Application of plasmid elimination module based on repressor protein

Abstract

The invention relates to the field of gene engineering, in particular to application of a plasmid elimination module based on repressor protein, and the plasmid elimination module is used for selective elimination of a specified object plasmid or synchronous elimination of several specified object plasmids. The method is high in elimination efficiency, elimination objects can be freely set according to needs, and selective or synchronous elimination of various plasmids can be realized.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and in particular to an application of a plasmid elimination module based on a repressor protein. Background Art

[0002] Free plasmids are a universal platform for genetic manipulation of animal, plant and microbial cells, and can be used for purposes such as genome editing, heterologous protein expression, and gene circuit construction. However, when genome editing or gene circuit plasmids are used to achieve the purpose of genome editing or gene circuit design, the genome editing tools or gene circuits carried on the plasmids become unstable factors in the cell genome. At this time, the plasmids need to be eliminated to obtain plasmid-free cells. The current plasmid elimination technologies are mainly divided into three types, namely, temperature-sensitive replicon plasmid elimination, sacB plasmid elimination, and CRISPR protein-related plasmid elimination technology.

[0003] Thermosensitive replicon plasmid elimination efficiency is low, and it is often used for low-copy plasmid elimination, but it is not effective for medium- and high-copy plasmid elimination. In addition, the same replicon in the same cell can generally only serve one plasmid at the same time. If the thermosensitive replicon is used to serve multiple plasmids, the spontaneous loss of plasmids may be aggravated, which is not conducive to the development of related experiments or production work.

[0004] Plasmid elimination based on the sacB gene can serve multiple plasmids at the same time, but when multiple plasmids exist in the cell, the plasmid elimination method based on the sacB gene cannot accurately eliminate specific types of plasmids, and its tolerance to mutations is weak and it is prone to failure.

[0005] Plasmid elimination technology based on CRISPR protein can eliminate multiple plasmids at the same time and freely select the type of plasmid to be eliminated, but there is a risk of CRISPR protein gene mutation failure or CRISPR protein cutting off-target, and the gene sequence of CRISPR-related protein elements is long, which is not conducive to use in chassis microorganisms that are difficult to transfer large plasmids. When there is no natural CRISPR protein available in the chassis cells, additional plasmids with CRISPR proteins need to be transferred, and the failure rate of self-targeted elimination of plasmids with CRISPR proteins is high. Summary of the invention

[0006] The present invention proposes a plasmid elimination technology based on antisense RNA, designs the application of a plasmid elimination module, which can promote the loss of free plasmids with a low spontaneous loss rate in cells, can efficiently achieve the selective elimination or synchronous elimination of multiple free plasmids, can be applied to the selective elimination or synchronous elimination of different types (copy numbers) of free plasmids in eukaryotic and prokaryotic cells, and has better tolerance to sequence mutations than the plasmid elimination technology based on CRISPR protein. The gene sequence length of the related protein element is smaller than that of CRISPR, and it is still applicable to chassis cells that are difficult to transfer large plasmids.

[0007] Antisense RNA designed for key metabolic genes can reduce the expression of key metabolic genes, thereby affecting the cell growth rate. During cell amplification and passage, plasmids are randomly distributed to offspring. The number of offspring cells containing the plasmids of this elimination module will decrease, while the number of offspring cells without the plasmids of this elimination module will increase due to rapid growth, thereby achieving the purpose of enriching plasmid-free cells and achieving plasmid elimination.

[0008] The plasmid elimination module designed by the present invention can be deployed in the cell where the plasmid to be eliminated is located, except for the antisense RNA expression region which must be deployed on the plasmid to be eliminated. After the deployment is completed, the plasmid elimination module designed by the present invention can efficiently achieve plasmid elimination within the deployment range.

[0009] The significance of the present invention lies in proposing a universal plasmid elimination module construction idea that is convenient, usable, programmable, widely adaptable, highly stable, and requires a shorter sequence. Under the condition that the prerequisites are met, the plasmid elimination module can be used for the elimination of constructed plasmids after the construction of genetically engineered bacteria, the elimination of artificially constructed plasmids, and can also be used in conjunction with sequence editing tools to achieve the elimination of natural plasmids in cells.

[0010] In order to achieve the above object, the present invention adopts the following technical solution:

[0011] An application of a plasmid elimination module based on a repressor protein, characterized in that it is used for the selective elimination of a designated target plasmid or the selective simultaneous elimination of several designated target plasmids.

[0012] According to an embodiment of the present invention, the plasmid elimination module includes two types of independent expression regions, one of which is the repressor gene transcription region, which is composed of the constitutive promoter of the repressor gene, including its RNA polymerase binding site and transcription start site, ribosome binding site, repressor translation region, and terminator; the other type of region is the antisense RNA expression region, which is composed of a constitutive promoter, a repressor binding site, antisense RNA and a terminator; the antisense RNA is the antisense RNA of the key metabolic gene mRNA, which can bind to the key metabolic gene mRNA to hinder the translation of the key metabolic gene mRNA.

[0013] According to an embodiment of the present invention, the repressor protein is a repressor protein that can bind to a specific DNA sequence, inhibit downstream DNA transcription after binding, can be activated or deactivated by a compound, and does not affect the growth of chassis cells. The repressor protein binding site binds to the repressor protein and prevents RNA polymerization from passing through or crossing the binding site to transcribe the DNA sequence downstream of the binding site.

[0014] According to an embodiment of the present invention, the repressor protein gene is a LacI protein gene, and the repressor protein binding site is a LacI protein binding site.

[0015] According to an embodiment of the present invention, the constitutive promoter is a specific DNA sequence that can bind to RNA polymerase with a certain strength in the cell and initiate the transcription function of RNA polymerase to transcribe downstream functional sequences and antisense RNA.

[0016] According to an embodiment of the present invention, the constitutive promoter includes T7, tet, trc, trp, J23119 promoter, tac, and constitutive promoters related to the resistance genes of chloramphenicol, kanamycin, and penicillin commonly used antibiotics in Corynebacterium glutamicum.

[0017] According to an embodiment of the present invention, the plasmid elimination module is mounted in the plasmid to be eliminated.

[0018] According to an embodiment of the present invention, the plasmid to be eliminated is a circular or linear DNA that is stable and free in the cell and can replicate independently, or replicate with the genome and be passed to daughter cells.

[0019] According to an embodiment of the present invention, the plasmid to be eliminated includes any one of pet28A, PEC-XK99E, and yeast 2μ.

[0020] According to an embodiment of the present invention, the gene interfered by the antisense RNA is the antisense RNA of the mRNA of the key metabolic gene, which can bind to the mRNA of the key metabolic gene to hinder the translation of the mRNA of the key metabolic gene.

[0021] According to an embodiment of the present invention, the key metabolic genes are TCA cycle related genes, protein synthesis related genes, aerobic respiration related genes, anaerobic respiration related genes, lipid synthesis related genes, cell wall synthesis related genes, sugar transport pathway related genes, amino acid transport pathway related genes, ATP synthesis related genes, cytoskeleton synthesis related genes, NADPH / NADP + Synthesis-related genes, NADH / NAD + Synthesis-related genes, vitamin synthesis-related genes, one-carbon transport system-related genes, carbon dioxide fixation-related genes, DNA / RNA synthesis-related genes, amino acid synthesis-related genes, ribose synthesis-related genes, ribosome synthesis-related genes, ribosome assembly-related genes, aminoacyl-tRNA synthetase-related genes and isoenzyme genes of the above genes.

[0022] According to an embodiment of the present invention, the objects of elimination of the plasmid elimination module are all microorganisms, animals or plant cells that have stable free plasmids, have a probability of producing daughter cells without plasmids during proliferation, and the elimination of free plasmids will not cause cell death or inability to proliferate.

[0023] To facilitate those skilled in the art to understand the present invention, the main terms are explained as follows:

[0024] Gene circuit: A combination of DNA sequences that combines specific gene elements such as promoters, terminators, protein translation regions, and specific protein binding regions according to certain rules and arranges them at single sites or multiple sites to achieve specific functions.

[0025] Convenient and usable: The module can be stored in the form of PCR products / plasmids, and can be inserted into extracellular or intracellular plasmids through Gibson assembly, Golden Gate cloning, enzyme ligation, genome editing, etc.

[0026] Programmable: The module can be used regardless of the number of plasmid copies and can be selectively eliminated in cells containing multiple plasmids by combining different regulatory proteins.

[0027] Wide adaptability: The module can be used across species by means of codon optimization / replacement of related control elements.

[0028] Strong stability: Even if there is a certain sequence deviation between the antisense RNA and the target mRNA, it does not affect the function of the module proposed by the present invention.

[0029] The required sequence is shorter: when using cell background regulatory factors, the total length of the plasmid elimination module sequence proposed in the present invention can usually be less than 1kbp, or even less than 100bp. When using self-contained regulatory factors, the total length of the plasmid elimination module sequence proposed in the present invention usually does not exceed 3kbp.

[0030] Constructing plasmid: mainly refers to the tool plasmid that is equipped with the necessary functional proteins for genome editing to assist in achieving the purpose of genome editing in genetically engineered cells. This type of plasmid usually needs to be eliminated after the genome editing of the engineered cells is completed to avoid introducing or causing additional mutations in the application of engineered cells.

[0031] Artificially constructed plasmids: mainly refers to plasmids that are artificially constructed to express homologous / heterologous proteins or some functional gene circuits without involving genome editing.

[0032] Plasmid backbone: DNA sequence that carries the plasmid replicon and plasmid maintenance genes.

[0033] Free plasmid: can autonomously assist or replicate with the genome in the cell, can be distributed to daughter cells as the cell proliferates, and can stabilize linear or circular double-stranded DNA outside the free genome.

[0034] Constitutive promoter: A specific DNA sequence that can be recognized by the Escherichia coli sigma factor and recruit RNA polymerase subunits for downstream transcription.

[0035] The following are examples

[0036] E. coli related sequences

[0037] The complete sequence of the interference region of the Escherichia coli acnB gene:

[0038] ACTATGACAATGAGAGCGAGGAGAACCGTCGTGCTAGAAGAATACCGTAAGCACGTAG (omitted here, see the sequence list for details)

[0039] AAAGCCGATGGGGTGATTTTCCAGACTGCGGTTTAA (SEQ ID NO: 1)

[0040] pET28a plasmid full sequence:

[0041] TGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGC (omitted here, see the sequence list for details)

[0042] GTTTTTTGCTGAAAGGAGGAACTATATCCGGAT (SEQ ID NO: 2)

[0043] T7 promoter sequence (arrow indicates the direction of transcription initiation):

[0044] TAATACGACTCACTATAGG→(SEQ ID NO: 3)

[0045] Tet promoter sequence:

[0046] TTGACAGCTTATCATCGATTAGCTTTAAT→(SEQ ID NO: 4)

[0047] T7 terminator sequence (arrow indicates the direction of transcription termination):

[0048] →CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG (SEQ ID NO: 5) LacI protein expression cassette (including promoter, CDS region, terminator):

[0049] CGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAG (omitted here, see the sequence list for details)

[0050] TGACTCTCTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTG TC (SEQ ID NO: 6)

[0051] LacI protein binding site sequence:

[0052] GGAATTGTGAGCGGATAACAATTCC (SEQ ID NO: 7)

[0053] Corynebacterium glutamicum related sequences:

[0054] The complete sequence of the CDS region of the acn gene of Corynebacterium glutamicum:

[0055] TTGGAGCTCACTGTGACTGAAAGCAAGAACTCCTTCAATGCTAAGAGCACCCTTGAAGT (omitted here, see the sequence list for details)

[0056] CTGACTACTACCGCCACGGCGGCATCCTGCAGTACGTGCTGCGTCAGATGGCTGCTTCTT CTAAGTAA (SEQ ID NO: 8)

[0057] Corynebacterium glutamicum pEC-XK99E plasmid sequence:

[0058] GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGG (omitted here, see the sequence list for details)

[0059] TGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATG (SEQ ID NO: 9) trc promoter sequence (arrow indicates the direction of transcription initiation):

[0060] TTGACAATTAATCATCCGGCTCGTATAATG→(SEQ ID NO: 10)

[0061] rrnB T1 terminator sequence (arrow indicates transcription termination direction):

[0062] →

[0063] CAAATAAAACGAAAGGCTCAGTCGAAAGACTGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAAT (SEQ ID NO: 11)

[0064] LacI protein expression cassette (including promoter, CDS region, terminator):

[0065] GACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAG (omitted here, see the sequence list for details)

[0066] TAATTCGTGTCGCTCAAGGCGCACTCCCGTTCTGG (SEQ ID NO: 12)

[0067] LacI protein binding site sequence:

[0068] GGAATTGTGAGCGGATAACAATTCC (SEQ ID NO: 13)

[0069] Saccharomyces cerevisiae related sequences:

[0070] The complete sequence of the CDS region of the Saccharomyces cerevisiae ACO1 gene:

[0071] ATGCTGTCTGCACGTTCTGCCATCAAGAGACCCATTGTTCGTGGTCTTGCGACAGTCTCC (omitted here, see the sequence list for details)

[0072] GCAAATTGAATGGTTCAAATATGGTTCTGCCTTAAATAAAATTAAGGCCGATGAGAAGAA ATAA(SEQID NO: 14)

[0073] Saccharomyces cerevisiae 2μ shuttle plasmid sequence:

[0074] CAACTTTGTATAGAAAAGTTGACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGA (omitted here, see the sequence list for details) CCGCTACAGGGCGCGTGGGGATCGATCCACTAGT (SEQ ID NO: 15)

[0075] Saccharomyces cerevisiae neomycin sulfate resistance gene sequence (including promoter, expression cassette, terminator): GTGAGTTGAGTATACATGCATTTACTTATAATACAGTTTTTCAGAAGAACTCGTCAAGAA (omitted here, see sequence list for details)

[0076] ACTGGGCAATTTCATGTTTCTTTCAACACTACATATGCGTATATATACCAATCTAAGTCTGTGCTCCTTCCTTCGTTCTTCCTTCTG (SEQ ID NO: 16)

[0077] Shuttle vector E. coli replicon sequence:

[0078] TTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGT (omitted here, see the sequence list for details)

[0079] CGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAA (SEQ ID NO: 17)

[0080] Shuttle vector ampicillin resistance gene expression cassette (including promoter, expression cassette, terminator): GGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATAT (omitted here, see sequence list for details)

[0081] CAATGGGTAATAACTGATATAATTAAATTGAAGCTCTAATTTGTGAGTTGAGTATACATGC (SEQ IDNO: 18)

[0082] Saccharomyces cerevisiae constitutive promoter TEF1 sequence:

[0083] GATCCCCCACACACCATAGCTTCAAAATGTTTCTACTCCTTTTTTACTCTTCCAGATTTTC (omitted here, see the sequence listing for details)

[0084] TTTTTTACTTCTTGCTCATTAGAAAGAAAGCATAGCAATCTAATCTAAG (SEQ ID NO: 19) Saccharomyces cerevisiae LacI protein expression cassette (comprising promoter, expression cassette, terminator):

[0085] GATCCTTTTTTGTAGAAATGTCTTGGTGTCCTCGTCCAATCAGGTAGCCATCTCTGAAATA (omitted here, see the sequence list for details)

[0086] CGCCACCGCGTGGAGCTCCAGCTTTTGTT (SEQ ID NO: 20)

[0087] Yeast terminator CYC1 sequence:

[0088] ATCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCCCCCACATCCGCTCTAACCG (omitted here, see the sequence list for details)

[0089] CATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGGCTTTAATTTGCAAGCT (SEQ ID NO: 21)

[0090] The beneficial effects of the present invention are:

[0091] The present invention designs a modular plasmid elimination technology based on antisense RNA. The elements required for constructing the plasmid elimination module are simple and easy to obtain. The plasmid module has high elimination efficiency. The elimination object can be freely set according to the needs, and the selective or synchronous elimination of multiple plasmids can be achieved. And the present invention has a wide range of applications. The technology can be applied to eukaryotic prokaryotes. The genes related to the central metabolic pathway can all be combined with antisense RNA for plasmid elimination. The antisense RNA of the metabolic related genes such as amino acids, nucleic acids, lipid synthesis pathways, transcription and translation, DNA replication, cell wall, cell membrane, endoplasmic reticulum outside the central metabolic pathway can also be applied to this technology. If the elimination effect is not good, the elimination effect can be enhanced by increasing the types of antisense RNA, extending the length of antisense RNA and other strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0092] Figure 1 This is the interference result diagram of Example 5.

[0093] Figure 2 This is the interference result diagram of Example 6.

[0094] Figure 3 This is the interference result diagram of Example 7.

[0095] Figure 4 This is the interference result diagram of Example 8.

[0096] Figure 5 It is a schematic diagram of the principle of the present invention. DETAILED DESCRIPTION

[0097] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0098] The principle of antisense RNA to eliminate plasmids is: we place antisense RNA that can specifically bind to the mRNA of key metabolic genes such as TCA cycle-related genes, protein synthesis-related genes, DNA / RNA synthesis-related genes, amino acid synthesis-related genes, ribose synthesis-related genes, ribosome synthesis-related genes, and ribosome assembly-related genes downstream of the repressor protein binding site, and control the transcription of antisense RNA of key metabolic genes by adding / not adding repressor proteins. When antisense RNA is transcribed, antisense RNA can bind to the mRNA of key metabolic genes in the form of hydrogen bond pairing, thereby inhibiting the translation of key metabolic genes, making the growth rate of cells expressing antisense RNA significantly lower than that of cells that do not express antisense RNA. Due to the spontaneous loss of plasmids, plasmid-free cells can be enriched through subculture to achieve plasmid elimination. (Principle as Figure 5 (shown)

[0099] The repressor protein can controllably inhibit the expression of antisense RNA of the key metabolic gene on the plasmid to be eliminated, thereby achieving controllable cell growth inhibition, controllable plasmid-free cell enrichment and plasmid elimination.

[0100] Instruments and equipment:

[0101] 1.PCR instrument

[0102] 2. Electrophoresis apparatus

[0103] 3. Electrophoresis tank

[0104] 4. Ultra-low temperature refrigerator

[0105] 5. Biochemical incubator

[0106] 6. Autoclave

[0107] 7. Water bath

[0108] 8. Medical freezer

[0109] 9. Desktop Centrifuge

[0110] 10. Pipette

[0111] 11. Oven

[0112] 12.Electroshock converter and its matching 1mm electroshock cup

[0113] Reagents:

[0114]

[0115]

[0116] Biomaterials:

[0117] E. coli related plasmids and primers: Primers:

[0118] EP001:CTCGCTCTCATTGTCATAGTCTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGG (SEQ ID NO: 22)

[0119] EP002:

[0120] GACAATGAGAGCGAGGAGAAGGAATTGTTATCCGCTCACAATTCCCCTATAGTGAGTCG (SEQ IDNO: 23)

[0121] EP003:CATCGGTGATGTCGGCGATATAGG (SEQ ID NO: 24)

[0122] EP004:GCTAATCGATGATAAGCTGTCAAATTTCGCGGGATCGAGATCTCGATCCTC (SEQ ID NO: 25)

[0123] EP005:TTGACAGCTTATCATCGATTAGCTTTAATGGAATTGTGAGCGGATAACAATTCC (SEQ IDNO: 26)

[0124] EP006:

[0125] GAATACCGTAAGCACGTAGCTGAGCGTGCCGCTGGGAATTGTTATCCGCTCACAATTCC (SEQ IDNO: 27)

[0126] EP007:

[0127] CTACTGCTTACGGTATTCTTCTAGCACGACGGTTCTCCTGCTCTCATTGTCATAGTC (SEQ IDNO: 28)

[0128] Corynebacterium glutamicum related plasmids and primers:

[0129] Primers:

[0130] GP001:

[0131] CCTTCAATGCTAAGAGCACCCTTGAAGTTGGCGACAAGTCCTTGTTATCCGCTCACAATT CC(SEQID NO: 29)

[0132] GP002:

[0133] GGGTGCTCTTAGCATTGAAGGAGCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGG(SEQ ID NO: 30)

[0134] GP003: GCTGTGCAGGTCGTAAATCACTGC(SEQ ID NO: 31)

[0135] Plasmids and primers related to Saccharomyces cerevisiae:

[0136] Primers:

[0137] SP001: CGTATAACGTTACTGGTTTCACGGTGGCAGCCTGCTTTTTTGTACAAACTTGC(SEQ IDNO: 32)

[0138] SP002: GTGAAACCAGTAACGTTATACGATGTCGC(SEQ ID NO: 33)

[0139] SP003: GTTCACTGCCCGCTTTCCAGTCG(SEQ ID NO: 34)

[0140] SP004: GGAAAGCGGGCAGTGAACCCAGCTTTCTTGTACAAAGTGGTAGC(SEQ ID NO: 35)SP005: GAAGAAAGCGAAAGGAGCGGAGCTTGCAAATTAAAGCCTTCGAGC(SEQ ID NO: 36)

[0141] SP006: CCGCTCCTTTCGCTTTCTTCCCTTCC(SEQ ID NO: 37)

[0142] SP007: GCGGCGCATTAAGCGAGTTTACCACACACCATAGCTTCAAAATGTTTC(SEQ ID NO: 38)

[0143] SP008: TAAACTCGCTTAATGCGCCGCTACAGG(SEQ ID NO: 39)

[0144] SP009:

[0145] CAAGACCACGAACAATGGGTCTCTTGATGGCAGAACGTGCATCATGTAATTAGTTATGTC ACGC (SEQ ID NO: 40)

[0146] SP010:CCATTGTTCGTGGTCTTGCGACAGTCTCCAACTTGACTAGAGTTGTGAGCGGATAACAACTTAGATTAGATTGCTATGCTTTC (SEQ ID NO: 41)

[0147] SP011:GATTTAGAGCTTGACGGGGAAAGCC (SEQ ID NO: 42)

[0148] SP012:CTGATTCTGTGGATAACCGTATTACC (SEQ ID NO: 43)

[0149] Example 1 Construction of Escherichia coli T7 promoter + LacI repressor protein particle elimination module

[0150] (1) High-fidelity enzyme amplification and plasmid construction experiments:

[0151] 1. Design primers EP001 and EP002 to amplify the plasmid template pET28a plasmid system according to the following system and PCR program:

[0152]

[0153] PCR procedure:

[0154]

[0155] 2. Use the ready-to-use seamless cloning kit to assemble the SanPrep column PCR product purification kit, and purify the PCR products EP001-EP002 according to the instructions of the purification kit.

[0156] 3. Connect the purified products EP001-EP002 according to the operation procedures in the instructions of the ready-to-use seamless cloning kit.

[0157] 4. Follow the steps below to convert 5αChemically Competent Cells after overnight culture:

[0158] 1) Take 100 μL of competent cells melted on ice, add the ligation product in "3", mix gently (gently pipette or tap the tube wall several times), and let it stand on ice for 5 minutes.

[0159] 2) Heat shock in a 42°C water bath for 60 seconds, quickly transfer to an ice bath, and let stand for 2 minutes.

[0160] 3) Add 700 μL of sterile liquid culture medium (SOB or LB) without antibiotics into the centrifuge tube, mix well and resuscitate at 37°C, 200 rpm for 40 min.

[0161] 4) Take an appropriate volume of the resuscitation solution and spread it evenly on LB solid antibiotic medium containing 50ug / mL kanamycin, and culture it upside down in a 37°C incubator overnight.

[0162] (2) Construction result sequencing verification experiment:

[0163] Take a single colony obtained from the coated plate and send it for sequencing with EP003 primer to verify the construction result.

[0164] Plasmid construction results:

[0165] TGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTA (omitted here, see the sequence list for details)

[0166] TGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTGCTGAAAGGAGGAACTATATCCGGAT. (SEQ ID NO: 44)

[0167] The antisense RNA sequence is ACTATGACAATGAGAGCGAGGAGAA. (SEQ ID NO: 45)

[0168] (3) Plasmid extraction experiment:

[0169] According to the sequencing results in (2), a single colony available on the transformation plate in (1) was selected to inoculate 5 mL of LB liquid culture medium containing 50 ug / mL kanamycin for overnight activation, and plasmid extraction was completed according to the instructions of the Tiangen Plasmid Extraction Kit.

[0170] Example 2 Construction of Escherichia coli tet promoter + LacI repressor protein particle elimination module

[0171] (1) High-fidelity enzyme amplification and plasmid construction experiments:

[0172] 1. Design primers EP004 and EP005 to amplify the plasmid obtained by "T7 promoter + LacI repressor protein plasmid elimination module construction" according to the following system and PCR program.

[0173] system:

[0174]

[0175] PCR procedure:

[0176]

[0177] 2. Use the ready-to-use seamless cloning kit to assemble the SanPrep column PCR product purification kit, and purify the PCR products EP004-EP005 according to the instructions of the purification kit.

[0178] 3. Connect the purified products EP004-EP005 according to the operation procedures in the instructions of the ready-to-use seamless cloning kit.

[0179] 4. Follow the steps below to convert 5αChemically Competent Cells after overnight culture:

[0180] 1) Take 100 μL of competent cells melted on ice, add the target DNA (plasmid or ligation product), mix gently (gently pipette or tap the tube wall several times), and let it stand on ice for 5 minutes.

[0181] 2) Heat shock in a 42°C water bath for 60 seconds, quickly transfer to an ice bath, and let stand for 2 minutes (do not shake the sample during standing on ice, otherwise it will reduce the transformation efficiency).

[0182] 3) Add 700 μL of sterile liquid culture medium (SOB or LB) without antibiotics to the centrifuge tube, mix well, and resuscitate at 37°C, 200 rpm for 20 min (the conversion efficiency increases by 3 to 5 times for every 5 min increase in resuscitation time).

[0183] 4) Take an appropriate volume of the resuscitation solution and evenly spread it on LB solid culture medium containing 50ug / mL kanamycin, and culture it upside down in a 37℃ incubator overnight.

[0184] (2) Plasmid extraction experiment:

[0185] Select a single colony available on the transformation plate in (1) and inoculate 5 mL of LB liquid culture medium containing 50 ug / mL kanamycin for overnight activation, and complete plasmid extraction according to the instructions of the Tiangen Plasmid Extraction Kit.

[0186] (3) Second round of high-fidelity enzyme amplification and plasmid construction experiments:

[0187] 1. Design primers EP006 and EP007 to amplify the plasmid obtained in (2) according to the following system and PCR procedure.

[0188] system:

[0189]

[0190] PCR procedure:

[0191]

[0192] 2. Use the ready-to-use seamless cloning kit to assemble the SanPrep column PCR product purification kit, and purify the PCR products EP006-EP007 according to the instructions of the purification kit.

[0193] 3. Connect the purified products EP006-EP007 according to the operation procedures in the instructions of the ready-to-use seamless cloning kit.

[0194] 4. Follow the steps below to convert 5αChemically Competent Cells after overnight culture:

[0195] 1) Take 100 μL of competent cells melted on ice, add the ligation product in "3", mix gently (gently pipette or tap the tube wall several times), and let it stand on ice for 5 minutes.

[0196] 2) Heat shock in a 42°C water bath for 60 seconds, quickly transfer to an ice bath, and let stand for 2 minutes.

[0197] 3) Add 700 μL of sterile liquid culture medium (SOB or LB) without antibiotics into the centrifuge tube, mix well and resuscitate at 37°C, 200 rpm for 40 min.

[0198] 4) Take an appropriate volume of the resuscitation solution and evenly spread it on LB solid culture medium containing 50ug / mL kanamycin, and culture it upside down in a 37℃ incubator overnight.

[0199] (4) Construction result sequencing verification experiment:

[0200] Take a single colony obtained from the coated plate and send it for sequencing with EP003 primer to verify the construction result.

[0201] Plasmid construction results:

[0202] TGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTT (omitted here, see the sequence list for details)

[0203] CTCAGCTACGTGCTTACGGTATTCTTCTAGCACGACGGTTCTCCTCGCTCTCATTGTCATA

[0204] GTCTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGAT. (SEQ ID NO: 46)

[0205] The antisense RNA sequence is:

[0206] CAGCGGCACGCTCAGCTACGTGCTTACGGTATTCTTCTAGCACGACGGTTCCTCCTCGCTCTCATTGTCATAG. (SEQ ID NO: 47)

[0207] Example 3 Construction of Corynebacterium glutamicum trc promoter + LacI repressor protein plasmid elimination module

[0208] (1) High-fidelity enzyme amplification and plasmid construction experiments:

[0209] 1. Design primers GP001 and GP002 to amplify the plasmid template pEC-XK99E plasmid according to the following system and PCR procedure.

[0210] system:

[0211]

[0212] PCR procedure:

[0213]

[0214] 2. Use the ready-to-use seamless cloning kit to assemble the SanPrep column PCR product purification kit, and purify the PCR products EP001-EP002 according to the instructions of the purification kit.

[0215] 3. Connect the purified products GP001-GP002 according to the instructions of the ready-to-use seamless cloning kit.

[0216] 4. Follow the steps below to convert 5αChemically Competent Cells after overnight culture:

[0217] 1) Take 100 μL of competent cells melted on ice, add the ligation product in "3", mix gently (gently pipette or tap the tube wall several times), and let it stand on ice for 5 minutes.

[0218] 2) Heat shock in a 42°C water bath for 60 seconds, quickly transfer to an ice bath, and let stand for 2 minutes.

[0219] 3) Add 700 μL of sterile liquid culture medium (SOB or LB) without antibiotics into the centrifuge tube, mix well and resuscitate at 37°C, 200 rpm for 40 min.

[0220] 4) Take an appropriate volume of the resuscitation solution and evenly spread it on LB solid culture medium containing 50ug / mL kanamycin, and culture it upside down in a 37℃ incubator overnight.

[0221] (2) Construction result sequencing verification experiment:

[0222] Take a single colony obtained from the coated plate and send it for sequencing with GP003 primer to verify the construction result.

[0223] Experimental results:

[0224] CAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTT (omitted here, see the sequence list for details)

[0225] AACAAGGACTTGTCGCCAACTTCAAGGGTGCTCTTAGCATTGAAGGAG (SEQ ID NO: 48)

[0226] The antisense RNA sequence:

[0227] GGACTTGTCGCCAACTTCAAGGGTGCTCTTAGCATTGAAGGAG (SEQ ID NO: 49)

[0228] (3) Plasmid extraction experiment:

[0229] According to the sequencing results in (2), a single colony available on the transformation plate in (1) was selected to inoculate 5 mL of LB liquid culture medium containing 50 ug / mL kanamycin for overnight activation, and plasmid extraction was completed according to the instructions of the Tiangen Plasmid Extraction Kit.

[0230] Example 4 Construction of Saccharomyces cerevisiae constitutive promoter + LacI repressor protein particle elimination module

[0231] (1) High-fidelity enzyme amplification and plasmid construction experiments:

[0232] 1. Primers SP001-SP004 / SP009-SP010 amplify the plasmid template Saccharomyces cerevisiae 2μ plasmid according to the following system and PCR program; Primers SP002-SP003 amplify the codon-optimized LacI protein expression cassette

[0233] system:

[0234]

[0235] PCR procedure:

[0236]

[0237] 2. Use the ready-to-use seamless cloning kit to assemble the SanPrep column-based PCR product purification kit, and purify the PCR products SP001-SP004 / SP009-SP010 / SP002-SP003 according to the instructions of the purification kit.

[0238] 3. Connect the purified products SP001-SP004 and SP002-SP003 respectively according to the operation procedures in the instruction manual of the ready-to-use seamless cloning kit; the purified products SP009-SP010 are self-connected using the ready-to-use seamless cloning kit.

[0239] 4. Follow the steps below to convert 5αChemically Competent Cells after overnight culture:

[0240] 1) Take 100 μL of competent cells melted on ice, add the ligation product in "3", mix gently (gently pipette or tap the tube wall several times), and let it stand on ice for 5 minutes.

[0241] 2) Heat shock in a 42°C water bath for 60 seconds, quickly transfer to an ice bath, and let stand for 2 minutes.

[0242] 3) Add 700 μL of sterile liquid culture medium (SOB or LB) without antibiotics into the centrifuge tube, mix well and resuscitate at 37°C, 200 rpm for 40 min.

[0243] 4) Take an appropriate volume of the resuscitation solution and evenly spread it on LB solid culture medium containing 50ug / mL kanamycin, and culture it upside down in a 37℃ incubator overnight.

[0244] (2) Construction result sequencing verification experiment:

[0245] Single colonies obtained from two coated plates were sent for sequencing with primers SP011 / SP012 to verify the construction results, and SP001-SP004 / SP002-SP003-2μ plasmids and SP009-SP010-2μ plasmids were obtained.

[0246] (3) Plasmid extraction experiment:

[0247] According to the sequencing results in (2), a single colony available on the transformation plate in (1) was selected to inoculate 5 mL of LB liquid culture medium containing 50 ug / mL kanamycin for overnight activation, and plasmid extraction was completed according to the instructions of the Tiangen Plasmid Extraction Kit.

[0248] (4) High-fidelity enzyme amplification and plasmid construction experiments:

[0249] 1. Primers SP006-SP008 amplify the correctly sequenced SP001-SP004 / SP002-SP003-2μ plasmids according to the following system and PCR program; Primers SP005-SP007 amplify the correctly sequenced SP009-SP010-2μ plasmids

[0250] system:

[0251]

[0252] PCR procedure:

[0253]

[0254]

[0255] 2. Use the ready-to-use seamless cloning kit to assemble the SanPrep column-based PCR product purification kit, and purify the PCR products SP006-SP008 / SP005-SP007 according to the instructions of the purification kit.

[0256] 3. Connect the purified products SP006-SP008 and SP005-SP007 according to the operation procedures in the instructions of the ready-to-use seamless cloning kit.

[0257] 4. Follow the steps below to convert 5αChemically Competent Cells after overnight culture:

[0258] 1) Take 100 μL of competent cells melted on ice, add the ligation product in "3", mix gently (gently pipette or tap the tube wall several times), and let it stand on ice for 5 minutes.

[0259] 2) Heat shock in a 42°C water bath for 60 seconds, quickly transfer to an ice bath, and let stand for 2 minutes.

[0260] 3) Add 700 μL of sterile liquid culture medium (SOB or LB) without antibiotics into the centrifuge tube, mix well and resuscitate at 37°C, 200 rpm for 40 min.

[0261] 4) Take an appropriate volume of the resuscitation solution and evenly spread it on the LB solid culture medium containing 100ug / mL AMP antibiotics, and culture it upside down in a 37℃ incubator overnight.

[0262] (2) Construction result sequencing verification experiment:

[0263] The single colony obtained from the coated plate was sent for sequencing using SP011 / SP012 primers to verify the construction results.

[0264] Plasmid construction results:

[0265] CAACTTTGTATAGAAAAGTTGCCACACACCATAGCTTCAAAATGTTTCTACTCCTTT (omitted here, see the sequence list for details)

[0266] GGAGTAGAAACATTTTTGAAGCTATGGTGTGTGGTAAACTCGCTTAATGCGCCGCTACAGGGCGCGTGGGGATCGATCCACTAGT (SEQ ID NO: 50)

[0267] The antisense RNA sequence is:

[0268] CTCTAGTCAAGTTGGAGACTGTCGCAAGACCACGAACAATGGGTCTCTTGATGGCA GAACGTGC (SEQ ID NO: 51)

[0269] Example 5 Plasmid elimination using E. coli T7 promoter + LacI repressor protein plasmid elimination module

[0270] 1. Make the E. coli to be transformed competent according to the process described in the super competent cell preparation kit.

[0271] 2. Take 100 μL of competent cells melted on ice, add the plasmid described in Example 1, mix gently (gently pipette or tap the tube wall a few times), and let stand on ice for 5 min.

[0272] 3. Heat shock in a 42°C water bath for 60 seconds, quickly transfer to an ice bath, and let stand for 2 minutes (do not shake the sample during standing on ice, otherwise it will reduce the transformation efficiency).

[0273] 4. Add 700 μL of sterile liquid culture medium (SOB or LB) without antibiotics to the centrifuge tube and mix well.

[0274] 5. Take an appropriate volume of the resuscitation solution and spread it evenly on the LB solid culture medium containing 50ug / mL kanamycin, and culture it upside down in a 37℃ incubator overnight.

[0275] 6. Add the E. coli constructed in "5" or the frozen E. coli / puncture bacteria containing the building blocks in "5" into LB liquid culture medium with a culture medium volume not exceeding 1 / 5 of the volume of the conical flask, at 37°C and 220rpm.

[0276] 7. Add IPTG inducer to the LB medium in step "6" at a final concentration of 1 mM.

[0277] 8. After overnight induction (12 h), E. coli / Corynebacterium glutamicum were streaked onto antibiotic-free LB solid medium plates.

[0278] Take the single colony obtained in "8" and spot it on the solid culture medium plates with and without antibiotics (a single colony needs to be spotted twice to ensure the phenotypic difference can be distinguished).

[0279] 9. Specific results are as follows: Figure 1 As shown, after plasmid elimination, most of the bacteria lost their resistance to antibiotics and could no longer grow on antibiotic plates, indicating that the relevant resistance genes had been lost and the plasmid had been successfully eliminated. By inoculating the corresponding successfully eliminated strain, the strain with successfully eliminated plasmid could be obtained.

[0280] Example 6 Plasmid elimination using the E. coli tet promoter + LacI repressor protein plasmid elimination module

[0281] 1. Make the E. coli to be transformed competent according to the process described in the super competent cell preparation kit.

[0282] 2. Take 100 μL of competent cells melted on ice, add the plasmid described in Technical Solution Example 2, gently mix (gently pipette or tap the tube wall several times), and let stand on ice for 5 minutes.

[0283] 3. Heat shock in a 42°C water bath for 60 seconds, quickly transfer to an ice bath, and let stand for 2 minutes (do not shake the sample during standing on ice, otherwise it will reduce the transformation efficiency).

[0284] 4. Add 700 μL of sterile liquid culture medium (SOB or LB) without antibiotics to the centrifuge tube and mix well.

[0285] 5. Take an appropriate volume of the resuscitation solution and spread it evenly on the LB solid culture medium containing 50ug / mL kanamycin, and culture it upside down in a 37℃ incubator overnight.

[0286] 6. Add the E. coli constructed in "5" or the frozen / punctured E. coli containing the building blocks in "5" into an antibiotic-free LB liquid culture medium with a culture medium volume not exceeding 1 / 5 of the volume of the conical flask, and incubate at 37°C, 220 rpm.

[0287] 7. Add IPTG inducer to the LB described in "6" at a final concentration of 1 mM.

[0288] 8. After overnight induction (12 h), E. coli / Corynebacterium glutamicum were streaked onto antibiotic-free LB solid medium plates.

[0289] 9. Take the single colony obtained in "8." and spot it on the solid culture medium plates with and without antibiotics (a single colony needs to be spotted twice to ensure the phenotypic difference).

[0290] 10. Specific results are as follows Figure 2 As shown, after plasmid elimination, most of the bacteria lost their resistance to antibiotics and could no longer grow on antibiotic plates, indicating that the relevant resistance genes had been lost and the plasmid had been successfully eliminated. By inoculating the corresponding successfully eliminated strain, the strain with successfully eliminated plasmid could be obtained.

[0291] Example 7 Plasmid elimination using the Corynebacterium glutamicum trc promoter + LacI repressor protein plasmid elimination module

[0292] 1. Activate the Corynebacterium glutamicum ATCC13032 strain overnight with 5 ml of brain heart infusion liquid culture medium.

[0293] 2. Inoculate all activated Corynebacterium glutamicum bacterial liquid into 45 mL Epo liquid culture medium until the final OD600 reaches 0.2, and grow at 200 rpm and 30°C until OD600 reaches 0.9.

[0294] 3. Transfer the bacterial solution to a sterile 50 mL centrifuge tube and centrifuge to remove the supernatant. Wash 4 times with ice-cold 10% sterile glycerol. Dispense 100 ul / tube into sterile 1.5 mL centrifuge tubes and store at -70°C or use immediately.

[0295] 4. During electroporation, the competent cells were aliquoted and thawed on ice, and the plasmid obtained in Example 3 was added.

[0296] 5. Transfer the mixture to a cold electroporation cup (0.1 cm) and perform an electroporation at 1.8 k V for 5 ms. Immediately after electroporation, add 1 mL of LBHIS medium to the cuvette, mix well, and transfer to a 1.5 mL centrifuge tube.

[0297] 6. Incubate at 30°C for 1 hour.

[0298] 7. Finally, spread the plate on brain heart infusion agar plate containing 50ug / mL kanamycin.

[0299] 8. Add the frozen bacteria / puncture bacteria of Corynebacterium glutamicum constructed in "7" or Corynebacterium glutamicum containing the building blocks in "7" into a liquid culture medium containing antibiotic-free heart infusion in a volume not exceeding 1 / 5 of the volume of the conical flask, at 30°C, 220rpm.

[0300] 9. Add IPTG inducer to the culture medium described in "8" at a final concentration of 1 mM.

[0301] 10. After overnight induction (18 h), streak the Corynebacterium glutamicum on an antibiotic-free LB solid culture medium plate.

[0302] 11. Take the single colony obtained in "10" and spot it on the solid culture medium plates with and without antibiotics (a single colony needs to be spotted twice to ensure the phenotypic difference).

[0303] 12. Specific results are as follows Figure 3 As shown, after plasmid elimination, most of the bacteria lost their resistance to antibiotics and could no longer grow on antibiotic plates, indicating that the relevant resistance genes had been lost and the plasmid had been successfully eliminated. By inoculating the corresponding successfully eliminated strain, the strain with successfully eliminated plasmid could be obtained.

[0304] Example 8 Plasmid Elimination Using Saccharomyces cerevisiae Constitutive Promoter + LacI Repressor Protein Plasmid Elimination Module

[0305] Prepare the following reagents first:

[0306] 10*TE buffer

[0307] 100mM LiAC buffer

[0308] 1M DTT buffer

[0309] ddH2O

[0310] 1M Sorbitol Solution

[0311] Preparation of competent cells of Saccharomyces cerevisiae:

[0312] 1. Precool reagents.

[0313] 2. Take 30 μL of the Saccharomyces cerevisiae glycerol tube and inoculate it into 10 mL of liquid YPD medium. Culture it in a constant temperature shaker at 30°C for 24 h. Then take 100 μL of it and inoculate it into 100 mL of liquid YPD medium until the bacterial concentration OD600 grows to 1.3-1.5.

[0314] 3. Divide the bacterial solution into three pre-cooled 50 mL centrifuge tubes, centrifuge at 4°C, 5000 r×min-1 for 5 min, discard the supernatant and collect the bacteria.

[0315] 4. Use 4 mL of pre-cooled ddH2O to blow and aspirate the bacteria to resuspend them. Combine the three tubes into one tube and add 2 mL of pre-cooled 10×TE buffer, 2 mL of 100 mM LiAC buffer and 0.5 mL of 1 M DTT buffer. Mix by pipetting and aspirate. Place the centrifuge tube in a constant temperature water bath shaker at 30°C and 50 r×min-1 and culture for 45 min.

[0316] 5. Add 13.5 mL of pre-cooled ddH2O to a 50 mL centrifuge tube, centrifuge at 4°C, 5000 r×min-1 for 5 min, discard the supernatant, and collect the bacteria.

[0317] 6. Add 25 mL of pre-cooled ddH2O into a 50 mL centrifuge tube, blow and aspirate the suspended bacteria, centrifuge at 5000 r×min-1 for 5 min, discard the supernatant, collect the bacteria, and then wash the bacteria twice with 1 M sorbitol (25 mL of sorbitol for the first time and 20 mL for the second time).

[0318] 7. Add 1 mL of pre-cooled sorbitol to the centrifuge tube to suspend the bacteria, and dispense into 1.5 mL EP tubes, 80 μL per tube, for immediate use.

[0319] 8. During electroporation, place the aliquoted competent cells on ice and add 5uL of the plasmid obtained in Example 4.

[0320] 9. Transfer the mixture to a cold electroporation cup (0.2 cm) and electroporate at 1.5 kV, 200 Ω, 25 uF, 5 ms pulse. Immediately after electroporation, add 1 mL of YPD-free medium to the cuvette, mix well, and transfer to a 1.5 mL centrifuge tube. Incubate at 30°C, 200 rpm on a shaker for 1 to 3 hours.

[0321] 10. Collect the bacteria by centrifugation. Spread 150ul of the bacterial solution on a resistant plate and culture at 30℃ for 2-3 days.

[0322] 11. Add the Saccharomyces cerevisiae constructed in "10" or the frozen / punctured Saccharomyces cerevisiae containing the building blocks in "10" into an antibiotic-free YPD liquid culture medium with a culture medium volume not exceeding 1 / 5 of the volume of the conical flask, at 30°C and 220rpm.

[0323] 12. When the OD600 of the bacterial solution in "11" reaches 2, add IPTG inducer with a final concentration of 1mM.

[0324] 13. After 48 hours of induction of Saccharomyces cerevisiae, streak the plate on an antibiotic-free LB solid medium plate.

[0325] 14. Take the single colony obtained in "13" and spot it on the solid culture medium plates with and without antibiotics (a single colony needs to be spotted twice to ensure the phenotypic difference).

[0326] 15. Specific results are as follows Figure 4 As shown, after plasmid elimination, most of the bacteria lost their resistance to antibiotics and could no longer grow on antibiotic plates, indicating that the relevant resistance genes had been lost and the plasmid had been successfully eliminated. By inoculating the corresponding successfully eliminated strain, the strain with successfully eliminated plasmid could be obtained.

[0327] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solution obtained by equivalent replacement or equivalent transformation falls within the protection scope of the present invention.

Claims

1. An application of a plasmid elimination module based on a repressor protein, characterized in that: Used for the selective elimination of a designated target plasmid or the selective simultaneous elimination of several designated target plasmids.

2. The use according to claim 1, characterized in that: The plasmid elimination module includes two types of independent expression regions, one of which is the repressor gene transcription region, which is composed of the constitutive promoter of the repressor gene, including its RNA polymerase binding site and transcription start site, ribosome binding site, repressor translation region, and terminator; the other type of region is the antisense RNA expression region, which is composed of a constitutive promoter, a repressor protein binding site, antisense RNA and a terminator; the antisense RNA is the antisense RNA of the key metabolic gene mRNA, which can bind to the key metabolic gene mRNA to hinder the translation of the key metabolic gene mRNA.

3. The use according to claim 2, characterized in that: The repressor protein is a repressor protein that can bind to a specific DNA sequence, inhibit downstream DNA transcription after binding, can be activated or released from binding activity by specific compounds, and does not affect the growth of chassis cells. The repressor protein binding site binds to the repressor protein and prevents RNA polymerization from passing through or crossing the binding site to transcribe the DNA sequence downstream of the binding site.

4. The use according to claim 3, characterized in that: The repressor protein gene is a LacI protein gene, and the repressor protein binding site is a LacI protein binding site.

5. The use according to claim 2, characterized in that: The constitutive promoter is a specific DNA sequence that can bind to RNA polymerase with a certain strength in the cell and start the transcription function of RNA polymerase to transcribe downstream functional sequences and antisense RNA.

6. The use according to claim 2, characterized in that: The constitutive promoters include T7, tet, trc, trp, J23119 promoter, tac and constitutive promoters related to the resistance genes of chloramphenicol, kanamycin and penicillin commonly used antibiotics in Corynebacterium glutamicum.

7. The use according to claim 2, characterized in that: The antisense RNA expression region is carried in the plasmid to be eliminated.

8. The use according to claim 2, characterized in that: The plasmid to be eliminated is a circular or linear DNA that is stable and free in the cell and can replicate independently outside the genome, or replicate with the genome and be passed to daughter cells.

9. The use according to claim 8, characterized in that: The plasmid to be eliminated includes any one of pet28A, PEC-XK99E, and yeast 2μ.

10. The use according to claim 2, characterized in that: The antisense RNA interference gene is the antisense RNA of the key metabolic gene mRNA, which can bind to the key metabolic gene mRNA to hinder the translation of the key metabolic gene mRNA.

11. The use according to claim 10, characterized in that: The key metabolic genes are TCA cycle related genes, protein synthesis related genes, aerobic respiration related genes, anaerobic respiration related genes, lipid synthesis related genes, cell wall synthesis related genes, sugar transport pathway related genes, amino acid transport pathway related genes, ATP synthesis related genes, cytoskeleton synthesis related genes, NADPH / NADP + Synthesis-related genes, NADH / NAD + Synthesis-related genes, vitamin synthesis-related genes, one-carbon transport system-related genes, carbon dioxide fixation-related genes, DNA / RNA synthesis-related genes, amino acid synthesis-related genes, ribose synthesis-related genes, ribosome synthesis-related genes, ribosome assembly-related genes, aminoacyl-tRNA synthetase-related genes and isoenzyme genes of the above genes.

12. The use according to any one of claims 1 to 11, characterized in that: The plasmid elimination module eliminates all microorganisms, animals or plant cells that have stable free plasmids, have a probability of producing daughter cells without plasmids during proliferation, and the elimination of free plasmids will not cause cell death or inability to proliferate.

Images