Peanut seed size related gene AhARF2-2, encoding protein and application of peanut seed size related gene AhARF2-2

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to a peanut seed size character related gene AhARF2-2, encoding protein and application of the peanut seed size character related gene AhARF2-2. According to the invention, the peanut seed size related gene AhARF2-2 is confirmed. The molecular marker is located on a No.08 chromosome, 275bp deletion and 7bp insertion exist on a 12th exon in a large fruit material, the 12th exon is terminated in advance on a 13th exon, and correlation analysis finds that structural variation on the 12th exon is remarkably correlated with the size of a peanut seed. The result of heterologous overexpression in arabidopsis shows that the AhARF2-2 negatively regulates and controls the grain size. The method can be used for researching molecular mechanisms for controlling related characters of the peanut grain size, and has important application value in the aspect of peanut breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to a gene related to peanut seed size. AhARF2-2 , encoded proteins and their applications. Background Art

[0002] Peanuts are also known as groundnuts, longevity nuts, ground beans, etc. Their entire body is a treasure. Arachis hypogaea L.) belongs to the Leguminosae family ( Leguminosae ), Fabaceae ( Papilionoideae ), Arachis ( Arachis ), is an allotetraploid (AABB, 2n = 40). Studies have shown that peanuts originated in South America about 6,000 years ago, and later spread to all parts of the world through maritime trade routes and other means. Currently, they are mainly distributed in more than 100 countries and regions in Asia, Africa and America.

[0003] Peanut seeds contain about 50% oil and 25% to 30% protein, and are an important source of vegetable oil and protein. They provide 48% of high-quality edible oil and 25% of high-quality vegetable protein for semi-arid tropical regions. Peanuts also contain a variety of essential nutrients for the human body. In addition, peanut cakes after oil extraction from peanut seeds are also high-quality high-protein animal feeds. Peanut vines and peanut shells contain a large amount of crude fiber and crude protein, which can be crushed and mixed into feed to feed livestock, which can reduce feeding costs. They can also be used as fermentation substrates and can be used as substrates for cultivating edible fungi after being crushed.

[0004] According to data released by the Food and Agriculture Organization of the United Nations (https: / / www.fao.org / faostat / zh / #data / QCL / visualize), the total peanut production in the world in 2022 is about 54.24 million tons, and the total planting area is about 30.54 million hectares. Peanut is an important oil crop in my country, and its total output ranks first in the world, accounting for more than half of the country's total oil production. According to data from the National Bureau of Statistics, the planting area of ​​peanuts in my country has steadily increased in recent years, and the national peanut planting area reached 4,683.80 thousand hectares in 2022. The national peanut production reached 18.3295 million tons in 2022. my country is the world's largest peanut exporter. By 2020, the scale of peanut trade in the country has exceeded 11 billion yuan, and the export volume of peanut products accounts for 20% to 30% of the world's peanut trade volume. Although my country's peanut yield has continued to increase in recent years with the renewal of varieties and the improvement of cultivation technology, there is still a certain gap. It increased by 452.89 kg / ha, from 3,460.48 kg / ha in 2010 to 3,913.37 kg / ha in 2022. However, there is still a large gap compared with the international advanced level.

[0005] my country's current peanut supply capacity is far from meeting market demand, and the reason is that it is affected by the yield level. Peanut yield is mainly affected by the number of plants per unit area, the number of fruits per plant, and the fruit weight. In particular, the traits related to peanut pods are the direct traits that determine peanut yield. In recent years, researchers have used different types of materials to construct different populations and used a variety of molecular markers to locate multiple QTLs related to pods and grains. However, since the yield traits of peanuts are easily affected by the environment, and the cultivated peanuts are allotetraploids with large genomes and complex structures, few key genes have been cloned in recent years and their molecular mechanisms have been elucidated. The lack of research on the genetic basis of peanut yield-related traits is a "bottleneck" that restricts high-yield breeding. Exploring peanut yield-related traits, especially functional genes closely related to yield such as grain size, and analyzing their genetic basis and molecular regulatory mechanisms, will be an effective way for peanuts to break through the bottleneck of high-yield breeding. Summary of the invention

[0006] The purpose of the present invention is to provide a peanut seed size related gene AhARF2-2 , the encoded protein and its application in breeding. To solve the problem of lack of new genes related to peanut seed size and provide more options for peanut breeding.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is: A peanut seed size-related gene AhARF2-2 The genomic nucleotide sequence thereof is shown in SEQ ID NO.1.

[0008] Provide a peanut seed size-related gene AhARF2-2 , its full-length cDNA nucleotide sequence is: (1) the nucleic acid sequence shown in SEQ ID NO.2; (2) A nucleic acid sequence derived from the nucleic acid sequence shown in SEQ ID NO.2 and having equivalent functions.

[0009] The present invention provides a protein AhARF2-2 encoded by a peanut seed size-related gene, the amino acid sequence of which is: (1) the amino acid sequence shown in SEQ ID NO.3; (2) The sequence of an active fragment or conservative variant is obtained by adding, deleting or replacing one or more amino acids on the basis of the amino acid sequence shown in SEQ ID NO.3.

[0010] Furthermore, the present invention provides a method for amplifying the peanut seed size-related gene. AhARF2-2 A primer pair for the full length or any fragment thereof, the primer pair is as follows: AhARF2-2_1F: 5'-GATCTGTGTTTGTCGGAGAA -3'; AhARF2-2_1R: 5'- CCTTCCATTGACATCCAGT -3'; AhARF2-2_2F: 5'-CTTCACCAGCAAATGGATTC -3'; AhARF2-2_2R: 5'- CTAATTATCGTGGACCATAGC -3'; Furthermore, the present invention provides a method for producing a peanut seed size-related gene AhARF2-2 The recombinant plasmid is a gene related to peanut seed size AhARF2-2 The CDS was inserted into the pCAMBIA1300-GFP plant overexpression vector.

[0011] The present invention also provides a breeding method for large-grain peanut varieties, which comprises the following steps: selecting an excellent variety containing a large-grain genotype as a donor parent and hybridizing it with a recipient parent, performing testing on F2, selecting plants carrying large-grain related markers, and simultaneously performing field trait identification; The selected excellent plants are self-pollinated until the traits are stable (usually to the F6 generation). The excellent lines of the stable generation are tested in multiple regions to evaluate their yield, fruit size, disease resistance and other agronomic traits; The selection of the superior varieties containing the large-seed genotype is carried out by testing and determining whether they contain the peanut seed size-related gene AhARF2-2 , and there are structural variations; More specifically, the following steps are included: AhARF2-2 PCR amplification is performed to determine whether there is a structural variation, specifically by PCR amplification of the gene region or sequencing. If a deletion exists, it is a large particle material, and if no deletion exists, it is a small particle material.

[0012] The present invention also provides a method for breeding large-seed peanut varieties, characterized in that the endogenous peanut genes such as peanut seed size-related genes are modified by genetic engineering. AhARF2-2 Knockouts are performed or structural variations are generated to obtain transgenic peanuts with large kernels, which are optionally further developed into peanut varieties.

[0013] More specifically, the genetic engineering method is editing technology or RNAi technology, etc.

[0014] Compared with the prior art, the beneficial technical effects of the present invention are: 1. This invention discloses and confirms for the first time a new peanut seed size gene, named AhARF2-2, the gene is located on peanut chromosome 08, AhARF2-2 HapI The CDS sequence length is 2595 bp, containing 14 exons, and the protein it expresses is 865 amino acids long. AhARF2-2 HapII The CDS sequence is 1917 bp long, contains 13 exons, and the protein it expresses is 639 amino acids long.

[0015] 2. The present invention identifies genes related to peanut seed size AhARF2-2 The DNA sequence, CDS sequence and protein coding sequence can be used to breed large-grain peanut varieties, laying a foundation for the application practice of peanut breeding.

[0016] 3. The present invention helps to reveal the molecular genetic basis of peanut seed size, and plays an important role in using genetic engineering technology to increase peanut yield and quickly and efficiently cultivate high-yield peanut varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 for AhARF2-2 Gene structure characteristics; Figure 2 for AhARF2-2 Conserved domains and protein tertiary structural features; Figure 3 for AhARF2-2 Overexpression of Arabidopsis seed traits. Figure A shows the seed traits of the overexpression strain; Figure B shows AhARF2-2 HapI / HapII The relative expression of genes in the overexpressing Arabidopsis lines is shown in the bar graph; Figure C is a comparative bar graph of seed area of ​​seeds of overexpressing Arabidopsis plants; Figure D is a comparative bar graph of seed width of seeds of overexpressing Arabidopsis plants; Figure E is a comparative bar graph of seed length of seeds of overexpressing Arabidopsis plants. Significant differences were analyzed by ANOVA followed by post hoc Tukey's multiple comparison test and are indicated by lowercase letters above each bar graph. DETAILED DESCRIPTION

[0018] The specific implementation modes of the present invention are described below in conjunction with the accompanying drawings and examples. However, the following examples are only used to illustrate the present invention in detail and do not limit the scope of the present invention in any way.

[0019] Unless otherwise specified, the instruments and equipment involved in the following examples are all conventional instruments and equipment; unless otherwise specified, the reagents involved are all commercially available conventional reagents; unless otherwise specified, the test methods involved are all conventional methods. The quantitative tests in the following examples were repeated three times, and the results were averaged. Primer synthesis and sequencing were completed by Sangon Biotech (Shanghai) Co., Ltd.

[0020] Example 1: Peanut seed size-related genes AhARF2-2 Acquisition Genome-Wide Association Studies (GWAS) explored genes associated with peanut seed size, as follows: (1) To identify the gene that controls peanut seed size, we performed phenotypic analysis on 269 peanut materials, resequenced the materials, and then performed association analysis based on the detected structural variations (SVs). We finally screened for a gene located on chromosome 08. Arahy.EBLC22 There is an SV in the gene that may be associated with peanut seed size, among which there are 151 small-fruit materials (pod length <30 mm) and 47 large-fruit materials (pod length >38 mm), respectively. Arahy.EBLC22 Belonging to the ARF transcription factor, it is further named AhARF2-2 .

[0021] Then use H7500 and HZP06 to AhARF2-2 Make a clone 。 H7500( AhARF2-2 HapI SV is absent) belongs to small fruit (pod length <30 mm), HZP06 ( AhARF2-2 HapII The presence of SV) is large-fruited with pod length >38 mm, and there are significant differences between the two in pods and seeds.

[0022] (3) To verify whether the above-mentioned difference in seed size between H7500 and HZP06 is caused by genes AhARF2-2 The DNA and CDS sequences of the gene were cloned and sequenced in H7500 and HZP06, respectively.

[0023] The specific steps are as follows: 1.1 DNA extraction The DNA of H7500 and HZP06 were extracted using the SLS method.

[0024] 1.2 Total RNA extraction and first-strand cDNA synthesis RNA extraction from different peanut tissues was performed using the RNA room temperature extraction kit (RC411, Novozyme, Nanjing, China) of Nanjing Novozyme Biotechnology Co., Ltd. Total RNA from different tissues of H7500 and HZP06 was extracted respectively. RNA that met the quality standards was reverse transcribed and synthesized into cDNA using a reverse transcription kit, and then the RNA was synthesized using the TransScript® One-Step gDNA Removaland cDNA Synthesis SuperMix Kit (AT311-02, Quanshijin, Beijing, China).

[0025] 1.3 AhARF2-2 Gene cloning and sequence analysis PCR primers were designed by segmented cloning, and the primer designs were as follows: AhARF2-2_1F: 5'-GATCTGTGTTTGTCGGAGAA-3'; AhARF2-2_1R: 5'- CCTTCCATTGACATCCAGT -3'; AhARF2-2_2F: 5'- CTTCACCAGCAAATGGATTC -3'; AhARF2-2_2R: 5'- CTAATTATCGTGGACCATAGC -3'; Using DNA from H7500 and HZP06 as templates, PCR amplification was performed with AhARF2-2_1 / _2 using the high-fidelity enzyme KOD-Plus-Neo (KOD-401, Toyobo, Japan). The PCR products were subjected to 1% agarose gel electrophoresis and then recovered and connected to 5xTA / Blunt-Zero Cloning Kit (C601-01, Novozymes, Nanjing, China). After bacterial inspection, the correct monoclonal clones were selected and sent to Shanghai Biotechnology for sequencing, followed by sequence splicing.

[0026] The cDNA after reverse transcription of H7500 and HZP06 was used as a template and the high-fidelity enzyme KOD-Plus-Neo (KOD-401, Toyobo, Japan) was used with primers AhARF2-2F / R. The primer sequences are as follows: AhARF2-2F: 5'-ATGGCATCATCGGAGGCAG -3'; AhARF2-2 HapI R: 5'-CTAATTATCGTGGACCATAGCCAC-3'; AhARF2-2 HapIIR: 5'-TTAGTGGTTTGGCCTGACCATTCT -3'; PCR amplification was performed separately, and the PCR products were subjected to 1% agarose gel electrophoresis and connected to 5 x TA / Blunt-Zero Cloning Kit (C601-01, Novozymes, Nanjing, China) after recovery. After that, the correct monoclonal clones were selected after bacterial examination and sent to Bioengineering for sequencing.

[0027] The sequencing results showed that the DNA fragments obtained by PCR amplification using peanut H7500 and HZP06 DNA as templates were AhARF2-2 The genome level sequence of the gene is shown in the sequence listing SEQ ID NO.1.

[0028] PCR amplification using peanut H7500 and HZP06 cDNA as template AhARF2-2 cDNA sequence of the gene, clone CDS length AhARF2-2 HapI 2595 bp AhARF2-2 HapII It is 1917 bp as shown in SEQ ID NO.2. AhARF2-2 HapII compared to AhARF2- 2 HapI It has a structural variation, with a 268 bp SV deletion at 3560 bp of the gene and a 7 bp insertion, which results in a stop codon at 3913 bp of the fourteenth exon, leading to premature termination ( Figure 1 ). Its amino acid sequence is shown in SEQ ID NO.3. AhARF2-2 The structure of the gene was predicted, AhARF2-2 HapI It contains three conserved domains: an N-terminal B3 DNA binding domain (DBD, PF02362) that interacts with AuxREs in the upstream promoter region of auxin-responsive genes; an intermediate region auxin response factor (MR, PF06507), which is a non-conserved region that activates or inhibits the function of target genes; and an AUX / IAA domain (PF02309) at the C-terminus. HapII The C-terminal AUX / IAA domain is missing ( Figure 2 ). AhARF2-2 HapI The CDS sequence length is 2595 bp, containing 14 exons, and the protein it expresses is 865 amino acids long. AhARF2-2 HapII The CDS sequence is 1917 bp long, contains 13 exons, and the protein it expresses is 639 amino acids long.

[0029] Embodiment 2: AhARF2-2 Obtaining and Identifying Heterologous Overexpression Arabidopsis (1) Construction of plant overexpression vector Overexpression vector construction: Sequencing the correct junction AhARF2-2 The T plasmid containing the gene was used as a template. pCAMBIA1300-AhARF2-2 HapI -GFP F / R and pCAMBIA1300-AhARF2-2 HapII -GFP F / R Add homology arm primers for PCR amplification.

[0030] pCAMBIA1300- AhARF2-2 HapI --GFP_F:5'-AGAACACGGGGGGACGATGGCATCATCGGAGGCAG-3'; pCAMBIA1300- AhARF2-2 HapI -GFP_R: 5'-CTAGAGGATCCCCGGATTATCGTGGACCATAGCCACACT-3'; pCAMBIA1300- AhARF2-2 HapII --GFP_F:5'-AGAACACGGGGGGACGATGGCATCATCGGAGGCAG-3'; pCAMBIA1300- AhARF2-2 HapII -GFP_R: 5'-CTAGAGGATCCCCGGGTGGTTTGGCCTGACACACTT-3'; Restriction enzymes were used to overexpress the pCAMBIA1300-GFP vector Kpn I-HF (Star Select Enzyme) and Sac I-HF (Star Select), 37℃ digestion reaction for 30 min, 65℃ heat inactivation for 20 min for double digestion, then run 1% agarose for PCR products and digestion products, and then recover the products. According to the homologous recombination kit (C112, Novozymes, Nanjing, China), insert 4 μl of fragment, 3 μl of linear vector, 2 μl of 5 × CE II Buffe, 1 μl of Exnase I in a metal bath at 37℃ for 30 min for ligation. The ligated vector was transferred into DH5α Escherichia coli competent cells and coated on a culture dish containing 50 mg / L kanamycin (Kanamycin, Kan). Then, the 1300_GFP-F / R primer was used for bacterial detection, and the correct monoclonal bacterial solution was sent to Shanghai Shenggong Biological Company for sequencing.

[0031] 1300_GFP-F: 5'-ATGGTGAGCAAGGGCGAGGAGCT-3'; 1300_GFP-R: 5'-ACCGATGATACGAACGAAAG-3'; Final Build pCAMBIA1300-AhARF2-2 HapI / HapII -GFP The vector was transferred into Shanghai Weidi GV3101 Agrobacterium tumefaciens, spread on YEP solid medium containing 50 mg / L Kan and 25 mg / L rifampin (Rif) resistance, cultured at 28℃ for 2 to 3 days, and single clones were picked for examination.

[0032] (2) AhARF2-2 HapI / HapII Obtaining heterologous overexpression Arabidopsis Will pCAMBIA1300-AhARF2-2 HapI / HapII -GFP The cells were transformed into Arabidopsis thaliana by Agrobacterium infection.

[0033] (3) PCR identification of transgenic Arabidopsis The hygromycin tag (Hyg) was used for screening on 30 mg / L hygrovetine (hyg) screening medium, and the T1 generation transgenic plants were positively identified using the Hyg-1F / R primers. The primer sequences are as follows: Hyg-F: 5'-CGAGTACTTCTACACAGCCATC-3'; Hyg-R: 5'-TCCACTATCGGCGAGTACTTCT -3'; After multiple generations, single-copy transgenic strains with similar expression levels were selected for motif culture, and the T3 generation homozygous transgenic strains were obtained: OE-7-1 , OE-7-3 , OE-7-5 , OE-Z-3 , OE-Z-11 and OE-Z-12 ( Figure 3 ). The results show that OE-Z-3 , OE-Z-11 and OE-Z-12 The surface area and length of the seeds are similar to Col-0 There was no significant difference, but both were significantly greater than OE-7-1 , OE-7-3 and OE-7-5The results show that AhARF2-2 Negatively correlated with seed size, AhARF2-2 HapII The lack of the C-terminal AUX / IAA domain may have resulted in the loss of inhibitory function.

[0034] therefore, AhARF2-2 HapI Heterologous overexpression of Arabidopsis thaliana OE-7-1 , OE-7-3 and OE-7-5 The grain size is smaller than that of the wild type. AhARF2-2 HapII There is a SV lacking the C-terminal AUX / IAA domain, and its heterologous overexpression in Arabidopsis thaliana material has a similar grain size to wild type OE-Z-3 , OE-Z-11 and OE-Z-12 There is not much difference, which means that its inhibitory function has been lost.

[0035] In summary, the peanut pod size trait-related genes of the present invention AhARF2-2 It may regulate the size of peanut seeds and can be used to study the molecular mechanism that controls peanut seed traits, which has important application value in peanut breeding.

[0036] The present invention has been described in detail above with reference to the accompanying drawings and embodiments. However, those skilled in the art will appreciate that, without departing from the spirit of the present invention, the specific parameters in the above embodiments may be changed to form a plurality of specific embodiments, which are all within the common variation range of the present invention and will not be described in detail herein.

Claims

1. A gene related to peanut seed size AhARF2-2 , characterized in that, The genomic nucleotide sequence thereof is shown as SEQ ID NO.

1.

2. A peanut seed size-related gene AhARF2-2 , its full-length CDS nucleotide sequence is: (1) the nucleic acid sequence shown in SEQ ID NO.2; or (2) A nucleic acid sequence derived from the nucleic acid sequence shown in SEQ ID NO.2 and having equivalent functions.

3. A protein AhARF2-2 encoded by a peanut seed size-related gene, whose amino acid sequence is: (1) the amino acid sequence shown in SEQ ID NO.3; or (2) The sequence of an active fragment or conservative variant is obtained by adding, deleting or replacing one or more amino acids on the basis of the amino acid sequence shown in SEQ ID NO.

3.

4. An expression vector constructed by the gene according to any one of claims 1 to 3.

5. A recombinant bacterium constructed by the expression vector according to claim 5.

6. Use of the gene according to any one of claims 1 to 3 in preparing transgenic plant cells.

7. Use of the gene according to any one of claims 1 to 3 and / or the protein according to claim 4 in peanut breeding; preferably, the breeding is to cultivate large-grain peanut varieties.

8. A method for breeding large peanut varieties, characterized in that: The method comprises the following steps: selecting an excellent variety containing a large-grain genotype as a donor parent and hybridizing it with a recipient parent, performing testing on F2, selecting plants carrying large-grain-related markers, and simultaneously performing field trait identification; The selected excellent plants are self-pollinated until the traits are stable (usually to the F6 generation); the excellent strains of the stable generation are tested in multiple regions to evaluate their yield, fruit size, disease resistance and other agronomic traits; The selection of the superior varieties containing the large-seed genotype is carried out by detecting and determining that they contain the peanut seed size-related gene as described in claim 1 AhARF2-2 , and there are structural variations; More specifically, the following steps are included: AhARF2-2 PCR amplification is performed to determine whether there is a structural variation, specifically by PCR amplification of the gene region or sequencing. If a deletion exists, it is a large particle material, and if no deletion exists, it is a small particle material.

9. A method for breeding large peanut varieties, characterized in that: Using genetic engineering to modify endogenous genes such as peanut seed size AhARF2-2 Knockout is performed to obtain transgenic peanut with large kernel material, which is optionally further developed into peanut varieties.

10. The cultivation method according to claim 9, characterized in that The genetic engineering method is gene editing technology or RNAi technology.

Images