Monochamus alternatus fatty acid beta oxidation regulation gene MaCPT1 and dsRNA and application thereof

Abstract

The invention relates to a monochamus alternatus fatty acid beta oxidation regulation gene MaCPT1 as well as dsRNA and application thereof. The nucleotide sequence of the MaCPT1 gene is as shown in SEQ ID NO.1, and the amino acid sequence of the protein coded by the MaCPT1 gene is as shown in SEQ ID NO.2. The method comprises the following steps: designing a primer to synthesize dsRNA for interfering the MaCPT1 gene, wherein the dsRNA consists of a nucleotide sequence as shown in SEQ ID NO.4 and a nucleotide sequence which is reversely complementary with the nucleotide sequence as shown in SEQ ID NO.4; the dsRNA is injected into the chest back plate of the monochamus alternatus, and the result shows that the expression of the MaCPT1 gene of the monochamus alternatus is obviously reduced, the oxidation rate of fatty acid beta is obviously reduced, and the pine wood nematode carrying capacity is obviously improved. The MaCPT1 gene and the dsRNA thereof have the effects of regulating and controlling the fatty acid beta oxidation rate of the monochamus alternatus and the pine wood nematode carrying capacity of the monochamus alternatus. The method can also provide a theoretical basis for prevention and control of pine wood nematodes.

Description

Technical Field

[0001] The present invention belongs to the field of forest protection, and specifically relates to a fatty acid β-oxidation regulatory gene of Monochamus alternatus MaCPT1 And its dsRNA and application. Background Art

[0002] Pine wood nematode disease is caused by the pine wood nematode ( Bursaphelenchus xylophilus ) is a devastating disease that parasitizes pine trees and causes their death. The disease spreads quickly and is difficult to prevent and control. If it is not prevented and controlled in time, it is easy to cause large areas of pine forests to die, seriously endangering pine forests, affecting forest landscapes and regional forest ecosystem security. Pine wilt disease presents typical pathogen-dominated disease characteristics on Asian pine trees, that is, the prevalence of the disease does not depend on the growth status of the pine trees, but on whether the pine wilt can spread to this area to infect pine trees. Once a pine tree is infected with pine wilt disease, no matter how healthy it grows, it will eventually become ill and die.

[0003] Pine wood nematode disease is mainly transmitted through two ways: insect vectors and human spread. Monochamus alternatus ) is the main medium for the spread of pine wood nematode disease and an important trunk-boring pest that harms coniferous trees. It has a special "tracheal symbiotic" relationship with pine wood nematodes. The fourth-instar larvae of the diffusive type of pine wood nematode enter the trachea of ​​the pine beetle during the pupal stage. Sometimes there are 200,000 to 300,000 pine wood nematodes in the tracheal system of a pine beetle. How to cut off the symbiotic relationship between pine beetles and pine wood nematodes, thereby blocking the spread of pine wood nematode disease, is an important link in the prevention and control of pine wood nematode disease, but there is currently no effective prevention and control method for this link.

[0004] The present invention is the first to separate the MaCPT1 Genes were validated by gene silencing and phenotypic analysis. MaCPT1 The gene plays a negative regulatory role in controlling the amount of pine wood nematodes carried by pine beetles, laying the foundation for further research on the genetic function of pine beetles and the prevention and control of pine wood nematodes. Summary of the invention

[0005] The purpose of the present invention is to provide a fatty acid β-oxidation regulatory gene for Monochamus alternatus MaCPT1 And its dsRNA and application.

[0006] To achieve the above object, the present invention adopts the following technical solutions: Genes regulating fatty acid β-oxidation in Monochamus alternatus MaCPT1 The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by it is shown in SEQ ID NO.2.

[0007] The above-mentioned fatty acid β-oxidation regulatory genes MaCPT1 The application is any one or more of the following: 1) Application in regulating the β-oxidation rate of fatty acids in Monochamus alternatus; 2) Application in regulating the ability of Monochamus alternatus to carry pine wood nematodes; 3) Application in the prevention and control of pine wood nematodes.

[0008] Furthermore, the above-mentioned regulation of the β-oxidation rate of fatty acids in Monochamus alternatus is achieved by reducing the β-oxidation regulatory gene of the fatty acids in Monochamus alternatus. MaCPT1 The expression level of pine needles reduces the rate of fatty acid β-oxidation in pine needles.

[0009] Furthermore, the above-mentioned regulation of the ability of pine beetles to carry pine wood nematodes is achieved by reducing the regulation of fatty acid β-oxidation in pine beetles. MaCPT1 The expression level of pine beetle improves the ability of pine beetle to carry pine wood nematodes.

[0010] The above-mentioned fatty acid β-oxidation regulatory genes MaCPT1 A fluorescent quantitative primer pair, the sequence of which is: Forward primer: 5'-CGAGAATGCCTTGAAAGTAGCA-3', Reverse primer: 5′-ACAGGTCGAAGAGTTTCCGT-3′.

[0011] The above-mentioned fatty acid β-oxidation regulatory genes MaCPT1 The dsRNA is a double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID NO.4 and a nucleotide sequence that is reverse complementary to the nucleotide sequence shown in SEQ ID NO.4.

[0012] The above-mentioned dsRNA preparation method is based on the fatty acid β-oxidation regulatory gene of Monochamus alternatus MaCPT1 A dsRNA primer pair is designed and a DNA with a T7 promoter sequence is obtained by PCR amplification. The DNA with a T7 promoter sequence is used as a template to synthesize dsRNA by in vitro transcription. The nucleotide sequence of the DNA with a T7 promoter sequence is shown in SEQ ID NO.3.

[0013] Furthermore, the sequence of the above dsRNA primer pair is: Sense strand primer: 5'-TAATACGACTCACTATAGGGTCATGGCTCACCTTTGGGA-3', Antisense primer: 5′-TAATACGACTCACTATAGGCTGTCTATGCCCTTTCCGCA-3′.

[0014] The application of the above-mentioned dsRNA is any one or more of the following: 1) Application in reducing the β-oxidation rate of fatty acids in Monochamus alternatus; 2) Application in improving the ability of Monochamus alternatus to carry pine wood nematodes; 3) Application in the prevention and control of pine wood nematodes.

[0015] A method for reducing the fatty acid β-oxidation rate of Monochamus alternatus and / or improving the ability of Monochamus alternatus to carry pine wood nematodes comprises injecting the above-mentioned dsRNA into the body of Monochamus alternatus, wherein the injection site is the pronotum of the Monochamus alternatus.

[0016] The significant advantages of the present invention are: The present invention is the first to separate the MaCPT1 Genes were validated by gene silencing and phenotypic analysis. MaCPT1 Genes play a negative regulatory role in controlling the amount of pine wood nematodes carried by pine beetles, in order to use genetic engineering to increase the number of pine wood nematodes carried by pine beetles, concentrate on preventing and controlling pine beetles, cut off the transmission routes of pine wood nematode disease, and at the same time reduce the use of various toxic organic volatile chemicals in the prevention and control of pine wood nematode disease, thereby reducing pollution to the environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 :Electrophoresis results of dsRNA synthesis products. CPT1 indicates MaCPT1 dsRNA of the gene, Control means dsControl.

[0018] Figure 2 : Monochamus alternatus injected with dsRNA MaCPT1 Relative gene expression.

[0019] Figure 3 :Fatty acid β-oxidation rate in Monochamus alternatus injected with dsRNA.

[0020] Figure 4 : MaCPT1 The amount of pine wood nematode carried by Monochamus alternatus after gene silencing. DETAILED DESCRIPTION

[0021] In order to make the contents of the present invention easier to understand, the technical solution of the present invention is further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0022] Example 1: Monochamus alternatus MaCPT1 Gene sequence information Based on the existing genome information and transcriptome data of Monochamus alternatus, we compared it with other species and found that MaCPT1The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.

[0023] SEQ ID NO.1 (from 5' to 3'): SEQ ID NO.2 (from the N-terminus to the C-terminus): MAEAHSAVAFSFSITHEGWDVNFDREVLHLVWQSGVRSWKKRMARFQNSVHNGVYPGHYRYLCVLIGLVTAVHLNGYTVPLNIANKIIRILPGNTLPWQLAACFLTSLVYWLTVIYILRYILKLLFMYKGWMYESRARGAQISTQTKLWLFLVKIFSGWNTPRLYSYQGSLPRLPLPTVQETMTRYLNSVKPLLDDEKYKRMEKLATEFENGIGKKLQRYLILKSWWSTNYVSDWWEEYVYLRGRSPLMINSNFYGIDALLLHPTHNQAARAASTINSLLVFRRLVERQELEPILVQGLVPLCSWQYERIFNTTRIPGTETDKICHWADSNHIVVYHKGRYFKVIIYKGRILKPAEIQVQIQQILDDTSEPLPGEEKLAALTAGERTHWANVRKMLFNKGVNRTSLDTVEKAAFVVALDDFPYEYDKSDPSKLDKYGRALLHGKGYDRWFDKSFTLCVGSNGRIGFNAEHSWADAAVMAHLWEWVMTSETWESRFDEDGNTIGKPEITPPTPIRLKWELKYEASTAIENALKVAQNLISDIDLRILVHDHYGKGFMKTCGLSPDAFIQMALQLAYYRDAGKFCLTYEATMTRLYREGRTETLRPVTLESVAWVKAMVDGKTPVEERVKLLRSACKKHQAGYQDAMCGKGIDRHLFCLYVVSKYLEVDSPFLKEVLSEPWRLSTSQTPHGQTTRLDLKKHPKCISAGGGFGPVADDGYGVSYIIAGEDLLFFHISHKMSCPTTDCHRFARKIEEALSDIKQMFLEYKSVNGVK Example 2: Monochamus alternatus MaCPT1 Synthesis of gene dsRNA The third instar larvae of Monochamus alternatus Hope were collected from Quanzhou City and Yanping District, Nanping City, Fujian Province. Each larva was placed in a plastic bottle with a height of 7 cm and a diameter of 5 cm and placed in an artificial climate chamber. The artificial diet was prepared according to the previous methods [Chen, R., Wang, L., Lin, T., Wei, Z., Wang, Y., and Hao, D. (2017). Rearing techniques of Monochamus alternatus Hope (Coleoptera: Cerambycidae) on artificial diets. J. of Nanjing Forestry Uni., 60(01), 199-202.; Fan, JT, and Sun, JH (2006). Influences of hostvolatiles on feeding behaviour of the Japanese pine sawyer, Monochamus alternatus. J Appl Entomol, 130(4), 238-244.] and the larvae were raised to adulthood under the following conditions: temperature of 30℃, relative humidity of 50%, and dark environment.

[0024] Adult Monochamus alternatus was collected and quickly frozen in liquid nitrogen. Total RNA was extracted by Trizol method. RNA degradation and contamination were detected by 1% agarose gel electrophoresis. The purity of the extracted RNA samples was detected by NanoDrop 2000 (Thermo Fisher Scientific), and the RNA integrity was detected by Agilent 2100 Bioanalyzer (Agilent Technologies). The extracted total RNA was reverse transcribed into cDNA according to the instructions of ThermoScientific RevertAcid First Strand cDNA Synthesis Kit.

[0025] Monochamus alternatus MaCPT1 The dsRNA of the gene was transcribed in vitro using the T7 RNAi Transcription Kit (Nanjing Novogene Biotech Co., Ltd., TR102-02). MaCPT1The dsRNA primer pair was designed based on the gene sequence. The forward primer sequence was 5'-TAATACGACTCACTATAGGGTCATGGCTCACCTTTGGGA-3', and the antisense primer sequence was 5'-TAATACGACTCACTATAGGCTGTCTATGCCCTTTCCGCA-3'. Then the designed dsRNA primer pair was used to perform PCR amplification on the cDNA of Monochamus alternatus to obtain a DNA fragment with a T7 promoter sequence ( Figure 1 ), with a length of 527 bp, and a nucleotide sequence as shown in SEQ ID NO.3. After gel separation and purification, the quality was tested and qualified as a template for dsRNA synthesis; wherein, the PCR amplification system was: 1µL of Monochamus alternatus cDNA, 7.5µL of TaqPlus Master Mix, 0.5µL of 10μM positive chain primer, 0.5µL of 10μM antisense chain primer, RNase free ddH 2 O 5.5µL; PCR amplification program: 95℃ 3min; 98℃ 30s, 57℃ 30s, 72℃ 30s, 35 cycles; 72℃ termination extension for 10min, stored at 4℃. Based on the obtained dsRNA template, dsRNA (i.e., dsCPT1) was synthesized by in vitro transcription by T7 RNA polymerase according to the instructions of the in vitro transcription kit. It is a double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID NO.4 and a nucleotide sequence that is reverse complementary to the nucleotide sequence shown in SEQ ID NO.4.

[0026] SEQ ID NO.3 (from 5' to 3'): GTCATGGCTCACCTTTGGGAATGGGTAATGACTTCAGAGACCTGGGAATCTCGATTTGATGAAGATGGAAATACAATCGGAAAACCTGAAATTACCCCGCCTACCCCTATCCGACTTAAATGGGAACTGAAATACGAAGCTAGCACTGCTATCGAGAATGCCTTGAAAGTAGCACAAAATCTCATAAGTGACATAGATCTGCGAATTCTAGTCCATGACCATTACGGAAAAGGTTTTATGAAAACTTGTGGACTCAGCCCGGACGCCTTTATACAAATGGCTTTGCAGTTAGCGTATTACCGAGACGCAGGAAAATTTTGCCTAACTTATGAAGCCACCATGACTAGGTTGTATAGAGAAGGTCGAACGGAAACTCTTCGACCTGTTACACTCGAATCGGTTGCCTGGGTTAAGGCAATGGTAGATGGTAAGACTCCAGTAGAGGAAAGAGTGAAGTTGCTTAGAAGTGCTTGCAAAAAGCATCAGGCTGGTTACCAAGATGCGATGTGCGGAAAGGGCATAGACAG SEQ ID NO.4 (from 5' end to 3' end): CTGTCTATGCCCTTTCCGCACATCGCATCTTGGTAACCAGCCTGATGCTTTTTGCAAGCACTTCTAAGCAACTTCACTCTTTCCTCTACTGGAGTCTTACCATCTACCATTGCCTTAACCCAGGCAACCGA TTCGAGTGTAACAGGTCGAAGAGTTTCCGTTCGACCTTCTCTATACAACCTAGTCATGGTGGCTTCATAAGTTAGGCAAAATTTTCCTGCGTCTCGGTAATACGCTAACTGCAAAGCCATTTGTATAAAGGC GTCCGGGCTGAGTCCACAAGTTTTCATAAAACCTTTTCCGTAATGGTCATGGACTAGAATTCGCAGATCTATGTCACTTATGAGATTTTGTGCTACTTTCAAGGCATTCTCGATAGCAGTGCTAGCTTCGTA TTTCAGTTCCCATTTAAGTCGGATAGGGGTAGGCGGGGTAATTTCAGGTTTTCCGATTGTATTTCCATCTTCATCAAATCGAGATTCCCAGGTCTCTGAAGTCATTACCCATTCCCAAAGGTGAGCCATGAC Example 3: Monochamus alternatus MaCPT1 Injection of cDNA dsRNA The third-instar larvae of Monochamus alternatus were collected from Quanzhou City and Yanping District, Nanping City, Fujian Province. Each larva was individually placed in a plastic bottle with a height of 7 cm and a diameter of 5 cm and placed in an artificial climate chamber. The method of Chen, R., Wang, L., Lin, T., Wei, Z., Wang, Y., and Hao, D. (2017). Rearing techniques of Monochamus alternatus Hope (Coleoptera: Cerambycidae) on artificial diets.J. of Nanjing Forestry Uni., 60(01), 199-202.; Fan, JT, and Sun, JH(2006). Influences of hostvolatiles on feeding behavior of the Japanese pinesawyer, Monochamus alternatusJ Appl Entomol, 130(4), 238-244. 】, artificial diet was prepared and raised to the pupal stage as injection test insects, and the breeding conditions were: temperature 30℃, relative humidity 50%, and dark environment.

[0027] The injected insects were divided into three treatments: injection of ddH 2 O, injection of dsCPT1, injection of dsControl (provided by the T7RNAi Transcription Kit). On the fifth day of the pupal stage, the injected insects were disinfected with 70% ethanol, placed in a sterile centrifuge tube and placed on ice for 15 minutes of freezing anesthesia, and then 30 μg (<5 μL) of dsRNA or an equal volume of ddH2O was injected into the tube using a microsyringe. 2 O was injected into the pronotum of each test insect, with an injection depth of 2-3 mm. The survival of the test insects was observed and recorded 24 hours after injection. The results showed that no death was found in each treatment group after injection, and the activity of the test insects between the treatments was not much different, indicating that the mechanical damage caused by the injection did not affect the survival rate.

[0028] After the injected test insects were restored at room temperature for 30 minutes, 10 active female test insects and 10 male test insects were selected from each treatment group and placed in high-pressure sterilized (121°C, 30 minutes) Masson pine sawdust without pine wood nematodes. They were raised at 30°C, 50% relative humidity, and dark environment. Seven days after eclosion, the pine beetle adults were collected to extract total RNA, and the first-chain cDNA was obtained by reverse transcription. Real-time fluorescence quantitative PCR was used to detect the expression of the target gene. The results showed that the dsControl group injected with ddH 2 O Group MaCPT1 There was no significant difference in gene expression. The dsCPT1 injection group was significantly higher than that of the ddH injection group. 2 O Group MaCPT1 Gene expression tends to be downregulated ( Figure 2 ). The primer sequences used in real-time fluorescence quantitative PCR are as follows: MaCPT1 Gene-specific primers: Forward primer: 5'-CGAGAATGCCTTGAAAGTAGCA-3' Reverse primer: 5'-ACAGGTCGAAGAGTTCCGT-3' Internal reference primer (GAPDH): Forward primer: 5'-AGAAAGTTATTATCTCCGCTCCA-3' Reverse primer: 5'-CCATACCAGTTAGTTTGCCATT-3' Example 4: Artificial inoculation of pine wood nematodes The pine nematodes cultured on corn agar medium were separated using the Baermann funnel method; the centrifuge tube containing the pine nematode separation solution was tightly capped and mixed by inverting it upside down; 250 μL of the thoroughly mixed pine nematode separation solution was aspirated with a micropipette and transferred to a culture dish with a counting grid, and counted under a stereoscope (M205FA, Leica, Wetzlar, Germany); after counting, the droplets on the culture dish were transferred back to the centrifuge tube, and the counting was repeated four times. The number of nematodes in 1 mL of pine nematode separation solution was calculated based on the average value, and the total number of pine nematodes in the separation solution was calculated; the separation solution was centrifuged and concentrated to prepare a pine nematode suspension containing 6000 nematodes per milliliter of sterile water. 50 mL of pine wood nematode suspension was mixed with 20 μL of 1 / 2500 antibiotic (A6533, MacLean, USA), and inoculated into 150 g of high-pressure sterilized (121°C, 30 min) Masson pine sawdust to obtain Masson pine sawdust containing pine wood nematodes.

[0029] After the test insects injected in Example 3 were restored at room temperature for 30 minutes, 10 vigorous female test insects and 10 male test insects were selected from each treatment group, and placed in Masson pine sawdust containing pine wood nematodes, and raised under the conditions of temperature 30°C, relative humidity 50%, and dark environment. Seven days after emergence, the pine beetle adults were collected for subsequent determination of the β-oxidation rate of fatty acids in the pine beetle and quantification of the amount of pine wood nematodes carried by the pine beetle.

[0030] Determination of fatty acid β-oxidation rate of Monochamus alternatus: The fatty acid β-oxidation rate of Monochamus alternatus was determined according to the instructions of the Insect fatty acid β-oxidase (FAβO) ELISA kit (RC-E109423A) of Tianjin Ruichuang Biotechnology Co., Ltd.

[0031] Quantification of pine wood nematode load in Monochamus alternatus: To quantify the pine wood nematode load in Monochamus alternatus, total DNA was extracted according to the DNA extraction kit (DP304, Beijing Tiangen Biochemical Technology Co., Ltd.). The integrity of the DNA sample was determined by 1% agarose gel electrophoresis, and the DNA purity (A260 / A280) and concentration were detected by a spectrophotometer (Thermo NanoDrop 2000). The extracted sample DNA was stored at -80°C for future use. [Li, Y., Chen, H., Chu, X., Ma, Q., Liang, G., Wu, S., Wang, R., Tigabu, M., Zhang, F., et al. (2020). Molecular Cloning and Expression Analysis of the Endogenous Cellulase Gene MaCel1in Monochamus alternatus . Forests, 11(12), 1372.; Wang, F., Chen, Q., Zhang, R., Li, D., Ling, Y., and Song, R. (2019). The anti-phytoalexin gene Bx-cathepsin W supports the survival of Bursaphelenchus xylophilus under Pinus massoniana phytoalexin stress. BMC Genom., 20(1), 779.】The gene-specific primers and internal reference primers mentioned in the article were used on the QuantStudioTM 6Flex Real-Time PCR System (Thermo Fisher Scientific). The HieffTM qPCR SYBR Green Master Mix (Low Rox Plus, 11202ES08, Shanghai Yisheng Biotechnology Co., Ltd.) kit was used and all operations were completed on ice. The reaction system is shown in Table 3-1. The reaction procedure is: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 10 s, 55℃ annealing for 20 s, 72℃ extension for 20 s, and 40 cycles. The reaction corresponding to each primer contained 20 biological replicates (QZ and YP: 10 females and 10 males; F and M: 20 females and 20 males) and 3 technical replicates. The CT value method (2 −ΔΔCT ) Calculate the amount of pine wood nematodes carried by pine beetles.

[0032] The sequence of the internal reference primer is: Forward primer: 5'-AGAAAGTTATTATCTCCGCTCCA-3' Reverse primer: 5'-CCATACCAGTTAGTTTGCCATT-3' The gene-specific primer sequences are: Forward primer: 5'-TTGCATTCTACGGCCAGTCC-3' Reverse primer: 5'-ACTGACTTTCGATGGCTCCG-3' The results showed that Monochamus alternatus MaCPT1 Gene silencing can cause a decrease in the β-oxidation rate of fatty acids in Monochamus alternatus, leading to an increase in the amount of pine wood nematodes carried by Monochamus alternatus ( Figure 3 , Figure 4 ).

[0033] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. Genes regulating fatty acid β-oxidation in Monochamus alternatus MaCPT1 , characterized in that: The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by it is shown in SEQ ID NO.

2.

2. The fatty acid β-oxidation regulatory gene of Monochamus alternatus according to claim 1 MaCPT1 The application is characterized by: Any one or more of the following: 1) Application in regulating the β-oxidation rate of fatty acids in Monochamus alternatus; 2) Application in regulating the ability of Monochamus alternatus to carry pine wood nematodes; 3) Application in the prevention and control of pine wood nematodes.

3. The use according to claim 2, characterized in that: The method of regulating the fatty acid β-oxidation rate of Monochamus alternatus is to reduce the fatty acid β-oxidation regulatory gene of Monochamus alternatus MaCPT1 The expression level of pine needles reduces the rate of fatty acid β-oxidation in pine needles.

4. The use according to claim 2, characterized in that: The method of regulating the ability of pine beetle to carry pine wood nematodes is to reduce the β-oxidation regulatory gene of pine beetle fatty acid MaCPT1 The expression level of pine beetle improves the ability of pine beetle to carry pine wood nematodes.

5. The fatty acid β-oxidation regulatory gene of Monochamus alternatus according to claim 1 MaCPT1 The fluorescent quantitative primer pair is characterized by: The sequence of the fluorescent quantitative primer pair is: Forward primer: 5'-CGAGAATGCCTTGAAAGTAGCA-3', Reverse primer: 5′-ACAGGTCGAAGAGTTTCCGT-3′.

6. The fatty acid β-oxidation regulatory gene of Monochamus alternatus according to claim 1 MaCPT1 The dsRNA is characterized by: The dsRNA is a double-stranded RNA consisting of a nucleotide sequence shown in SEQ ID NO.4 and a nucleotide sequence that is reverse complementary to the nucleotide sequence shown in SEQ ID NO.

4.

7. The method for preparing dsRNA according to claim 6, characterized in that: Genes regulated by fatty acid β-oxidation in Monochamus alternatus MaCPT1 A dsRNA primer pair is designed and a DNA with a T7 promoter sequence is obtained by PCR amplification. The DNA with a T7 promoter sequence is used as a template to synthesize dsRNA by in vitro transcription. The nucleotide sequence of the DNA with a T7 promoter sequence is shown in SEQ ID NO.

3.

8. The preparation method according to claim 7, characterized in that: The sequence of the dsRNA primer pair is: Sense strand primer: 5'-TAATACGACTCACTATAGGGTCATGGCTCACCTTTGGGA-3', Antisense primer: 5′-TAATACGACTCACTATAGGCTGTCTATGCCCTTTCCGCA-3′.

9. The use of the dsRNA according to claim 6, characterized in that: Any one or more of the following: 1) Application in reducing the β-oxidation rate of fatty acids in Monochamus alternatus; 2) Application in improving the ability of Monochamus alternatus to carry pine wood nematodes; 3) Application in the prevention and control of pine wood nematodes.

10. A method for reducing the fatty acid β-oxidation rate of Monochamus alternatus and / or improving the ability of Monochamus alternatus to carry pine wood nematodes, characterized in that: The dsRNA according to claim 6 is injected into the body of Monochamus alternatus, and the injection site is the pronotum of Monochamus alternatus.

Images