strains for efficient synthesis of lipopeptide products. Summary of the invention

[0003] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an engineering bacterium for increasing the yield of lipopeptides.

[0004] The second object of the present invention is to provide a method for constructing an engineering bacterium for improving lipopeptide production.

[0005] The third object of the present invention is to provide a method for obtaining lipopeptides by fermenting engineered bacteria to increase the yield of lipopeptides.

[0006] The fourth object of the present invention is to provide another engineered bacterium for increasing the production of lipopeptides.

[0007] The fifth object of the present invention is to provide another method for constructing an engineered bacterium that improves lipopeptide production.

[0008] The sixth objective of the present invention is to provide another use of obtaining lipopeptides by fermentation of engineered bacteria for increasing the yield of lipopeptides.

[0009] The technical solution of the present invention is summarized as follows:

[0010] A method for constructing an engineering bacterium for improving lipopeptide production comprises the following steps: eliminating the endogenous plasmid of Bacillus amyloliquefaciens to obtain the engineering bacterium 1 for improving lipopeptide production.

[0011] The Bacillus amyloliquefaciens is preferably Bacillus amyloliquefaciens HM-618, with a deposit number of CGMCC No.7097.

[0012] The engineered bacteria 1 for improving lipopeptide production constructed by the above construction method.

[0013] The use of the above-mentioned engineered bacteria 1 for increasing lipopeptide production to obtain lipopeptides by fermentation.

[0014] Another method for constructing an engineered bacterium for increasing lipopeptide production comprises the following steps: knocking out the non-ribosomal peptide synthetase gene of surfactin and the non-ribosomal peptide synthetase gene of fengycin of Bacillus amyloliquefaciens; and then eliminating the endogenous plasmid to obtain an engineered bacterium 2 for increasing lipopeptide production.

[0015] The Bacillus amyloliquefaciens is preferably Bacillus amyloliquefaciens HM-618, with a deposit number of CGMCC No.7097.

[0016] The above-mentioned construction method constructs an engineered bacterium 2 for improving lipopeptide production.

[0017] The use of the above-mentioned engineered bacteria 2 for increasing lipopeptide production to obtain lipopeptides by fermentation.

[0018] Advantages of the present invention:

[0019] Compared with Bacillus amyloliquefaciens without eliminating endogenous plasmids, the engineered bacteria 1 for improving lipopeptide production of the present invention can produce more lipopeptide substances such as surfactin, fengycin and iturin A during the culture process.

[0020] The engineered bacteria 2 for improving lipopeptide production of the present invention can significantly improve the production of iturin A during the culture process. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the gel electrophoresis diagram of the knockout of the endogenous plasmid DNA of Bacillus amyloliquefaciens HM618 by colony PCR. M: marker; 1-10: negative control (Bacillus amyloliquefaciens HM618); 11-19: positive strain (HM618 strain with the endogenous plasmid plas1 eliminated)

[0022] Figure 2 It is a shake flask fermentation verification of Bacillus amyloliquefaciens HM618-N (engineered bacteria 1 for improving lipopeptide production).

[0023] Figure 3 This is a DNA gel electrophoresis diagram of the genome-identified knockout of the surfactin and fengycin non-ribosomal peptide synthetase gene clusters in Bacillus amyloliquefaciens HM618.

[0024] Figure 4 It is a shake flask fermentation verification of Bacillus amyloliquefaciens HM618-NDSF (engineered bacteria 2 for improving lipopeptide production). DETAILED DESCRIPTION

[0025] The technical scheme of the present invention is further described below in conjunction with specific examples. Unless otherwise specified, the technical means used in the present invention are methods known to those skilled in the art. In addition, the embodiments should be understood as illustrative rather than limiting the scope of the present invention, and the essence and scope of the present invention are limited only by the claims. For those skilled in the art, various changes or modifications to the material composition and dosage in these embodiments, without departing from the essence and scope of the present invention, also belong to the protection scope of the present invention.

[0026] The non-ribosomal peptide synthetase gene of surfactin (Bacillus amyloliquefaciens HM618, DKG78_02285, DKG78_02290, DKG78_02295, DKG78_02300).

[0027] Fengycin non-ribosomal peptide synthetase gene (Bacillus amyloliquefaciens HM618, gene number DKG78_10110, DKG78_10115, DKG78_10120, DKG78_10125, DKG78_10130)

[0028] Bacillus amyloliquefaciens HM-618, deposit number CGMCC No. 7097, was deposited in the General Microbiological Center of China National Committee for the Preservation and Administration of Microbiological Cultures on January 8, 2013, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. Other Bacillus amyloliquefaciens can also be used in the present invention.

[0029] The present invention will be described in more detail below through specific examples.

[0030] Example 1

[0031] Construction of CRISPR / Cas9 gene editing plasmid for Bacillus amyloliquefaciens 1. Using pJOE8999 as template, high-fidelity Takara Prime HS DNA Polymerase, two linear fragments frag 1 and frag 2 with BamH I site sequence eliminated were obtained by PCR amplification, and the primers were:

[0032] frag 1-F(SEQ ID NO.1):TTAACGTGAGTTTTCGTTCCACTGAGCGTCAG;

[0033] frag 1-R (SEQ ID NO.2):

[0034] AAGACTGGGACCCAAAAAAATATGGTGGTTTTTGATAGTCCAACG;

[0035] frag 2-F (SEQ ID NO.3):

[0036] TTTTTTTGGGTCCCAGTCTTTTTTACGAGCAATAAGCTTGTCCG;

[0037] frag 2-R (SEQ ID NO. 4):GGAACGAAAACTCACGTTAAGGGATTTTGGTCAT.

[0038] The PCR reaction system is shown in Table 1.

[0039] Table 1 HS enzyme PCR reaction system

[0040]

[0041] The PCR reaction program settings are shown in Table 2.

[0042] Table 2Hs enzyme PCR reaction program

[0043]

[0044] The amplified frag 1 and frag 2 fragments were recovered using the Cycle Pure Kit D6492 kit.

[0045] 2. Use the seamless cloning kit ClonExpressⅡOne Step Cloning Kit to recombinant the frag 1 and frag 2 fragments, and the homologous recombination ligation reaction system (Table 3) is placed in a 37°C water bath for 30 minutes, and then ice-bathed for 5 minutes. Then, the system is transformed into Escherichia coli DH5α competent cells by chemical transformation, positive transformants are screened, plasmid strains are preserved, and plasmids are extracted.

[0046] Table 3 Homologous recombination ligation reaction system

[0047]

[0048] The constructed plasmid vector is named pJOE8999a (SEQ ID NO.13), also known as the CRISPR / Cas9 gene editing plasmid suitable for Bacillus amyloliquefaciens. The plasmid can be used for gene editing of Bacillus amyloliquefaciens.

[0049] Example 2: Elimination of the endogenous plasmid Plas1 of Bacillus amyloliquefaciens HM-618, deposit number CGMCC No. 7097 (referred to as Bacillus amyloliquefaciens HM618) by gene editing

[0050] 1. Construction of a gene editing plasmid to knock out the endogenous plasmid Plas1 of Bacillus amyloliquefaciens HM618

[0051] The sequence information of the Red replication protein gene site of the endogenous plasmid of Bacillus amyloliquefaciens HM618 was determined in the gene database (NCBI), and the appropriate PAM sequence (5'-NGG-3') and the gene sequence of 20 bp upstream thereof were searched through CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ). The sequences of the single-stranded annealing fragments designed in this embodiment were Q-HMplas-20bp-S (SEQ ID NO.5):

[0052] TGAGTAAAATGTACCTACGCTTCAGCCCGAAGGCTTATGTTTTAGAGCTAGAAATA G; and Q-HMplas-20bp-A (SEQ ID NO. 6):

[0053] CTATTTCTAGCTCTAAAACATAAGCCTTCGGGCTGAAAGCGTAGGTACATTTTACTC A, the single-stranded annealed fragment was synthesized by Qingke Company, and the synthesized single-stranded fragment was annealed by PCR to form a double-stranded fragment. The above double-stranded fragment was connected with the pJOE8999a vector fragment linearized with Bsa I by homologous recombination, and transformed into Escherichia coli DH5α competent cells, positive clones were screened and plasmids were extracted. The extracted recombinant plasmid was named pJOE8999a-ΔP, and the plasmid was placed in a -20℃ refrigerator for standby use.

[0054] 2. Transform the pJOE8999a-ΔP plasmid into Bacillus amyloliquefaciens HM618

[0055] 2.1 Preparation of competent cells of Bacillus amyloliquefaciens HM618

[0056] Competent cells of Bacillus amyloliquefaciens HM618 were prepared by the Bacillus Spizizen chemical transformation method. First, a single colony of activated Bacillus amyloliquefaciens HM618 was obtained by three-zone streaking, and the single colony was inoculated into a test tube containing 5 mL of GMI medium in the first generation, and cultured at 37°C, 200 rpm for 12 h; then 500 μL of the first generation GMI culture solution was inoculated into a test tube containing 4.5 mL of GMI medium in the second generation, and cultured at 37°C, 200 rpm until OD 600 After the concentration was 3, 750 μL of the second-generation GM I culture solution was inoculated into a test tube containing 4.25 mL of GM II medium and cultured at 37°C, 200 rpm, for 1.5 h to obtain chemically competent cells of Bacillus amyloliquefaciens HM618.

[0057] Among them, the preparation of GMI and GMII culture medium:

[0058] 10×Spizizen basic salt solution: 12g / L sodium citrate, 183g / L K2HPO4, 60g / L KH2PO4, 20g / L (NH4)2SO4, the balance is water. (NH4)2SO4 must be prepared into a mother solution and sterilized by filtering with a 0.22μm sterile syringe filter, and the remaining ingredients are prepared into a mother solution and sterilized at 121℃ for 20min.

[0059] GMI medium (100 mL): 10 mL 10× Spizizen basic salt solution, 2 mL 2% casein hydrolyzate stock solution, 2 mL 5% yeast extract stock solution, 2 mL 40% glucose stock solution, 1 mL 0.5% L-tryptophan stock solution, 100 μL 20% MgSO4·7H2O stock solution, and finally add 82.9 mL sterile water.

[0060] GMⅡ medium (100mL): 10mL 10×Spizizen basic salt solution, 1mL 2% casein hydrolyzate mother solution, 2mL 40% glucose mother solution, 800μL 20% MgSO4·7H2O mother solution, and finally add 86.2mL sterile water.

[0061] 2.2 Transformation of pJOE8999a-ΔP into Bacillus amyloliquefaciens HM618 competent cells

[0062] Take 1mL GM II culture medium into a 1.5mL sterile EP tube, add 1000ng pJOE8999a-ΔP plasmid, and culture at 37℃, 200rpm for 3.5h. After the culture is completed, centrifuge at 6000rpm for 2min, keep 200μL culture medium, resuspend, and spread on LB solid plate containing 25μg / mL kanamycin, and culture at 30℃ until a single colony grows.

[0063] 3. Induced knockout of endogenous plasmid Plas1 in Bacillus amyloliquefaciens HM618

[0064] Inoculate the single colony in step 2.2 into a test tube containing LB medium containing 1% mannose and 25μg / mL kanamycin, culture at 37°C, 200rpm for 12h, and three-zone onto a non-antibiotic LB solid plate. After a single colony grows, perform PCR identification using identification primers. The identification primer sequences are: JD-Q-HMplas-F (SEQ ID NO.7): GTATGGTGAGCTGCTGAACTTTG and JD-Q-HMplas-R (SEQ ID NO.8): CACTCCGTGACCGCTCCTA. Use the 2×Taq PCR Master Mix system of Beijing Solebow Technology Co., Ltd. to prepare the reaction solution. The colony PCR reaction system and reaction procedure are shown in Tables 4 and 5. Screen the strains that cannot amplify the bands using the identification primers, that is, the Bacillus amyloliquefaciens strains that have knocked out the endogenous plasmid Plas1 but still contain pJOE8999a-ΔP. The PCR reaction identification results are shown in Figure 1 .

[0065] Table 4 Colony PCR reaction system

[0066]

[0067] Table 5 Colony PCR reaction procedure

[0068]

[0069] 4. Loss of the gene editing tool plasmid pJOE8999a-ΔP

[0070] The colony obtained in step 3 was inoculated into a 5 mL LB medium test tube, and cultured at 42° C., 200 rpm for 12 h. Single colonies were obtained by three-zone streaking. The single colonies were spotted onto an LB solid plate without antibiotics and an LB solid plate containing 25 μg / mL kanamycin, respectively, and cultured in a 30° C. incubator for 12 h. The colonies that grew on the solid plate without antibiotics and did not grow on the solid plate containing kanamycin were selected and inoculated into a 5 mL LB test tube medium. After culturing for 12 h, the bacteria were preserved to obtain the final Bacillus amyloliquefaciens that eliminated the endogenous plasmid Plas1, which was named Bacillus amyloliquefaciens HM618-N (i.e., engineered bacteria 1 for improving lipopeptide production).

[0071] Example 3: Bacillus amyloliquefaciens HM618-N shake flask fermentation verification

[0072] The method for producing lipopeptides by shake flask fermentation using the above-mentioned Bacillus amyloliquefaciens HM618-N engineered strain is as follows:

[0073] Seed activation culture: Take three zones of the strain stored at 80°C and inoculate them on LB solid plates for activation, and culture them at 37°C for 12 h.

[0074] Seed culture: Take a single activated colony and inoculate it into a 250 mL Erlenmeyer flask containing 20 mL of seed culture medium, and culture at 37 ° C and 200 rpm until OD 600 is 10.

[0075] Fermentation culture: Take 1 mL of seed liquid and inoculate it into a 250 mL baffled conical flask filled with fermentation medium, add 5 mL of 45% glucose mother solution (the final volume of fermentation liquid is 50 mL), culture at 30°C, 180 rpm, and the fermentation cycle is 72 h.

[0076] Seed culture medium: peptone 10g / L, yeast powder 5g / L, NaCl 10g / L, and the balance is water.

[0077] Fermentation medium: sodium glutamate 5g / L, MgSO4·7H2O 0.5g / L, KCl 0.5g / L, KH2PO4 0.5g / L, FeSO4 0.15×10-3 g / L,MnSO4 0.15×10 -3 g / L, peptone 12g / L, yeast powder 4g / L, glucose 45g / L, pH 6.8, and the balance is water.

[0078] After 72h of shake flask fermentation, Bacillus amyloliquefaciens HM618-N

[0079] The production of surfactin was 863.88 mg / L, which was 43 times higher than that of the control strain Bacillus myloliquefaciens HM618.

[0080] The production of fengycin was 349.86 mg / L, which was 17 times higher than that of the control strain Bacillus amyloliquefaciens HM618.

[0081] The production of iturin A was 614.75 mg / L, which was 54 times higher than that of the control strain Bacillusamyloliquefaciens HM618.

[0082] The yield of the three lipopeptides was 1828.49 mg / L, which was 35 times higher than that of the control strain Bacillus amyloliquefaciens HM618. Figure 2 .

[0083] Example 4: Knockout of the surfactin non-ribosomal peptide synthetase gene and the fengyogenin non-ribosomal peptide synthetase gene of Bacillus amyloliquefaciens HM618, and elimination of its endogenous plasmid.

[0084] First, the CRISPR / Cas9 method was used to knock out the non-ribosomal peptide synthetase genes of surfactin and fengycin in Bacillus amyloliquefaciens HM618. The designed genome identification primers were:

[0085] JD-Q-srf-F (SEQ ID NO.9): TGAGTCGTCTGTCGCTCCTAAA;

[0086] JD-Q-srf-R (SEQ ID NO.10): GCTTGAAATCGTTCCCCTGA;

[0087] JD-Q-fen-F (SEQ ID NO. 11): GGGGCCAGACCAAGTAGCA;

[0088] JD-Q-fen-R (SEQ ID NO. 12): TGACGGTTGAACGGGAGC;

[0089] The results of genome knockout validation are shown in Figure 3 A modified strain of Bacillus amyloliquefaciens HM618 with the genotype of Bacillus amyloliquefaciens HM618ΔsrfΔfen was constructed and named Bacillus amyloliquefaciens HM618-DSF.

[0090] The method used in Example 2 was used to knock out the endogenous plasmid of Bacillus amyloliquefaciens HM618-DSF to obtain the Bacillus amyloliquefaciens HM618-NDSF strain (ie, engineered strain 2 for improving lipopeptide production).

[0091] Example 5: Bacillus amyloliquefaciens HM618-NDSF shake flask fermentation verification

[0092] The culture method used in Example 3 was used to carry out synchronous control shake flask fermentation culture on Bacillus amyloliquefaciens HM618-DSF and Bacillus amyloliquefaciens HM618-NDSF, and the production of surfactin, fengycin and iturinA was measured. It was determined that Bacillus amyloliquefaciens HM618-NDSF could detect the synthesis of iturinA, with a production of 128.33 mg / L, while surfactin and fengycin could not be detected. The iturinA production of the control bacterium Bacillus amyloliquefaciens HM618-DSF was 3.29 mg / L, while surfactin and fengycin could not be detected. This indicates that the production of the lipopeptide iturinA can be increased in the Bacillus amyloliquefaciens HM618-DSF strain after the endogenous plasmid is eliminated. The results are shown in Table 2. Figure 4 .

[0093] Conclusion: The engineered bacteria 1 with improved lipopeptide production obtained by eliminating the endogenous plasmid had significantly increased production of lipopeptides such as surfactin, fengycin and iturin A after cultivation; the engineered bacteria 2 with improved lipopeptide production obtained by knocking out the non-ribosomal peptide synthetase genes of surfactin and fengycin and eliminating the endogenous plasmid at the same time had more single lipopeptide fermentation products and increased iturin A production after cultivation.

Claims

1. A method for constructing an engineered bacterium for increasing lipopeptide production, characterized in that The method comprises the following steps: eliminating the endogenous plasmid of Bacillus amyloliquefaciens to obtain an engineering bacterium 1 with improved lipopeptide production.

2. The construction method according to claim 1, characterized in that The Bacillus amyloliquefaciens is Bacillus amyloliquefaciens HM-618, with a preservation number of CGMCC No.7097.

3. An engineered bacterium 1 for improving lipopeptide production constructed by the construction method of claim 1 or 2.

4. Use of the engineered bacteria 1 for increasing lipopeptide production according to claim 3 to obtain lipopeptides by fermentation.

5. A method for constructing an engineered bacterium for increasing lipopeptide production, characterized in that The method comprises the following steps: knocking out the non-ribosomal peptide synthetase gene of surfactin and the non-ribosomal peptide synthetase gene of fengyrin of Bacillus amyloliquefaciens; and then eliminating the endogenous plasmid to obtain the engineering bacteria 2 with improved lipopeptide production.

6. The construction method according to claim 5, characterized in that The Bacillus amyloliquefaciens is Bacillus amyloliquefaciens HM-618, with a preservation number of CGMCC No.7097.

7. The engineered bacteria 2 for improving lipopeptide production constructed by the construction method of claim 5 or 6.

8. Use of the engineered bacteria 2 for increasing lipopeptide production according to claim 7 to obtain lipopeptides by fermentation.

Images