Application of E3 ubiquitin ligase RNF181 gene expression inhibitor in the preparation of drugs for preventing and / or treating HSV-1 virus infection

Abstract

The present invention relates to the use of an E3 ubiquitin ligase RNF181 gene expression inhibitor in the preparation of a drug for preventing and / or treating HSV-1 virus infection, and belongs to the field of gene technology. The inhibitor is a small interfering RNA; the small interfering RNA includes the following sequences: RNF181-siRNA-F: gacgagauaaggcucgaaatt; RNF181-siRNA-R: uuucgagccuuaucucguctt. The present invention has been found through research to determine the relationship between RNF181 and HSV-1 virus infection. Inhibiting RNF181 can inhibit the replication and expression of HSV-1, and overexpressing RNF181 can promote the replication and expression of HSV-1 virus, providing a target gene for the treatment of HSV-1 virus infection, and then the RNF181 gene can be used for the prevention or treatment of HSV-1 virus infection.

Description

Technical Field

[0001] The present invention belongs to the field of gene technology, and specifically relates to the application of an E3 ubiquitin ligase RNF181 gene expression inhibitor in the preparation of a drug for preventing and / or treating HSV-1 virus infection. Background Art

[0002] Herpes simplex virus type 1 (HSV-1) belongs to the family of Herpesviridae. It is an enveloped double-stranded DNA virus with a genome of approximately 152kb. The process of HSV-1 entering cells and infecting cells mainly includes cell adhesion, invasion, replication of viral nucleic acids and viral proteins, and the process of new virus packaging and exocytosis. According to the order of viral gene transcription activation, it can be divided into immediate-early genes (IE), early genes (E) and late genes (L), also known as α, β, and γ genes. The HSV-1 viral genome can express 75 proteins. The first to be expressed is the early viral gene, followed by the synthesis of late gene transcription activators, while the viral mid-gene synthesizes proteins responsible for DNA replication, and the late gene synthesizes structural proteins. HSV-1 is highly contagious and is mainly infected through contact with pathogens through the oral mucosa or ocular mucosa. After the infection is recovered, the virus will establish a latent infection in the human body, at which time the virus is still contagious. After HSV-1 infects the human body, there are three main stages: primary infection, latent infection, and recurrent infection. In recent years, the incidence and mortality rates have increased in newborns and immunodeficient infected patients. The current treatment for HSV-1 is acyclovir, etc., but due to its side effects and drug resistance caused by viral mutations, the treatment effect is not ideal and cannot completely eradicate HSV-1 infection. Although there are vaccines that have entered clinical trials, there is no effective vaccine in use. It is worth noting that HSV-1 can establish lifelong latent infection in neurons and mainly cause reactivation and lytic infection in epithelial or mucosal cells, which has become a serious public health problem facing humans. Therefore, it is necessary to find an effective therapeutic target for HSV-1.

[0003] RING finger protein 181 (RNF181), also known as HSPC238, belongs to the RING finger protein superfamily and is an E3 ubiquitin ligase containing a RING domain. RNF181 is a tumor suppressor gene located on chromosome 2p11.2. Its genome is 716 bases long, encoding 153 amino acids, and is expressed in 25 tissues including the pancreas, liver, and kidney. Ubiquitination is a highly conserved, reversible post-translational modification in eukaryotes, and its process requires three enzymes: E1 activating enzyme, E2 conjugating enzyme, and E3 ubiquitin ligase. There are two E1 activating enzymes, about 40 E2 conjugating enzymes, and more than 600 E3 ubiquitin ligases in the human genome. As an E3 ubiquitin ligase, RNF181 determines the specific recognition of target proteins, and it degrades target proteins through the ubiquitin-proteasome pathway or the lysosomal pathway for ubiquitination modification. At present, RNF181 mainly plays a role in the physiological processes of cells and in regulating the occurrence and development of cancer. First, RNF181 can bind to integrin complexes and regulate platelet function under physiological conditions, and can also regulate NF-κB signaling by interacting with CARD11 in lymphocytes. Second, RNF181 can also promote ERα signaling and breast cancer cell progression by interacting with and stabilizing ERα protein. However, there is no research on the mechanism of action of the RING finger protein 181 (RNF181) gene in HSV-1 infection. Summary of the invention

[0004] The purpose of the present invention is to solve the deficiencies of the prior art and to provide an application of an E3 ubiquitin ligase RNF181 expression inhibitor in the preparation of a drug for preventing and / or treating HSV-1 virus infection.

[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0006] The first aspect of the present invention provides the use of an E3 ubiquitin ligase RNF181 gene expression inhibitor in the preparation of a drug for preventing and / or treating HSV-1 virus infection.

[0007] Furthermore, the inhibitor is a small interfering RNA;

[0008] The small interfering RNA comprises the sequence shown below:

[0009] RNF181-siRNA-F: gacgagauaaggcucgaaatt; (SEQ ID NO.1)

[0010] RNF181-siRNA-R: uuucgagccuuaucucguctt; (SEQ ID NO. 2).

[0011] The second aspect of the present invention provides the use of an E3 ubiquitin ligase RNF181 gene overexpressing cell line in the preparation of an HSV-1 virus vaccine producing cell line.

[0012] The third aspect of the present invention provides a drug for preventing and / or treating HSV-1 viral infection, comprising a pharmaceutically acceptable carrier and an inhibitor of E3 ubiquitin ligase RNF181 gene expression.

[0013] Furthermore, the inhibitor is a small interfering RNA;

[0014] The small interfering RNA comprises the sequence shown below:

[0015] RNF181-siRNA-F: gacgagauaaggcucgaaatt; (SEQ ID NO.1)

[0016] RNF181-siRNA-R: uuucgagccuuaucucguctt; (SEQ ID NO. 2).

[0017] The fourth aspect of the present invention provides a method for non-therapeutic inhibition of HSV-1 virus infection of cells in vitro, wherein HSV-1 virus-infected cells are cultured in the presence of an inhibitor of E3 ubiquitin ligase RNF181 gene expression, thereby inhibiting HSV-1 virus; the inhibitor is a small interfering RNA;

[0018] The small interfering RNA comprises the sequence shown below:

[0019] RNF181-siRNA-F: gacgagauaaggcucgaaatt; (SEQ ID NO.1)

[0020] RNF181-siRNA-R: uuucgagccuuaucucguctt; (SEQ ID NO. 2).

[0021] The present invention has found through research that the relationship between RNF181 and HSV-1 virus infection is determined. Inhibiting RNF181 can inhibit the replication and expression of HSV-1, and overexpressing RNF181 can promote the replication and expression of HSV-1 virus, thereby providing a target gene for the treatment of HSV-1 virus infection, and further the RNF181 gene can be used for the prevention or treatment of HSV-1 virus infection.

[0022] The present invention has found through research that inhibiting RNF181 can resist HSV-1 virus infection. Knockdown of RNF181 by siRNA in Hela, HEK293T and wild-type HEK293 cells inhibits the replication of HSV-1, and also inhibits the replication of HSV-1 in HEK293 cells in which the RNF181 gene is knocked out.

[0023] The present invention has found through research that overexpression of the RNF181 gene can promote the replication of the HSV-1 virus. In Hela, HEK293T, and wild-type HEK293 cells transfected with the RNF181 overexpression plasmid, the replication of the HSV-1 virus is promoted in the RNF181 overexpressing cells.

[0024] The sequence of the E3 ubiquitin ligase RING finger protein 181 gene (RNF181) has been published in NCBI with the sequence number: NM_016494.4.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] (1) The present invention determines the relationship between the RNF181 gene and HSV-1 infection, and it can be used as a potential therapeutic target for HSV-1 infection. Knocking down the RNF181 gene can inhibit the replication and proliferation of the HSV-1 virus, and overexpressing the RNF181 gene can promote the replication and proliferation of the HSV-1 virus. RNF181 can be used as a therapeutic target for HSV-1 infection. The present invention provides an effective new approach for the treatment of HSV-1 infection;

[0027] (2) Currently, the treatment of herpes simplex virus infection mainly relies on acyclovir (ACV) and penciclovir (PCV) and their respective prodrugs valacyclovir and famciclovir. These therapeutic drugs can inhibit HSV replication at the DNA synthesis level, but due to the side effects of these drugs and their low efficiency against drug-resistant strains, their use in the treatment of HSV-1 infection is often limited. The anti-HSV-1 therapeutic target RNF181 identified in the present invention is derived from the host, has a conservative gene sequence, and is not prone to drug resistance to drugs designed for this target;

[0028] (3) The present invention determined the feasibility of E3 ubiquitin ligase RNF181 as a target for treating HSV-1 at the cellular level, providing a potential therapeutic target for the treatment of HSV-1. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1The CCID50 method was used to measure the virus titer of the supernatant 24 hours after wild-type HEK293 and RNF181 knockout HEK293 cells were infected with HSV-1; WT-HEK293 represents wild-type HEK293 cells, and KO-HEK293 represents RNF181 knockout HEK293 cells;

[0030] Figure 2 The wild-type HEK293 and RNF181 knockout HEK293 cells were infected with HSV-1; WT-HEK293 represents wild-type HEK293 cells, and KO-HEK293 represents RNF181 knockout HEK293 cells; A is the result of protein immunoblotting, and B is the protein gray value analysis result of ICP27 and ICP5 by protein immunoblotting; 1, 2, and 3 represent 3 biological replicates in each group;

[0031] Figure 3 The CCID50 method was used to measure the virus titer in the supernatant of HEK293T cells in which RNF181 was knocked down by siRNA 24 hours after HSV-1 infection.

[0032] Figure 4 The results of protein immunoblotting in Hela, HEK293T and wild-type HEK293 cells with RNF181 knocked down by siRNA after 24 hours of HSV-1 infection; 1, 2, and 3 represent 3 biological replicates in each group; A is the results of protein immunoblotting in Hela cells; B is the results of protein immunoblotting in HEK293T cells; C is the results of protein grayscale analysis of ICP27 in B; D is the results of protein immunoblotting in wild-type HEK293 cells;

[0033] Figure 5 To overexpress the RNF181 gene in wild-type HEK293 cells using plasmid (pcDNA3.1-RNF181), empty plasmid (pcDNA3.1-GFP) was used as the experimental control group. The CCID50 method was used to measure the virus titer in the supernatant 24 hours after HSV-1 infection.

[0034] Figure 6 To overexpress the RNF181 gene in wild-type HEK293 cells using plasmid (pcDNA3.1-RNF181), empty plasmid (pcDNA3.1-GFP) was used as the experimental control group. Western blotting results after HSV-1 infection for 24 hours; 1, 2, and 3 represent 3 biological replicates in each group;

[0035] Figure 7The RNF181 gene was overexpressed in Hela and HEK293T cells using plasmid (pcDNA3.1-RNF181), and the empty plasmid (pcDNA3.1-GFP) was used as the experimental control group. The protein immunoblotting results 24 hours after HSV-1 infection; 1, 2, and 3 represent 3 biological replicates in each group; A is the protein immunoblotting results of Hela cells; B is the protein immunoblotting results of HEK293T cells. DETAILED DESCRIPTION

[0036] The present invention is further described in detail below in conjunction with embodiments.

[0037] Those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art or the product specifications are used. If the manufacturer of the materials or equipment used is not specified, they are all conventional products that can be purchased.

[0038] All culture medium formulas used in the present invention are:

[0039] 10% DMEM complete medium: Add 1% of the total volume of double antibody and 10% of the total volume of fetal bovine serum (v%) to the commercial DMEM (Vivacell) medium;

[0040] DMEM medium containing 2% fetal bovine serum: Add 2% fetal bovine serum (v%) to the commercial DMEM (Vivacell) medium;

[0041] 2% maintenance solution: add 1% of the total volume of double antibody and 2% of the total volume of fetal bovine serum (v%) to commercial DMEM (Vivacell) culture medium;

[0042] 4% maintenance solution: add 1% of the total volume of double antibody and 4% of the total volume of fetal bovine serum (v%) to commercial DMEM (Vivacell) culture medium;

[0043] Serum-free DMEM medium: commercial DMEM medium (Vivacell).

[0044] The cell involved in the present invention is:

[0045] Human cervical cancer cells (Hela) and human embryonic kidney cells (HEK293T) were cryopreserved by our laboratory, and wild-type human embryonic kidney cells (HEK293) and RNF181 knockout human embryonic kidney cells (HEK293) were purchased from Guangzhou Yuanjing Biotechnology Co., Ltd.

[0046] The present invention relates to viruses;

[0047] HSV-1 virus: The strain is Strain-17, provided by the Vaccine Research Laboratory, Institute of Medical Biology, Chinese Academy of Medical Sciences.

[0048] The siRNA sequence involved in the present invention is:

[0049] The small interfering RNA of the present invention is RNF181-siRNA, including RNF181-siRNA-F and RNF181-siRNA-R; the sequence is as follows:

[0050] RNF181-siRNA-F: gacgagauaaggcucgaaatt; (SEQ ID NO.1)

[0051] RNF181-siRNA-R: uuucgagccuuaucucguctt; (SEQ ID NO. 2)

[0052] The NC-siRNA of the present invention is a negative control, including NC-siRNA-F and NC-siRNA-R; the sequences are as follows:

[0053] NC-siRNA-F: uucuccgaacgugucacgutt; (SEQ ID NO.3)

[0054] NC-siRNA-R: acgugacacguucggagaatt; (SEQ ID NO.4)

[0055] The sequence of the RNF181 overexpression plasmid (pcDNA3.1-RNF181) involved in the present invention is:

[0056] atggcgtcctatttcgatgaacacgactgcgagccgtcggaccctgagcaggagacgcgaaccaacatgctgctggagctcgcaaggtcacttttcaataggatggactttgaaga cttggggttggtagtagattgggaccaccacctgcctccaccagctgccaagactgtggttgagaacctccccaggacagtcatcagaggctctcaggctgagctcaagtgccccgt gtgtcttttggaatttgaggaggaggagactgccattgagatgccttgccatcacctttccattccagctgcattctgccctggctaagcaagacaaattcctgtcccttgtgcc gctatgagctgcccactgatgacgacacttatgaggagcacagacgagataaggctcgaaaacagcagcagcaacaccgactggagaacctccatggagccatgtacacgtga (seq ID NO.5)

[0057] The antibodies involved in the present invention are shown in Table 1.

[0058] Table 1

[0059]

[0060] The reagents involved in the present invention are shown in Table 2.

[0061] Table 2

[0062]

[0063] The preparation method of the corresponding reagents in the present invention is:

[0064] The components of the transfer buffer are shown in Table 3.

[0065] Table 3

[0066]

[0067] Add 600 mL of ultrapure water to the above ingredients, stir to dissolve and then adjust the volume to 1 L.

[0068] The composition of 10×TBST buffer is shown in Table 4.

[0069] Table 4

[0070]

[0071] Add 400 mL of ultrapure water to the above ingredients, stir to dissolve, adjust the pH value to 7.5, and make up to 500 mL.

[0072] The composition of 1×TBST is shown in Table 5.

[0073] Table 5

[0074]

[0075] The components of the blocking solution are shown in Table 6.

[0076] Table 6

[0077]

[0078] Mix the above ingredients thoroughly and use them immediately.

[0079] The corresponding Chinese and English names of the English abbreviations involved in the present invention are shown in Table 7.

[0080] Table 7

[0081]

[0082] Example 1: Determination of HSV-1 virus titer in the culture supernatant after HSV-1 infection of wild-type HEK293 cells and RNF181 knockout HEK293 cells.

[0083] 1. Prepare cells. Take well-growing wild-type HEK293 cells and RNF181 knockout HEK293 cells (purchased from Guangzhou Yuanjing Biotechnology Co., Ltd.) for subculture and inoculate the cells in a 12-well plate. Inoculate 6 wells in total. Add 10% DMEM complete medium to each well in a volume of 1 mL. The starting cell amount is 5×10 5 Each well was shaken evenly and placed in an incubator at 37°C and 5% carbon dioxide concentration for overnight culture.

[0084] Infect with virus. Take out the 12-well plate, remove the 10% DMEM complete medium, wash the cells twice with PBS, and add 0.5mL of HSV-1 virus solution diluted with serum-free DMEM medium to each well (the ratio of virus-infected cells is MOI=1). After incubation at 37℃ for 1h, remove the virus solution, wash twice with PBS, add 1mL of 2% maintenance solution to each well, and culture in an incubator at 37℃ and 5% carbon dioxide concentration.

[0085] 3. Harvest the virus supernatant: Harvest the culture supernatant containing the virus 24 hours after virus infection, take out 1 mL of the culture supernatant and put it in a 1.5 mL centrifuge tube and store it at -80°C.

[0086] 4. Determine the virus titer using the CCID50 method.

[0087] (1) Prepare Vero cells. Mix Vero cells with 4% maintenance solution and plate them on a 96-well plate. The volume of each well is 100 μL, containing approximately 5×10 4 cells.

[0088] (2) Dilute the virus solution to be tested. Take the virus supernatant harvested in step 3 out of the -80°C refrigerator and wait for it to thaw. Dilute the virus stock solution 10-fold with serum-free DMEM medium in an EP tube, i.e., take 100 μL of the virus stock solution and mix it with 900 μL of serum-free DMEM medium to make 10 -1 Dilution gradient, take 100μL 10 -1 The diluted virus solution was mixed with 900 μL serum-free DMEM medium to form 10 -2 Dilution gradient. 11 virus gradients are formed in sequence, namely 10 -1 -10 -11 .

[0089] (3) Inoculation. Take a 96-well plate with Vero cells and add the diluted virus solution to the 96-well plate. Add 8 wells for each dilution gradient and add 100 μL to each well. Add the high dilution first and then the low dilution. Add 100 μL of serum-free DMEM medium to the remaining 8 wells as a blank control. Place in a carbon dioxide incubator at 37°C and 5% carbon dioxide concentration for 5-7 days.

[0090] (4) Observation and statistics. During the culture process, the cell pathological changes were observed under a microscope every day, and the number of cell pathological changes in each gradient was recorded until the number of cell pathological changes in the wells did not increase after continuous observation, and the results were statistically analyzed.

[0091] (5) Calculation results. The virus titer was calculated using the Karber method, i.e., lgCCID50 / mL = the negative logarithm of the highest dilution of complete lesions + the sum of the lesion wells of each dilution of incomplete lesions × 0.125 + 0.5 + 1.

[0092] 5. Experimental results are as follows Figure 1 Wild-type and RNF181 knockout HEK293 cells were infected with HSV-1, and the culture supernatant containing the virus was harvested 24 hours later and the virus titer was determined by CCID50 method. The results showed that knocking out the RNF181 gene in HEK293 cells could inhibit the expression and replication of herpes simplex virus HSV-1.

[0093] Example 2: After HSV-1 infected wild-type HEK293 and RNF181 knockout HEK293 cells, the expression of HSV-1 immediate early protein ICP27 and late protein ICP5 was detected by western blotting.

[0094] 1. Prepare cells. Take well-growing wild-type HEK293 cells and RNF181 knockout HEK293 cells for subculture and inoculate the cells in 12-well plates. Inoculate 6 wells in total. Add 10% DMEM complete medium to each well in a volume of 1 mL. The starting cell amount is 5×10 5 Each well was shaken evenly and placed in an incubator at 37°C and 5% carbon dioxide concentration for overnight culture.

[0095] 2. Infect with virus. Take out the 12-well plate, remove the 10% DMEM complete medium, wash the cells twice with PBS, and add 0.5mL of HSV-1 virus diluted with serum-free DMEM medium to each well (the ratio of virus-infected cells MOI = 1). After incubation at 37℃ for 1h, remove the virus solution, wash twice with PBS, add 1mL of 2% maintenance solution to each well and culture in an incubator at 37℃ and 5% carbon dioxide concentration for 24h.

[0096] 3. Harvest protein samples. Remove the cell culture supernatant, add 4°C pre-cooled PBS to wash twice, discard the PBS and place the 12-well plate on ice. Take RIPA lysis buffer on ice and add PMSF (100mM) at 1% (v%), mix well, and obtain a lysis buffer containing PMSF. Add 100μL of lysis buffer containing PMSF to each well and lyse on ice for 30 minutes. Tap the well plate every few minutes to fully lyse the cells. After lysis, use a pipette to transfer the cell fragments and lysis buffer to a 1.5 mL centrifuge tube. Centrifuge at 12500rpm for 5 minutes at 4°C. Finally, transfer the protein-containing supernatant after centrifugation to 0.5mL centrifuge tubes and store at -40°C.

[0097] 4. Protein immunoblotting was used to detect the expression of HSV-1 proteins.

[0098] (1) Sample preparation. The BCA method was used to detect protein concentration. The protein-containing supernatant obtained in step 3 was taken and the volume of the solution containing 30ug of protein was calculated as the loading volume (the loading volume of each well should be kept consistent. The sample concentration can be adjusted in advance to make the added volume and mass consistent; 3-5μL of protein marker was loaded; the loading volume of a 15-well plate should not exceed 25μL). 5×SDS-PAGE Loading buffer was added to a final concentration of 1×. Mix by pipetting repeatedly, and denature the protein in a 100℃ metal bath for 10 minutes. The sample was placed on ice for later use.

[0099] (2) SDS-polyacrylamide gel electrophoresis. Assemble the electrophoresis tank and add MOPS Running Buffer Liquid (1×) electrophoresis buffer [MOPS Running Buffer Liquid (20×) electrophoresis buffer purchased from GenScript prepared with ultrapure water], with the inner side covering the sample well and the outer side reaching the 2 Gels position. Carefully pull out the comb of the precast gel (purchased from GenScript). Slowly add the sample, try to add it to the middle well. Before adding the next sample, wash it three times in electrophoresis buffer to avoid contamination. Finally, add the protein marker. After adding the sample, cover the top cover, connect the electrophoresis instrument, turn on the electrophoresis instrument, first run the strips at 80V and then adjust the voltage to 120V and run for 40 minutes. Stop the electrophoresis when the bromophenol blue indicator migrates to 1 to 2 cm away from the front.

[0100] (3) Transfer. After electrophoresis, use a thin plate to gently pry apart the two glass plates of the gel plate, cut the gel containing the target protein using the control protein marker, and then carefully spread the gel on the filter paper. Cover the cut and marked PVDF membrane on the corresponding gel, making sure there are no bubbles between the two. Assemble the sandwich plate, with the black (gel) facing the black negative electrode and the transparent (membrane) facing the red positive electrode. Pour the transfer buffer (wet transfer solution) to fill the entire transfer tank, add ice cubes and transfer the membrane in an ice bath. Set the transfer current to a constant current of 300mA. The transfer time is determined according to the size of the protein, and the transfer time is 1 min per 1KD.

[0101] (4) Blocking. After transfer, remove the membrane, place the protein side up, rinse with 1× TBST for 5 seconds, and then place in 5 mL of blocking solution and block at room temperature for 2 hours on a horizontal shaker.

[0102] (5) Incubate the primary antibody. Dilute the primary antibody with Western primary antibody diluent (Biyuntian) according to the dilution multiple recommended in the antibody manual. The primary antibodies used include: ICP5 (abcam), ICP27 (Santa cruz), Anti-RNF181 antibody (Proteintech), and β-actin (CST). After absorbing the blocking solution, rinse briefly with 1×TBST, then immediately add the diluted primary antibody and place in a 4°C refrigerator overnight. The dilution ratios of each antibody are as follows: ICP5 is 1:2000; ICP27 is 1:1000; RNF181 is 1:2000; β-actin is 1:5000;

[0103] (6) Wash the membrane. After the incubation is completed, the primary antibody is aspirated and recovered. 1×TBST is added to a square fresh-keeping box and the membrane is placed in it so that the 1×TBST covers the PVDF membrane. Shake the membrane at a low speed of 80 rpm for 15 min on a shaker and repeat the washing three times.

[0104] (7) Incubation with secondary antibody. The secondary antibody was diluted with blocking solution at a volume ratio of blocking solution: secondary antibody = 1:10000. The secondary antibodies included goat anti-mouse IgG (Proteintech) and goat anti-rabbit IgG (Proteintech). The protein-transferred PVDF membrane was immersed in a square fresh-keeping box containing antibodies and incubated on a horizontal shaker at 80 rpm for 2 h.

[0105] (8) Wash the membrane. After the incubation is completed, remove the secondary antibody, add 5 mL of 1×TBST to a square fresh-keeping box, place the membrane in it, make sure that the 1×TBST covers the PVDF membrane, shake it on a shaker at a low speed of 80 rpm for 15 min, and repeat the washing three times.

[0106] (10) Development. Prepare the developer by mixing 1 ml of developer A and 1 ml of developer B in the Bio-Tech Ultra-Sensitive ECL Chemiluminescence Kit. Prepare the developer before use. When developing, add the developer to the membrane until it is completely covered. After reacting in the dark for 1 min, place the membrane in a UVP instrument to expose the protein bands and take photos.

[0107] 5. Experimental results are as follows Figure 2 Wild-type HEK293 cells and RNF181 knockdown HEK293 cells were infected with HSV-1, and the proteins were collected 24 hours later for western blotting to detect the expression of HSV-1 immediate early protein ICP27 and late protein ICP5; the results showed that knocking out the RNF181 gene in HEK293 cells could inhibit the expression and replication of herpes simplex virus HSV-1.

[0108] Example 3: Determination of HSV-1 virus titer in the culture supernatant after HSV-1 infected HEK293T cells in which the RNF181 gene was knocked down by siRNA.

[0109] 1. Prepare cells. Take well-growing HEK293T cells for subculture and inoculate the cells in a 12-well plate. In total, 9 wells were inoculated (divided into 3 groups, with three wells in each group). The volume of 10% DMEM complete medium in each well was 1 mL. The starting cell amount was 5×10 5 Each well was shaken evenly and placed in an incubator at 37°C and 5% carbon dioxide concentration for overnight culture.

[0110] 2. Transfect cells using liposome method.

[0111] (1) Dilute Lipofectamine 3000 (Thermo). Prepare three 1.5 mL EP tubes, numbered 1, 2, and 3. Take 150 μL of Opti-MEM serum-free medium (Gibco) into each tube and add 9 μL of Lipofectamine 3000.

[0112] (2) Dilute RNF181-siRNA and NC-siRNA. Prepare three 1.5 mL EP tubes, numbered 1, 2, and 3. Take 150 μL of Opti-MEM serum-free medium in the first tube (as the Mock group). Take 150 μL of Opti-MEM serum-free medium in the second tube, add 7.5 μL of NC-siRNA (which contains NC-siRNA-F and NC-siRNA-R, and the final concentration after mixing is 50 pmol, Jima Gene; as the NC group); Take 150 μL of Opti-MEM serum-free medium in the third tube, add 7.5 μL of RNF181-siRNA (which contains RNF181-siRNA-F and RNF181-siRNA-R, and the final concentration after mixing is 50 pmol, Jima Gene; as the siRNA group), and gently pipette to mix.

[0113] (3) Mix the corresponding numbered liquids in step (1) and step (2) and incubate at room temperature for 15 minutes.

[0114] (4) Transfecting cells. Add the siRNA-lipid complex obtained in step (3) to the cell culture supernatant of a 12-well plate, transfect 3 wells with siRNA, 3 wells with NC as a control group, and add Lipofectamine 3000 transfection reagent to 3 wells, 100 μL siRNA-lipid complex / well. Mix gently and place in a carbon dioxide incubator at 37°C and 5% carbon dioxide concentration for 48 h.

[0115] 3. Virus infection. Take out the 12-well plate, remove the culture supernatant, wash the cells twice with PBS, and add 0.5mL of serum-free DMEM medium to each well. Infect the HSV-1 virus with MOI=1, place the 12-well plate in a carbon dioxide incubator at 37°C and a carbon dioxide concentration of 5% for 1 hour, remove the serum-free DMEM medium, wash twice with PBS, add 1mL of virus solution diluted with 2% maintenance solution to each well (MOI=1), and continue to be placed in a carbon dioxide incubator at 37°C and a carbon dioxide concentration of 5% for 24 hours.

[0116] 4. Harvest the virus supernatant using the same method as in Example 1.

[0117] 5. The virus titer was determined by CCID50 method, which was the same as that in Example 1.

[0118] 6. Experimental results are as follows Figure 3As shown. RNF181 was knocked down using siRNA in HEK293T cells, and HSV-1 was infected 48 hours later. The cell supernatant was collected 24 hours later and the virus titer was determined by CCID50 method. The results showed that knocking down RNF181 in HEK293T cells could inhibit the expression and replication of herpes simplex virus HSV-1.

[0119] Example 4: After HSV-1 infected Hela, HEK293T, and wild-type HEK293 cells in which the RNF181 gene was knocked down by siRNA, protein immunoblotting was used to detect the expression of HSV-1 immediate early protein ICP27 and late protein ICP5.

[0120] 1. Prepare cells. Take well-growing Hela, HEK293T, and wild-type HEK293 cells for subculture and inoculate the cells in a 12-well plate. In total, 9 wells were inoculated (divided into 3 groups, with three wells in each group). The volume of 10% DMEM complete medium in each well was 1 mL, and the starting cell amount was 5×10 5 Each well was shaken evenly and placed in an incubator at 37°C and 5% carbon dioxide concentration for overnight culture.

[0121] 2. Transfect cells using liposome method.

[0122] (1) Dilute Lipofectamine 3000 (Thermo). Prepare three 1.5 mL EP tubes, numbered 1, 2, and 3. Take 150 μL of Opti-MEM serum-free medium (Gibco) into each tube and add 9 μL of Lipofectamine 3000.

[0123] (2) Dilute RNF181-siRNA and NC-siRNA. Prepare three 1.5 mL EP tubes, numbered 1, 2, and 3. Take 150 μL of Opti-MEM serum-free medium in the first tube (as the Mock group). Take 150 μL of Opti-MEM serum-free medium in the second tube, add 7.5 μL of NC-siRNA (which contains NC-siRNA-F and NC-siRNA-R, and the final concentration after mixing is 50 pmol, Jima Gene; as the NC group); Take 150 μL of Opti-MEM serum-free medium in the third tube, add 7.5 μL of RNF181-siRNA (which contains RNF181-siRNA-F and RNF181-siRNA-R, and the final concentration after mixing is 50 pmol, Jima Gene; as the siRNA group), and gently pipette to mix.

[0124] (3) Mix the corresponding numbered liquids in step (1) and step (2) and incubate at room temperature for 15 minutes.

[0125] (4) Transfecting cells. Add the siRNA-lipid complex obtained in step (3) to the cell culture supernatant of a 12-well plate, transfect 3 wells with siRNA, 3 wells with NC as a control group, and add Lipofectamine 3000 transfection reagent to 3 wells, 100 μL siRNA-lipid complex / well. Mix gently and place in a carbon dioxide incubator at 37°C and 5% carbon dioxide concentration for 48 h.

[0126] 3. Virus infection. Take out the 12-well plate, remove the culture supernatant, wash the cells twice with PBS, and add 0.5mL of serum-free DMEM medium to each well. Infect the HSV-1 virus with MOI=1, place the 12-well plate in a carbon dioxide incubator at 37°C and a carbon dioxide concentration of 5% for 1 hour, remove the serum-free DMEM medium, wash twice with PBS, add 1mL of virus solution diluted with 2% maintenance solution to each well (MOI=1), and continue to be placed in a carbon dioxide incubator at 37°C and a carbon dioxide concentration of 5% for 24 hours.

[0127] 4. Harvest protein samples using the same method as in Example 2.

[0128] 5. The expression of HSV-1 proteins was detected by western blotting using the same method as in Example 2.

[0129] 6. Experimental results are as follows Figure 4 As shown. After siRNA knockdown of RNF181 gene in Hela, HEK293T, and wild-type HEK293 cells for 48 hours, the protein was collected for protein immunoblotting 24 hours after HSV-1 infection. The expression of HSV-1 immediate early protein ICP27 and late protein ICP5 was detected. The results showed that siRNA knockdown of RNF181 gene in Hela, HEK293T, and wild-type HEK293 cells can inhibit the expression and replication of herpes simplex virus HSV-1.

[0130] Example 5: Determination of HSV-1 virus titer in the culture supernatant after HSV-1 infected wild-type HEK293 cells overexpressing the RNF181 gene.

[0131] 1. Prepare cells. Take well-growing wild-type HEK293 cells for subculture and inoculate the cells in a 12-well plate. In total, 6 wells were inoculated (divided into 2 groups, three wells in each group). The volume of 10% DMEM complete medium in each well was 1 mL. The starting cell amount was 5×10 5 Each well was shaken evenly and placed in an incubator at 37°C and 5% carbon dioxide concentration for overnight culture.

[0132] 2. Transfect cells using liposome method.

[0133] (1) Dilute Lipofectamine 3000 (Thermo). Prepare two 1.5 mL EP tubes, numbered 1 and 2. Take 150 μL of Opti-MEM serum-free medium (Gibco) into each tube and add 9 μL of Lipofectamine 3000.

[0134] (2) Dilute the plasmid. Prepare two 1.5 mL EP tubes, numbered 1 and 2. Take 150 μL of Opti-MEM serum-free medium (Gibco) into each tube and add 6 μL of P3000 from the Lipofectamine TM 3000 kit. Then add 3 μg of pcDNA3.1-RNF181 (NM_016494.4) (plasmid synthesized by Hanheng Biotechnology Co., Ltd.) to tube 1 and 3 μg of pcDNA3.1-GFP to tube 2.

[0135] (3) Add the mixed solution in step (2) to the diluted Lipofectamine 3000 in step (1) in a ratio of 1:1 according to the corresponding tube numbers 1 and 2, pipette thoroughly to mix, and incubate at room temperature for 15 minutes.

[0136] (4) Transfecting cells. Add the DNA-lipid complex obtained in step (3) to the cell culture supernatant of the 12-well plate, discard the original culture medium, wash twice with PBS, add 1 mL of DMEM culture medium containing 2% fetal bovine serum to each well, add the DNA-liposome complex in step (3) to the 12-well plate at 100 μL / well, of which 3 wells are transfected with pcDNA3.1(+)-RNF181 (NM016494.4), and 3 wells are transfected with pcDNA3.1-GFP as the control group. After slight mixing, place in a 37°C, 5% CO2 incubator for 24 hours.

[0137] 3. Infect with virus. Take out the 12-well plate, discard the original culture medium, wash twice with PBS, add 0.5mL serum-free DMEM culture medium to each well, and add HSV-1 virus at MOI=1. Incubate in a 37℃, 5% CO2 incubator for 1h, replace the serum-free DMEM culture medium with 2% maintenance solution. Continue to culture in a 37℃, 5% CO2 incubator for 24h.

[0138] 4. Harvest the virus supernatant using the same method as in Example 1.

[0139] 5. The virus titer was determined by CCID50 method, which was the same as that in Example 1.

[0140] 6. Experimental results are as follows Figure 5The plasmid pcDNA3.1-RNF181 was used to overexpress the RNF181 gene in wild-type HEK293 cells, and HSV-1 was infected 24 hours later. The cell supernatant was collected 24 hours later and the virus titer was determined by CCID50 method. The results showed that in wild-type HEK293 cells, compared with the pcDNA3.1-GFP group, overexpression of RNF181 can promote the expression and replication of herpes simplex virus HSV-1.

[0141] Example 6: After HSV-1 infected wild-type HEK293 cells overexpressing the RNF181 gene, protein immunoblotting was used to detect the expression of HSV-1 immediate early protein ICP27 and late protein ICP5.

[0142] 1. Prepare cells. Take well-growing wild-type HEK293 cells for subculture and inoculate the cells in a 12-well plate. In total, 6 wells were inoculated (divided into 2 groups, three wells in each group). The volume of 10% DMEM complete medium in each well was 1 mL. The starting cell amount was 5×10 5 Each well was shaken evenly and placed in an incubator at 37°C and 5% carbon dioxide concentration for overnight culture.

[0143] 2. Transfect cells using liposome method.

[0144] (1) Dilute Lipofectamine 3000 (Thermo). Prepare two 1.5 mL EP tubes, numbered 1 and 2. Take 150 μL of Opti-MEM serum-free medium (Gibco) into each tube and add 9 μL of Lipofectamine 3000.

[0145] (2) Dilute the plasmid. Prepare two 1.5 mL EP tubes, numbered 1 and 2. Take 150 μL of Opti-MEM serum-free medium (Gibco) into each tube and add 6 μL of P3000 from the Lipofectamine TM 3000 kit. Then add 3 μg of pcDNA3.1-RNF181 (NM_016494.4) (plasmid synthesized by Hanheng Biotechnology Co., Ltd.) to tube 1 and 3 μg of pcDNA3.1-GFP to tube 2.

[0146] (3) Add the mixed solution in step (2) to the diluted Lipofectamine 3000 in step (1) in a ratio of 1:1 according to the corresponding tube numbers 1 and 2, pipette thoroughly to mix, and incubate at room temperature for 15 minutes.

[0147] (4) Transfecting cells. Add the DNA-lipid complex obtained in step (3) to the cell culture supernatant of the 12-well plate, discard the original culture medium, wash twice with PBS, add 1 mL of DMEM culture medium containing 2% fetal bovine serum to each well, add the DNA-liposome complex in step (3) to the 12-well plate at 100 μL / well, of which 3 wells are transfected with pcDNA3.1(+)-RNF181 (NM016494.4), and 3 wells are transfected with pcDNA3.1-GFP as the control group. After slight mixing, place in a 37°C, 5% CO2 incubator for 24 hours.

[0148] 3. Infect with virus. Take out the 12-well plate, discard the original culture medium, wash twice with PBS, add 0.5mL serum-free DMEM culture medium to each well, and add HSV-1 virus at MOI=1. Incubate in a 37℃, 5% CO2 incubator for 1h, replace the serum-free DMEM culture medium with 2% maintenance solution. Continue to culture in a 37℃, 5% CO2 incubator for 24h.

[0149] 4. Harvest protein samples using the same method as in Example 2.

[0150] 5. The expression of HSV-1 proteins was detected by western blotting using the same method as in Example 2.

[0151] 6. Experimental results are as follows Figure 6 As shown. The plasmid pcDNA3.1-RNF181 was used to overexpress the RNF181 gene in wild-type HEK293 cells, and HSV-1 was infected 24 hours later. The proteins were collected for protein immunoblotting 24 hours later. The expression of the immediate early protein ICP27 and the late protein ICP5 of HSV-1 were detected. The results showed that in wild-type HEK293 cells, compared with the pcDNA3.1-GFP group, overexpression of RNF181 can promote the expression and replication of herpes simplex virus HSV-1.

[0152] Example 7: After HSV-1 infected Hela and HEK293T cells overexpressing the RNF181 gene, protein immunoblotting was used to detect the expression of HSV-1 immediate early protein ICP27 and late protein ICP5.

[0153] 1. Prepare cells. Take well-growing Hela and HEK293T cells for subculture and inoculate the cells in a 12-well plate. In total, 6 wells were inoculated (divided into 2 groups, three wells in each group). The volume of 10% DMEM complete medium in each well was 1 mL. The starting cell amount was 5×10 5 Each well was shaken evenly and placed in an incubator at 37°C and 5% carbon dioxide concentration for overnight culture.

[0154] 2. Transfect cells using liposome method.

[0155] (1) Dilute Lipofectamine 3000 (Thermo). Prepare two 1.5 mL EP tubes, numbered 1 and 2. Take 150 μL of Opti-MEM serum-free medium (Gibco) into each tube and add 9 μL of Lipofectamine 3000.

[0156] (2) Dilute the plasmid. Prepare two 1.5 mL EP tubes, numbered 1 and 2. Take 150 μL of Opti-MEM serum-free medium (Gibco) into each tube and add 6 μL of P3000 from the Lipofectamine TM 3000 kit. Then add 3 μg of pcDNA3.1-RNF181 (NM_016494.4) (plasmid synthesized by Hanheng Biotechnology Co., Ltd.) to tube 1 and 3 μg of pcDNA3.1-GFP to tube 2.

[0157] (3) Add the mixed solution in step (2) to the diluted Lipofectamine 3000 in step (1) in a 1:1 ratio according to the corresponding tube numbers 1 and 2, pipette thoroughly to mix, and incubate at room temperature for 15 minutes.

[0158] (4) Transfecting cells. Add the DNA-lipid complex obtained in step (3) to the cell culture supernatant of the 12-well plate, discard the original culture medium, wash twice with PBS, add 1 mL of DMEM (2% fetal bovine serum, no double antibody, v%) culture medium containing 2% fetal bovine serum to each well, and add the DNA-liposome complex in step (3) to the 12-well plate at 100 μL / well, of which 3 wells are transfected with pcDNA3.1(+)-RNF181 (NM016494.4), and 3 wells are transfected with pcDNA3.1-GFP as the control group. After slight mixing, place in a 37°C, 5% CO2 incubator for 24 h.

[0159] 3. Infect with virus. Take out the 12-well plate, discard the original culture medium, wash twice with PBS, add 500 μL serum-free DMEM culture medium to each well, and add HSV-1 virus at MOI=1. Incubate in a 37°C, 5% CO2 incubator for 1 hour, replace the serum-free DMEM culture medium with 2% maintenance solution. Continue to culture in a 37°C, 5% CO2 incubator for 24 hours.

[0160] 4. Harvest protein samples using the same method as in Example 2.

[0161] 5. The expression of HSV-1 proteins was detected by western blotting using the same method as in Example 2.

[0162] 6. Experimental results are as follows Figure 7 As shown. The RNF181 gene was overexpressed in Hela and HEK293T cells using plasmid pcDNA3.1-RNF181, and HSV-1 was infected 24 hours later. The proteins were collected and immunoblotted 24 hours later. The expression of the immediate early protein ICP27 and the late protein ICP5 of HSV-1 were detected. The results showed that in Hela and HEK293T cells, compared with the pcDNA3.1-GFP group, overexpression of RNF181 can promote the expression and replication of herpes simplex virus HSV-1.

[0163] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. Use of an E3 ubiquitin ligase RNF181 gene expression inhibitor in the preparation of a drug for preventing and / or treating HSV-1 virus infection, characterized in that: The inhibitor is small interfering RNA; The small interfering RNA comprises the sequence shown below: RNF181-siRNA-F: gacgagauaaggcucgaaatt; RNF181-siRNA-R:uuucgagccuuaucucguctt.

2. Application of E3 ubiquitin ligase RNF181 gene overexpressing cell line in the preparation of HSV-1 virus vaccine producing cell line.

3. A method for non-therapeutic inhibition of HSV-1 virus infection of cells in vitro, characterized in that: Cultivating HSV-1 virus-infected cells in the presence of an inhibitor of E3 ubiquitin ligase RNF181 gene expression, thereby inhibiting the HSV-1 virus; the inhibitor is a small interfering RNA; The small interfering RNA comprises the sequence shown below: RNF181-siRNA-F: gacgagauaaggcucgaaatt; RNF181-siRNA-R:uuucgagccuuaucucguctt.

Images