Microorganism for producing L-isoleucine and method for producing L-isoleucine using same

Abstract

The present disclosure relates to: a microorganism having an L-isoleucine producing ability, into which an exogenous gene encoding glutamate dehydrogenase is introduced; a method for producing L-isoleucine using the microorganism; and a composition for the production of L-isoleucine, said composition comprising said microorganism.

Description

Technical Field

[0001] The present disclosure relates to a microorganism having the ability to produce L-isoleucine, into which a foreign gene encoding glutamate dehydrogenase is introduced; a method for producing L-isoleucine using the microorganism; and a composition for producing L-isoleucine, the composition comprising the microorganism. Background Art

[0002] L-isoleucine is a branched-chain amino acid among the 20 amino acids, and is classified as an essential amino acid and is widely used in animal feed, food additives and medicine. Since L-isoleucine has functions such as energy production after metabolism, hemoglobin production, blood sugar level control, muscle building and repair, it is increasingly used not only in fluids, nutrients and sports nutrition, but also in animal feed.

[0003] For the production of L-isoleucine, Corynebacterium glutamicum and Escherichia coli are used as representative microorganisms. In these microorganisms, L-isoleucine shares a major biosynthetic pathway with other branched-chain amino acids, L-valine and L-leucine. Regarding the biosynthetic pathway of L-isoleucine, pyruvic acid produced during glycolysis and 2-ketobutyric acid produced by L-threonine (an amino acid derived from aspartic acid, aspartate) are used as precursors for the final production of L-isoleucine.

[0004] A method for producing L-amino acids using various microorganisms and variants thereof is known (U.S. Pat. No. 10113190). However, in the method using the variant, various by-products other than L-isoleucine are generated, thereby causing a problem of reduced purity of L-isoleucine in the purification step.

[0005] In this regard, in order to improve the purity of L-isoleucine, a method for purifying L-isoleucine is known (U.S. Patent No. 6072083). However, the disadvantage of this purification method is that a separate additional purification process is required. Therefore, it is necessary to develop a method for improving the purity of L-isoleucine.

[0006] Meanwhile, L-glutamic acid is a precursor that provides an amine group in the synthesis of amino acids including L-isoleucine. When producing amino acids, it is essential to strengthen the synthesis of the precursor L-glutamic acid. However, the enhancement of glutamate dehydrogenase (known to produce glutamate in microorganisms that produce L-isoleucine) can cause a side reaction, namely, the production of a byproduct α-aminobutyric acid (AABA) by dehydrogenation of the intermediate 2-ketobutyric acid of isoleucine (Microb Cell Fact. 2017Mar23; 16(1): 51). Therefore, there is a problem of reducing the purity and biosynthesis efficiency of L-isoleucine. Summary of the invention

[0007] [Technical issues]

[0008] The present inventors have developed a microorganism having the ability to produce L-isoleucine, into which a foreign gene encoding glutamate dehydrogenase is introduced; a method for producing L-isoleucine using the microorganism; and a composition for producing L-isoleucine, the composition comprising the microorganism, thereby completing the present disclosure.

[0009] [Technical solution]

[0010] An object of the present invention is to provide a microorganism having the ability to produce L-isoleucine, into which a foreign gene encoding glutamate dehydrogenase derived from Bacillus subtilis or Rhodospirillales is introduced.

[0011] Another object of the present invention is to provide a method for producing L-isoleucine, which comprises the step of culturing the microorganism in a culture medium.

[0012] Still another object of the present disclosure is to provide a composition for producing L-isoleucine, the composition comprising the microorganism.

[0013] [Beneficial Effects]

[0014] The microorganism having L-isoleucine-producing ability disclosed herein, into which a foreign gene encoding glutamate dehydrogenase is introduced, can produce L-isoleucine at a high yield by producing less by-products, and thus can be usefully applied to the industrial production of L-isoleucine. DETAILED DESCRIPTION

[0015] The present disclosure will be described in detail below. Meanwhile, each description and embodiment disclosed in the present disclosure may be applicable to other descriptions and embodiments. That is to say, all combinations of various elements disclosed in the present disclosure fall within the scope of the present disclosure. In addition, the scope of the present disclosure is not limited by the specific description described below.

[0016] In addition, those skilled in the art will recognize or be able to ascertain, using only routine experimentation, many equivalents to the specific embodiments of the present disclosure described herein. In addition, these equivalents should be understood to fall within the scope of the present disclosure.

[0017] One aspect of the present invention provides a microorganism capable of producing L-isoleucine, into which a foreign gene encoding glutamate dehydrogenase derived from Bacillus subtilis or Rhodospirillales is introduced.

[0018] As used herein, the term "L-isoleucine", which is one of the essential amino acids, refers to an amino acid having a chemical formula of HO 2 CCH(NH 2 )CH(CH 3 )CH 2 CH 3 L-amino acids, which correspond in structure to the branched-chain amino acids together with L-valine and L-leucine.

[0019] As used herein, the term "strain (or microorganism)" includes all wild-type microorganisms or naturally or artificially genetically modified microorganisms, and it may be a microorganism in which a specific mechanism is weakened or enhanced due to the insertion of exogenous genes, the enhancement or inactivation of the activity of endogenous genes, etc., and it may be a microorganism containing a genetic modification for producing a desired polypeptide, protein or product.

[0020] As used herein, the term "microorganism having L-isoleucine production ability" refers to a microorganism naturally having L-isoleucine production ability or a microorganism obtained by providing L-isoleucine production ability to a parent strain that does not have L-isoleucine production ability. Specifically, the microorganism can be a microorganism producing L-isoleucine, into which an exogenous gene encoding glutamate dehydrogenase derived from Bacillus subtilis or Rhodospirillales is introduced, but is not limited thereto.

[0021] Specifically, "microorganisms producing L-isoleucine" include all wild-type microorganisms or microorganisms that have undergone genetic modification naturally or artificially. More specifically, the microorganism may be a microorganism whose specific mechanism is weakened or enhanced due to the insertion of exogenous genes, the activity enhancement or inactivation of endogenous genes, etc., and it may be a microorganism in which genetic modification occurs or the L-isoleucine production activity is enhanced to produce the desired L-isoleucine. For the purpose of the present disclosure, the microorganism with L-isoleucine production capacity is characterized in that the desired L-isoleucine production capacity is improved by introducing an exogenous gene encoding glutamate dehydrogenase derived from Bacillus subtilis or Rhodospirillales, and it may be a genetically modified microorganism or a recombinant microorganism, but is not limited thereto.

[0022] As used herein, the term "introduction" of an activity refers to the expression of a gene that a microorganism does not originally possess in the microorganism, thereby showing the activity of a specific protein or showing an increased or improved activity compared to the endogenous activity of the corresponding protein or the activity before modification. For example, a polynucleotide encoding a specific protein can be introduced into the chromosome of a microorganism, or a vector containing a polynucleotide encoding the specific protein can be introduced into the microorganism, thereby showing its activity.

[0023] For example, the recombinant strain with improved productivity can increase its L-isoleucine productivity by about 1% or more compared to the parent strain before modification or an unmodified microorganism having endogenous activity of gdh protein, specifically, about 1% or more, about 2% or more, about 3% or more, about 4% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 8.1% or more, about 8.2% or more or about 8.3% or more (the upper limit is not particularly limited, but can be, for example, about 100% or less, about 50% or less, about 25% or less, about 20% or less, about 15% or less or about 10% or less), but the amount of increase is not limited thereto, as long as the productivity has a positive increase compared to the productivity of the parent strain before modification or the unmodified microorganism. In another example, the L-isoleucine productivity of the recombinant strain with improved productivity can be improved by about 1.01 times or more, about 1.02 times or more, about 1.03 times or more, about 1.04 times or more, about 1.05 times or more, about 1.06 times or more, about 1.07 times or more, or about 1.08 times or more (the upper limit is not particularly limited, but can be, for example, about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, about 1.5 times or less, or about 1.1 times or less) compared to the productivity of the parent strain before the modification or the unmodified microorganism, but is not limited thereto.

[0024] As used herein, the term "unmodified microorganism" does not exclude the bacterial strain comprising the mutation that can be naturally present in the microorganism, and can be a wild-type strain or a natural strain itself, or can be a strain before the character is changed by genetic variation due to natural or artificial factors. For example, the unmodified microorganism can refer to the bacterial strain before the exogenous glutamate dehydrogenase gene described in this specification sheet is imported." unmodified microorganism" can be used interchangeably with "strain before modification", "microorganism before modification", "unvaried strain", "unmodified strain", "unvaried microorganism" or "reference microorganism".

[0025] In another example of the present disclosure, the microorganism of the present disclosure may be a microorganism capable of producing L-isoleucine, and its type is not particularly limited. The microorganism of the present disclosure may be a prokaryotic cell or a eukaryotic cell, specifically, a prokaryotic cell. Prokaryotic cells may include, for example, Corynebacterium, Escherichia, Erwinia, Serratia, Providencia, and Brevibacterium, specifically, microbial strains of Corynebacterium.

[0026] In the present disclosure, "microorganisms of the genus Corynebacterium" may include all microorganisms of the genus Corynebacterium. Specifically, it can be Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacteriumammoniagenes, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium flavescens, more specifically, Corynebacterium glutamicum.

[0027] As used herein, term " glutamate dehydrogenase " is the enzyme of synthesizing glutamate, and glutamate is the precursor of L-isoleucine biosynthesis.In the present invention, " glutamate dehydrogenase " can be used interchangeably with " gdh ", " rocG ".

[0028] As used herein, the terms "protein having glutamate dehydrogenase activity" and "gene encoding glutamate dehydrogenase" may include, without limitation, any protein having glutamate dehydrogenase activity as described above and any gene encoding the same. Specifically, glutamate dehydrogenase is known in the art, and protein and gene sequences of glutamate dehydrogenase can be obtained from known databases, examples of which may include NCBI GenBank, etc., but are not limited thereto.

[0029] Meanwhile, L-glutamic acid is a precursor that provides an amine group in the synthesis of amino acids including L-isoleucine. When producing amino acids, it is essential to strengthen the synthesis of the precursor L-glutamic acid. However, the enhancement of glutamate dehydrogenase (known to produce glutamate in microorganisms that produce L-isoleucine) can cause a side reaction, namely, the production of a byproduct α-aminobutyric acid (AABA) by dehydrogenation of the intermediate 2-ketobutyric acid of isoleucine (Microb Cell Fact. 2017Mar23; 16(1): 51). Therefore, there is a problem of reducing the purity and biosynthesis efficiency of L-isoleucine.

[0030] In the microorganism with L-isoleucine production capacity disclosed in the present invention, an exogenous gene encoding glutamate dehydrogenase derived from Bacillus subtilis or Rhodospirillales is introduced to reduce the generation of by-products. The by-product may be alpha-aminobutyric acid (AABA). Compared with a wild-type microorganism, the reduction in by-product generation may mean that the output of alpha-aminobutyric acid (AABA) is reduced relative to the output of L-isoleucine, but is not limited thereto.

[0031] For the purpose of the present disclosure, the protein having glutamate dehydrogenase activity may be derived from Bacillus subtilis or Rhodospirillales. Specifically, the glutamate dehydrogenase may have and / or may include, may be mainly composed of, or may consist of an amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3.

[0032] In addition, the glutamate dehydrogenase of the present disclosure may also include an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% or higher homology or identity with the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3. It is also obvious that any glutamate dehydrogenase having an amino acid sequence with deletion, modification, substitution, conservative substitution or addition in a partial sequence may also be included in the scope of the present disclosure, as long as the amino acid sequence has such homology or identity and exhibits the efficacy corresponding to the glutamate dehydrogenase of the present disclosure.

[0033] In the present disclosure, although it is described as 'a polypeptide or protein comprising an amino acid sequence represented by a specific SEQ ID NO', 'a polypeptide or protein consisting of an amino acid sequence represented by a specific SEQ ID NO' or 'a polypeptide or protein having an amino acid sequence represented by a specific SEQ ID NO', it is obvious that any protein having some sequence deletions, modifications, substitutions, conservative substitutions or additions in the amino acid sequence can also be used in the present disclosure, as long as the protein has the same or corresponding activity as the polypeptide consisting of the amino acid sequence of the corresponding SEQ ID NO. For example, there are cases where the N-terminus and / or C-terminus of the amino acid sequence have sequence additions, naturally occurring mutations, silent mutations or conservative substitutions thereof that do not change the function of the protein.

[0034] For example, there are cases where the N-terminus, C-terminus and / or interior of the amino acid sequence have sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions thereof that do not alter the function of the glutamate dehydrogenase of the present disclosure.

[0035] As used herein, the term "conservative substitution" means that one amino acid is replaced by another amino acid with similar structural properties and / or chemical properties. Such amino acid substitutions can generally occur based on the similarity of the polarity, charge, solubility, hydrophobicity, hydrophilicity and / or amphipathicity of the residues. For example, positively charged (basic) amino acids include arginine, lysine and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; aromatic amino acids include phenylalanine, tryptophan and tyrosine; and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine and tryptophan. In addition, amino acids can also be divided into amino acids with charged side chains and amino acids with uncharged side chains. Amino acids with charged side chains include aspartic acid, glutamic acid, lysine, arginine and histidine, while amino acids with uncharged side chains can be further divided into non-polar amino acids or polar amino acids. Non-polar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan and proline, while polar amino acids include serine, threonine, cysteine, tyrosine, asparagine and glutamine. Typically, conservative substitutions have little or no effect on the activity of the resulting polypeptide. Typically, conservative substitutions have little or no effect on the activity of a protein or polypeptide.

[0036] In addition, glutamate dehydrogenase may also include deletions or additions of amino acids that have minimal effects on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated to a signal (or leader) sequence at the N-terminus of the protein, which co-translationally or post-translationally directs the transfer of the protein. The polypeptide may also be conjugated to other sequences or linkers for identification, purification or synthesis of the polypeptide.

[0037] As used herein, the term "homology" or "identity" refers to the similarity between two given amino acid sequences or nucleotide sequences, and can be expressed as a percentage. The terms homology and identity are often used interchangeably with each other.

[0038] The sequence homology or identity of conservative polynucleotides or polypeptides is determined by standard comparison algorithms and can be used together with the default gap penalty established by the program used. Substantially homologous or identical sequences can hybridize with the entire sequence or partial sequence under moderate or high stringency conditions. It is apparent that hybridization also includes hybridization of polynucleotides that contain universal codons or codons that take into account codon degeneracy in the polynucleotide.

[0039] Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined, for example, using default parameters such as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444 using a known computer algorithm such as the "FASTA" program. Alternatively, homology, similarity or identity can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453) implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (version 5.0.0 or higher) (including the GCG program package (Devereux, J., et al, Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]:403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego; Diego, 1994 and [CARILLO ETA / .] (1988) SIAM J Applied Math 48: 1073). For example, BLAST or ClustalW from the National Center for Biotechnology Information can be used to determine homology, similarity or identity.

[0040] Homology, similarity or identity of polynucleotides or polypeptides can be determined by comparing sequence information using, for example, the GAP computer program described by Needleman et al. (1970), J Mol Biol. 48: 443, which was published by Smith and Waterman, Adv. Appl. Math (1981) 2: 482. In short, the GAP program defines homology, similarity or identity as the value obtained by dividing the number of similarly arranged symbols (i.e., nucleotides or amino acids) by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program may include (1) a binary comparison matrix (containing identity values ​​of 1 and non-identity values ​​of 0) and a weighted comparison matrix of Gribskov et al (1986) Nucl. Acids Res. 14:6745, as disclosed in Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353–358 (1979) (or the EDNAFULL (EMBOSS version of NCBINUC 4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap open penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0041] As used herein, the term "corresponding to" refers to an amino acid residue at a listed position in a polypeptide, or an amino acid residue that is similar, identical, or homologous to a listed residue in a polypeptide. The amino acid at the corresponding position can be identified as a specific amino acid in a determined sequence that refers to a specific sequence. As used herein, a "corresponding region" generally refers to an analogous or corresponding position in a related protein or a reference protein.

[0042] For example, any amino acid sequence is aligned with SEQ ID NO: 1, and on this basis, each amino acid residue of the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 1. For example, the sequence alignment algorithms described in the present disclosure can determine the position of an amino acid, or the position at which a modification such as a substitution, insertion, and deletion occurs, by comparison with the position in a query sequence (also referred to as a "reference sequence").

[0043] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277), etc. can be used, but are not limited thereto, and sequence alignment programs, pairwise sequence comparison algorithms, etc. known in the art can be appropriately used.

[0044] As used herein, the term "endogenous activity" refers to the activity of the microorganism in the natural state originally possessed or the activity of the protein possessed before the corresponding protein is modified. This can be used interchangeably with "activity before modification".

[0045] As used herein, the term "enhancing" of polypeptide activity means that the activity of polypeptide increases compared with its endogenous activity.Enhancement can be used interchangeably with terms such as activation, up-regulation, overexpression and increase.Here, activation, enhancement, up-regulation, overexpression and increase can include showing an activity that is not initially present, or compared with endogenous activity or the activity before modification, these two situations of activity enhancement."Endogenous activity" means that when proterties change because of the genetic variation caused by natural or artificial factors, the activity of the specific polypeptide that the parent strain or unmodified microorganism originally had before the proterties change.This can be used interchangeably with "activity before modification".The activity of polypeptide is "enhanced", "up-regulated", "overexpressed" or "increased" compared with endogenous activity, meaning that the activity of polypeptide and the parent strain or unmodified microorganism originally had the activity and / or concentration (expression level) of the specific polypeptide that the proterties change before are improved.

[0046] Enhancement can be achieved by introducing exogenous polypeptides or enhancing the activity and / or concentration (expression level) of endogenous polypeptides. The enhancement of polypeptide activity can be confirmed by an increase in the activity degree and expression level of the corresponding polypeptide or an increase in the amount of the product released by the corresponding polypeptide.

[0047] In order to enhance the activity of polypeptide, various methods known in the art can be applied, and the method is not limited, as long as the activity of the desired polypeptide can be enhanced compared with the activity of the microorganism before modification. Specifically, genetic engineering and / or protein engineering known to those skilled in the art can be used, which are common methods of molecular biology, but the method is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2.1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0048] Specifically, the enhancement of the polypeptide of the present disclosure may be:

[0049] 1) increasing the intracellular copy number of a polynucleotide encoding a polypeptide;

[0050] 2) Modifying the gene expression regulatory region encoding the polypeptide on the chromosome (for example, causing a mutation in the expression regulatory region, replacing it with a sequence with stronger activity, or inserting a sequence with stronger activity);

[0051] 3) a modified nucleotide sequence encoding: the start codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0052] 4) Modify the amino acid sequence of a polypeptide to enhance the activity of the polypeptide;

[0053] 5) modifying a polynucleotide sequence encoding a polypeptide to enhance the activity of the polypeptide (e.g., modifying a polynucleotide sequence of a polypeptide gene to encode a polypeptide modified to enhance the activity of the polypeptide);

[0054] 6) introducing an exogenous polypeptide exhibiting polypeptide activity or an exogenous polynucleotide encoding the same;

[0055] 7) codon-optimized polynucleotides encoding polypeptides;

[0056] 8) analyzing the tertiary structure of the polypeptide to select and modify or chemically modify exposed sites; or

[0057] 9) A combination of two or more selected from 1) to 8), but not particularly limited thereto.

[0058] More specifically, 1) increasing the intracellular copy number of a polynucleotide encoding a polypeptide can be achieved by introducing a vector into a host cell, which can replicate and function independently of the host and is operably linked to a polynucleotide encoding the corresponding polypeptide. Alternatively, the increase can be achieved by introducing one or more copies of a polynucleotide encoding the corresponding polypeptide into the chromosome of the host cell. Chromosomal introduction can be performed by introducing a vector capable of inserting a polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0059] 2) Replacing the gene expression regulatory region (or expression control sequence) encoding the polypeptide on the chromosome with a sequence showing strong activity can be, for example, a sequence variation due to deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacing the expression regulatory region with a sequence showing stronger activity to further enhance the activity of the expression regulatory region. The expression regulatory region may include, but is not particularly limited to, a promoter, an operator gene sequence, a sequence encoding a ribosome binding site, and a sequence controlling the termination of transcription and translation, etc. For example, the replacement may be replacing the original promoter with a strong promoter, but is not limited thereto.

[0060] Examples of known strong promoters may include CJ1 to CJ7 promoters (US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US10584338 B2), O2 promoter (US10273491 B2), tkt promoter, yccA promoter, etc., but are not limited to these.

[0061] 3) Modified nucleotide sequence, which encodes: the start codon or 5'-UTR region of the gene transcript encoding the polypeptide, which may be replaced by other start codons having a higher polypeptide expression rate than the endogenous start codon, but is not limited thereto.

[0062] 4) and 5) The modification of the amino acid sequence or polynucleotide sequence may be a sequence variation due to deletion, insertion, non-conservative or conservative substitution, or a combination thereof of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide; or the activity of the polypeptide may be enhanced by replacing the amino acid sequence or polynucleotide sequence improved to show stronger activity or the amino acid sequence or nucleotide sequence improved to have higher activity, but is not limited thereto. The replacement may be specifically performed by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto. The vector used here may further contain a selection marker to confirm the chromosome insertion. The selection marker is as described above.

[0063] 6) The introduction of an exogenous polynucleotide exhibiting polypeptide activity can be to introduce an exogenous polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide into a host cell. The source or sequence of the exogenous polynucleotide is not limited, as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction can be performed by those skilled in the art by appropriately selecting a known transformation method. When the introduced polynucleotide is expressed in the host cell, a polypeptide can be produced, and its activity can be improved.

[0064] 7) Codon Optimization The polynucleotide encoding the polypeptide can be a codon-optimized endogenous polynucleotide to enhance transcription or translation in a host cell, or a codon-optimized exogenous polynucleotide to perform optimized transcription and translation in a host cell.

[0065] 8) Analyzing the tertiary structure of the polypeptide to select and modify or chemically modify the exposed site can be, for example, by comparing the sequence information of the polypeptide to be analyzed with a database storing sequence information of known proteins to determine the template protein candidate based on sequence similarity, thereby confirming the structure and modifying or chemically modifying the exposed site to be modified or chemically modified on this basis.

[0066] Based on the activity or concentration of the polypeptide expressed in the wild-type or modified microbial strain, this enhancement of polypeptide activity can be an increase in the activity or concentration or expression level of the corresponding polypeptide, or an increase in the amount of the product produced by the corresponding polypeptide, but is not limited thereto.

[0067] Specifically, for the purpose of the present disclosure, an exogenous polynucleotide having glutamate dehydrogenase activity derived from Bacillus subtilis or Rhodospirillales may be introduced into a microorganism to enhance the activity of the glutamate dehydrogenase protein.

[0068] As used herein, the term "polynucleotide" refers to a DNA or RNA chain of a certain length or longer as a nucleotide polymer in which nucleotide monomers are linked by covalent bonds in the long chain, and more specifically, refers to a polynucleotide fragment encoding a variant.

[0069] The polynucleotide according to the present disclosure is characterized in that it is derived from Bacillus subtilis or Rhodospirillales. Specifically, the polynucleotide may include a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:3. More specifically, the exogenous gene encoding glutamate dehydrogenase derived from Bacillus subtilis and the exogenous gene encoding glutamate dehydrogenase derived from Rhodospirillales may have the nucleotide sequences of SEQ ID NO:2 and SEQ ID NO:4, respectively, but are not limited thereto. The nucleotide sequences of SEQ ID NO:2 and SEQ ID NO:4 can be obtained from known databases, and examples thereof may be NCBI GenBank, etc., but are not limited thereto.

[0070] In the present disclosure, a gene comprising the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4 can be used interchangeably with a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4, a gene or polynucleotide having the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or a gene or polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4.

[0071] Due to codon degeneracy or in consideration of preferred codons in the organism in which the disclosed variants are expressed, the polynucleotides of the present disclosure may undergo various modifications in the coding region without changing the amino acid sequence of the disclosed variants. Specifically, the polynucleotides of the present disclosure may have or may include a nucleotide sequence having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity with the sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or may consist of or may be mainly composed of a nucleotide sequence having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity with the sequence of SEQ ID NO: 2 or SEQ ID NO: 4, but are not limited thereto.

[0072] In addition, the polynucleotides of the present disclosure may include probes that can be prepared from known gene sequences, for example, the sequences that may be included are not limited, as long as they are sequences that can hybridize with all or part of the complementary sequences of the polynucleotide sequences of the present disclosure under stringent conditions. "Stringent conditions" means conditions that can achieve specific hybridization between polynucleotides. These conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). Examples include conditions in which polynucleotides having high homology or identity, i.e., polynucleotides having 70% or more, 75% or more, 6% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize to each other, whereas polynucleotides having low homology or identity do not hybridize to each other, or conditions in which washing is performed once, specifically 2 to 3 times, at a salt concentration and temperature equivalent to 60°C, 1XSSC, 0.1% SDS, specifically 60°C, 0.1XSSC, 0.1% SDS, more specifically 68°C, 0.1XSSC, 0.1% SDS, which are washing conditions for conventional Southern hybridization.

[0073] Hybridization requires that the two nucleic acids have complementary sequences, but mismatches between bases are allowed depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize to each other. For example, with respect to DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present disclosure may include substantially similar nucleic acid sequences and isolated nucleic acid fragments that are complementary to the entire sequence.

[0074] Specifically, the hybridization conditions including the hybridization step at a Tm value of 55° C. and the above conditions can be used to detect polynucleotides having homology or identity with the polynucleotides of the present disclosure. In addition, the Tm value can also be 60° C., 63° C. or 65° C., but is not limited thereto, and can be appropriately adjusted by those skilled in the art according to the purpose.

[0075] The appropriate stringency for hybridization to a polynucleotide depends on the length of the polynucleotide and the degree of complementation, and variables are well known in the art (eg, J. Sambrook et al., supra).

[0076] For the purpose of the present disclosure, the microorganism includes an expression vector for expressing an exogenous polynucleotide in a host, thereby having enhanced glutamate dehydrogenase protein activity compared to endogenous activity, but is not limited thereto.

[0077] The vector of the present disclosure may include a DNA construct comprising a base sequence of a polynucleotide encoding a desired polypeptide, which is operably linked to a suitable expression regulatory region (or expression control sequence) so that the desired polypeptide can be expressed in a suitable host. The expression regulatory region may include a promoter capable of initiating transcription, an arbitrary operator gene sequence for controlling transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling transcription and translation termination. The vector may be transformed into a suitable host cell, and then replicated or exerted its effect independently of the host genome, or it may be integrated into the genome itself.

[0078] The vector used in the present disclosure is not particularly limited, but any vector known in the art can be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as phage vectors or cosmid vectors, and pDC system, pBR system, pUC system, pBluescript II system, pGEM system, pTZ system, pCL system, pET system, etc. can be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pSK, pSKH130, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, etc. can be used.

[0079] For example, the polynucleotide encoding the desired polypeptide can be inserted into the chromosome by the vector for chromosome insertion in the cell. The polynucleotide insertion into the chromosome can be carried out by any method known in the art (for example, homologous recombination), but is not limited thereto. The carrier can also include a selection marker for confirming chromosome insertion. The selection marker is used to select the cells transformed with the carrier, i.e., to confirm the insertion of the desired nucleic acid molecule, and can be used to confer a marker for selecting a phenotype such as drug resistance, auxotrophy, cytotoxic agent resistance or surface polypeptide expression. In an environment treated with a selective agent, only cells expressing the selection marker can survive or show other phenotypic traits, so the cells transformed can be selected.

[0080] As used herein, the term "transformation" means that a vector containing a polynucleotide encoding a target polypeptide is introduced into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell. The converted polynucleotide can be inserted into the chromosome of the host cell or located outside the chromosome, and its location is independent of the position, as long as it can be expressed in the host cell. In addition, the polynucleotide also includes DNA and / or RNA encoding the desired polypeptide. The polynucleotide can be introduced in any form, as long as it can be introduced into the host cell and expressed. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a gene construct containing all the elements required for self-expression. The expression cassette can generally include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal that are operably connected to the polynucleotide. The expression cassette can be in the form of an expression vector that can replicate itself. In addition, the polynucleotide can also be introduced into the host cell in its own form and operably connected to the sequence required for expression in the host cell, but is not limited thereto.

[0081] Furthermore, the term "operably linked" also means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the desired variant of the present disclosure.

[0082] In the microorganisms disclosed herein, partial or complete modification of polynucleotides may be induced by: (a) homologous recombination using a vector for chromosome insertion in a microorganism or genome editing using an engineered nuclease (e.g., CRISPR-Cas9), and / or (b) treatment with light (e.g., ultraviolet light and radiation) and / or chemicals, but not limited thereto. Methods for modifying part or all of a gene may include methods utilizing DNA recombination technology. For example, a nucleotide sequence or a vector comprising a nucleotide sequence homologous to a target gene may be introduced into a microorganism to cause homologous recombination, thereby causing partial or complete deletion of a gene. The nucleotide sequence or vector to be introduced may include a dominant selection marker, but is not limited thereto.

[0083] Meanwhile, in a specific embodiment of the present disclosure, the microorganism of the genus Corynebacterium may further include an enzyme having enhanced activity, which participates in the L-isoleucine biosynthesis pathway.

[0084] As used herein, the term "enzymes involved in the L-isoleucine biosynthetic pathway" may include aspartate kinase (lysC gene), aspartate-β-semialdehyde dehydrogenase (asd gene), homoserine dehydrogenase (hom gene), homoserine kinase (thrB gene), threonine synthase (thrC gene), threonine dehydratase (ilvA gene), transaminase (ilvE gene) and the like, but are not limited thereto.

[0085] Another aspect of the present invention provides a method for producing L-isoleucine, which comprises the step of culturing a microorganism in a culture medium.

[0086] The microorganism and L-isoleucine are as described above.

[0087] Specifically, the exogenous gene encoding glutamate dehydrogenase derived from Bacillus subtilis; and the exogenous gene encoding glutamate dehydrogenase derived from Rhodospirillales may have the nucleotide sequences of SEQ ID NOs: 2 and 4, respectively, but are not limited thereto.

[0088] Specifically, the method reduces the production of α-aminobutyric acid (AABA) relative to the production of L-isoleucine, but is not limited thereto.

[0089] As used herein, the term "culture" refers to growing the microorganisms of the present disclosure under appropriately regulated environmental conditions. The culture procedures of the present disclosure can be performed according to appropriate culture media or culture conditions known in the art. Such culture can be easily adjusted by those skilled in the art according to the selected strain. Specifically, the culture can be batch, continuous and / or fed-batch, but is not limited thereto.

[0090] As used herein, "culture medium" refers to a mixture containing nutrients required for culturing the microorganisms of the present disclosure as main components, wherein the culture medium provides nutrients including water, growth factors, etc. necessary for survival and growth. Specifically, for the culture medium and other culture conditions for culturing the microorganisms of the present disclosure, any culture medium used for culturing microorganisms in general can be used without particular limitation. However, the microorganisms of the present disclosure can be cultured under aerobic conditions in a common culture medium containing appropriate carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and / or vitamins while controlling temperature, pH, etc.

[0091] In the present disclosure, the carbon source may include carbohydrates (such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.); sugar alcohols (such as mannitol, sorbitol, etc.); organic acids (such as pyruvic acid, lactic acid, citric acid, etc.); and amino acids (such as glutamic acid, methionine, lysine, etc.). In addition, natural organic nutrient sources (such as starch hydrolysates, molasses, blackstrap molasses, rice bran, cassava, bagasse, and corn syrup) may also be used, and specifically, carbohydrates (such as glucose and sterilized pretreated molasses (i.e., molasses converted into reducing sugars)) may be used, and various other carbon sources may also be used in appropriate amounts without limitation. These carbon sources may be used alone or in combination of two or more thereof, but are not limited thereto.

[0092] As the nitrogen source, inorganic nitrogen sources (such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.); amino acids (such as glutamic acid, methionine, glutamine, etc.); and organic nitrogen sources (such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc.) can be used. These nitrogen sources can be used alone or in combination of two or more thereof, but are not limited thereto.

[0093] The phosphorus source may include potassium dihydrogen phosphate, potassium hydrogen phosphate and corresponding sodium salts. As for inorganic compounds, sodium chloride, calcium chloride, ferric chloride, magnesium sulfate, ferric sulfate, manganese sulfate, calcium carbonate, etc. may be used. In addition, amino acids, vitamins and / or suitable precursors may also be included. These components or precursors may be added to the culture medium in batches or continuously. However, the present disclosure is not limited thereto.

[0094] The pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid to the culture medium in an appropriate manner during the cultivation of the microorganism of the present disclosure. In addition, during the cultivation process, a defoamer (such as fatty acid polyethylene glycol ester) can be added to prevent foam generation. In addition, oxygen or oxygen-containing gas can also be injected into the culture medium to maintain the aerobic state of the culture medium, and gas can also not be injected or nitrogen, hydrogen or carbon dioxide gas can be injected to maintain the anaerobic or non-aerobic state of the culture medium, but it is not limited thereto.

[0095] The culture temperature may be maintained at 25 to 40° C., more specifically 28 to 37° C., but not limited thereto. The culture may be continued until a desired amount of useful substances is produced, and specifically the culture lasts for about 1 to 100 hours, but not limited thereto.

[0096] L-isoleucine produced by the culture of the present disclosure may be released into the medium or may remain in the cells.

[0097] The method for producing L-isoleucine of the present disclosure may further include the steps of preparing the microorganism of the present disclosure, preparing a culture medium for culturing the microorganism, or a combination thereof (regardless of the order, in any order), for example, before or after the culturing step.

[0098] The method for producing L-isoleucine of the present disclosure may further include a step of recovering L-isoleucine from the culture medium obtained from the culture (cultured culture medium) or the microorganism. A recovery step may be further included after the culture step.

[0099] Recovery can be a method of culturing microorganisms according to the present disclosure, using appropriate methods known in the art, such as batch, continuous or fed-batch culture, to collect the desired L-isoleucine. For example, centrifugation, filtration, treatment with a crystal protein precipitant (salting out), extraction, ultrasonic treatment, ultrafiltration, dialysis, various types of chromatography (such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography and affinity chromatography, etc.), HPLC and combinations of these methods can be used, and the desired L-isoleucine can be recovered from the culture medium or microorganism using appropriate methods known in the art.

[0100] In addition, the method for producing L-isoleucine of the present disclosure may further include a purification step. Purification may be performed using an appropriate method known in the art. In an exemplary embodiment, when the method for producing L-isoleucine of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, may be performed simultaneously or integrated into one step, but is not limited thereto.

[0101] Yet another aspect of the present disclosure provides a composition for producing L-isoleucine, the composition comprising a microorganism.

[0102] The microorganism and L-isoleucine are as described above.

[0103] Specifically, the exogenous gene encoding glutamate dehydrogenase derived from Bacillus subtilis; and the exogenous gene encoding glutamate dehydrogenase derived from Rhodospirillales may have the nucleotide sequences of SEQ ID NOs: 2 and 4, respectively, but are not limited thereto.

[0104] Specifically, the method reduces the production of α-aminobutyric acid (AABA) relative to the production of L-isoleucine, but is not limited thereto.

[0105] The composition of the present disclosure may further include any suitable excipient commonly used in a composition for producing L-isoleucine, and such excipient may include, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, isotonic agents, etc., but are not limited thereto.

[0106] Still another aspect of the present disclosure provides use of the microorganism having L-isoleucine-producing ability of the present disclosure for producing L-isoleucine, wherein a foreign gene encoding glutamate dehydrogenase originating from Bacillus subtilis or Rhodospirillales is introduced into the microorganism.

[0107] Example

[0108] Hereinafter, the present disclosure will be described in more detail with reference to exemplary embodiments. However, these exemplary embodiments are only for illustrating the present disclosure, and the scope of the present disclosure is not intended to be limited by these exemplary embodiments.

[0109] Example 1: Construction of a recombinant vector for introducing exogenous glutamate dehydrogenase

[0110] In order to insert the exogenous gdh overexpression vector into the chromosome of Corynebacterium glutamicum, the gene NCgl2872, which is called the transposon encoding Corynebacterium glutamicum, is used as an insertion site (Journal of Biotechnology 104, 5-25 Jorn Kalinowski et al, 2003). In order to replace the NCgl2872 gene with exogenous gdh, a vector for NCgl2872 deletion and target gene insertion is constructed. In order to construct the vector, the chromosome of ATCC13032 is used as a template and the primers of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8 are respectively carried out PCR. PfuUltra TM High-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions included: denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, and denaturation, annealing, and polymerization were repeated 28 times under these conditions. As a result, DNA fragments of 623 bp and 620 bp were obtained, respectively. The obtained DNA product was purified using a PCR purification kit (QUIAGEN), and an infusion cloning kit (TaKaRa) was used according to the manual provided, and the heat-treated pDCM2 vector was cloned (Korean Patent Publication No. 10-2020-0136813), thereby constructing the vector pDCM2ΔN2872 for NCgl2872 deletion and target gene insertion.

[0111] In order to produce a strain having the gdh promoter of the parent strain Corynebacterium glutamicum (into which exogenous gdh was introduced), PCR was performed using each chromosome of Corynebacterium glutamicum ATC13032, Escherichia coli, Bacillus subtilis, Rhodospirillales and Mycobacterium smegmatis as a template and the following primers: SEQ ID NO: 9 and SEQ ID NO: 10; or SEQ ID NO: 9 and SEQ ID NO: 11; or SEQ ID NO: 12 and SEQ ID NO: 13; or SEQ ID NO: 14 and SEQ ID NO: 15; or SEQ ID NO: 16 and SEQ ID NO: 17; or SEQ ID NO: 18 and SEQ ID NO: 19. The primer sequences for performing each PCR are shown in Table 1 below.

[0112] [Table 1]

[0113]

[0114] PfuUltra TM High-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions included: 95°C denaturation for 30 seconds; 55°C annealing for 30 seconds; and 72°C polymerization for 1 minute, and under these conditions, denaturation, annealing and polymerization were repeated 28 times. As a result, a 519bp DNA fragment in the gdh promoter region, a 1882bp DNA fragment in the gdh region of Corynebacterium glutamicum ATCC13032 including the promoter, a 1382bp DNA fragment in the gdh region of Escherichia coli, a 1313bp DNA fragment in the gdh (rocG) region of Bacillus subtilis, a 1424bp DNA fragment in the gdh region of Rhodospirillales, and a 1388bp DNA fragment in the gdh region of Mycobacterium smegmatis were obtained respectively.

[0115] PCR was performed using the amplified promoter and exogenous gdh DNA fragment as templates and the following primers: SEQ ID NO: 9 and SEQ ID NO: 13; or SEQ ID NO: 9 and SEQ ID NO: 15; or SEQ ID NO: 9 and SEQ ID NO: 17; or SEQ ID NO: 9 and SEQ ID NO: 19. PCR conditions included denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 2 minutes, 28 cycles, and then polymerization at 72°C for 5 minutes.

[0116] As a result, a 2Kb exogenous gdh DNA fragment having the gdh promoter of Corynebacterium glutamicum ATCC13032 and encoding exogenous glutamate dehydrogenase was amplified. The amplified product was purified using a PCR purification kit (QUIAGEN) and used as an insert DNA fragment for vector construction. The purified amplification product was treated with restriction enzyme SmaI, and then the pDCM2ΔN2872 vector was heat-treated at 65°C for 20 minutes, and the amplification product insert DNA fragment was prepared at a molar concentration ratio (M) of 1:2 and cloned using an infusion cloning kit (TaKaRa) according to the provided manual to construct vectors for introducing exogenous gdh into the chromosome, namely pDCM2ΔN2872::Pn_gdh(c.gl), pDCM2ΔN2872::Pn_gdh(Escherichia coli), pDCM2ΔN2872::Pn_rocG(B.su), pDCM2ΔN2872::Pn_gdh(Rhodospirillales) and pDCM2ΔN2872::Pn_gdh(m.sm).

[0117] Example 2: Preparation of Corynebacterium strains capable of producing L-isoleucine

[0118] Wild-type Corynebacterium glutamicum has the ability to produce L-isoleucine, but does not produce excessive L-isoleucine. Therefore, according to the purpose of the present disclosure, in order to identify the genetic traits that improve the L-isoleucine productivity, it is attempted to utilize the bacterial strain with the L-isoleucine productivity that improves.

[0119] First, an L-isoleucine producing strain was developed from wild-type Corynebacterium glutamicum ATCC13032. Specifically, in order to relieve the feedback inhibition of threonine, the precursor of isoleucine, in the L-isoleucine biosynthetic pathway, the gene hom encoding homoserine dehydrogenase was mutated to replace the 407th amino acid of arginine-homoserine dehydrogenase with histidine (Korean Patent No. 10-1996769). Specifically, the polynucleotide sequence encoding hom (R407H) is represented by SEQ ID NO: 20.

[0120] Specifically, in order to prepare a strain into which the hom(R407H) mutation was introduced, PCR was performed using the chromosome of Corynebacterium glutamicum ATCC13032 as a template and the following primers: SEQ ID NO: 21 and SEQ ID NO: 22; or SEQ ID NO: 23 and SEQ ID NO: 24. The primer sequences used for each of the above PCRs are shown in Table 2 below.

[0121] [Table 2]

[0122]

[0123] PfuUltra TM High-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions included 95°C denaturation for 30 seconds; 55°C annealing for 30 seconds; and 72°C polymerization for 1 minute, and under these conditions, denaturation, annealing, and polymerization reactions were repeated 28 times. As a result, a 1000 bp DNA fragment of the 5' upstream region and a 1000 bp DNA fragment of the 3' downstream region were obtained, centered on the mutation of the hom gene.

[0124] PCR was performed using the two amplified DNA fragments as templates and primers of SEQ ID NO: 21 and SEQ ID NO: 24. PCR conditions included denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, 28 cycles, followed by polymerization at 72°C for 5 minutes.

[0125] As a result, a 2kb DNA fragment was amplified, which contained a mutation in the hom gene encoding a homoserine dehydrogenase variant, in which the arginine at position 407 was replaced by histidine. The amplified product was purified using a PCR purification kit (QUIAGEN) and used as an insert DNA fragment for vector construction. The purified amplified product was treated with restriction enzyme SmaI, and then the pDCM2 vector was heat-treated at 65°C for 20 minutes, and then the amplified product was prepared with a molar concentration ratio (M) of 1:2 to insert the DNA fragment, and cloned using an infusion cloning kit (TaKaRa) according to the manual provided, thereby constructing a vector pDCM2-R407H for introducing the hom (R407H) mutation into the chromosome.

[0126] The constructed vector was transformed into Corynebacterium glutamicum ATCC13032 by electroporation, and a strain containing the hom(R407H) mutation on the chromosome was obtained through a second crossover process, which was named Corynebacterium glutamicum ATCC13032 hom(R407H).

[0127] In order to relieve the feedback to L-isoleucine and increase the activity in the prepared ATCC13032 hom(R407H) strain, the gene ilvA encoding L-threonine dehydratase was mutated so that the amino acid threonine at position 381 in L-threonine dehydratase (SEQ ID NO: 25) was replaced by alanine, and the amino acid phenylalanine at position 383 was replaced by alanine. In addition, a strain into which ilvA(T381A+F383A) was introduced was also prepared.

[0128] Specifically, in order to prepare a strain into which the ilvA (T381A + F383A) mutation was introduced, PCR was performed using the chromosome of Corynebacterium glutamicum ATCC13032 as a template and the following primers: SEQ ID NO: 26 and SEQ ID NO: 27; or SEQ ID NO: 28 and SEQ ID NO: 29. The primer sequences used for each of the above PCRs are shown in Table 3 below.

[0129] [Table 3]

[0130]

[0131] PfuUltra TMHigh-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions included: 95°C denaturation for 30 seconds; 55°C annealing for 30 seconds; and 72°C polymerization for 1 minute, and the denaturation, annealing and polymerization reactions were repeated 28 times under these conditions. As a result, a 1126 bp DNA fragment of the 5' upstream region and a 286 bp DNA fragment of the 3' downstream region were obtained, centered on the mutation of the ilvA gene.

[0132] PCR was performed using the two amplified DNA fragments as templates and primers of SEQ ID NO: 26 and SEQ ID NO: 29. PCR conditions included denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, 28 cycles, followed by polymerization at 72°C for 5 minutes.

[0133] As a result, a 1.4 kb DNA fragment was amplified, which contained a mutation in the ilvA gene encoding the L-threonine dehydratase variant, in which the threonine at position 381 was replaced by alanine, and the phenylalanine at position 383 was replaced by alanine. The amplified product was purified using a PCR purification kit (QUIAGEN) and used as an insert DNA fragment for vector construction. The purified amplified product was treated with restriction enzyme SmaI, and then the pDCM2 vector was heat-treated at 65°C for 20 minutes, and the amplified product insert DNA fragment was prepared at a molar concentration ratio (M) of 1:2, and cloned using an infusion cloning kit (TaKaRa) according to the manual provided, thereby constructing a vector pDCM2-ilvA (T381A + F383A) for introducing the ilvA (T381A + F383A) mutation into the chromosome.

[0134] The constructed vector was transformed into Corynebacterium glutamicum ATCC13032 hom(R407H) by electroporation, and through a secondary exchange process, a strain containing the ilvA(T381A+F383A) mutation on the chromosome was obtained and named Corynebacterium glutamicum CA10-3101.

[0135] For reference, in order to confirm whether the introduction of ilvA (T381A + F383A) into the L-isoleucine-producing strain increases the L-isoleucine production efficiency by releasing the feedback to L-isoleucine and increasing the activity, the following experiment was performed. Specifically, the results of measuring the concentrations of L-isoleucine and L-threonine in the culture medium of the KCCM11248P / pECCG117-ilvA (T381A + F383A) strain, in which the ilvA (T381A + F383A) mutation was introduced into the KCJI-38 (which was deposited at the Korea Collection of Microorganisms in Seoul, Korea on January 9, 2012, with the deposit number KCCM11248P, Korean Patent No. 10-1335789) strain, which is an L-isoleucine-producing strain treated with N-methyl-N'-nitrosoguanidine (NTG), are shown in Table 4 below.

[0136] [Table 4]

[0137]

[0138] As shown in Table 3, the KCCM11248P / pECCG117-ilvA(T381A+F383A) strain into which the ilvA(T381A+F383A) mutation was introduced was confirmed to have significantly increased L-isoleucine production and high L-threonine degradation rate compared to the KCCM11248P or KCCM11248P / pECCG117-ilvA(F383A) strain. In other words, for the purpose of the present disclosure, it was confirmed that the introduction of the ilvA(T381A+F383A) mutation would release the feedback to L-isoleucine and increase the activity.

[0139] Example 3: Preparation of L-isoleucine strains into which exogenous gdh is introduced and evaluation of isoleucine production capacity

[0140] The vector prepared in Example 1 was transformed into the Corynebacterium glutamicum CA10-3101 prepared in Example 2 by electroporation, and a strain into which exogenous gdh was introduced on the chromosome was obtained by a secondary exchange process. The introduction was confirmed by SEQ ID NO: 30 and SEQ ID NO: 31. The primer sequences used to perform PCR are shown in the table below.

[0141] [Table 5]

[0142] SEQ ID NO. name sequence 30 Primers AACTGATGCCTGAGGACAAG 31 Primers GCTTGATACCGAAGCAAACC

[0143] The strain introduced with CA10-3101ΔN2872 was named CA10-3135, the strain introduced with CA10-3101ΔN2872::Pn_gdh(C.gl) was named CA10-3136, the strain introduced with CA10-3101ΔN2872::Pn_gdh(eco) was named CA10-3137, the strain introduced with CA10-3101ΔN2872::Pn_rocG(B.su) was named CA10-3138, the strain introduced with CA10-3101ΔN2872::Pn_gdh(rhodospirillales) was named CA10-3139 and the strain introduced with CA10-3101ΔN2872::Pn_gdh(m.sm) was named CA10-3140.

[0144] In order to confirm the effects of the six strains thus prepared on improving the L-isoleucine productivity and reducing the byproduct α-aminobutyric acid (AABA), the fermentation titer of each strain was evaluated in the following manner. The parent strain and the mutant strain were inoculated into a 250 ml baffled flask containing 25 ml of an isoleucine production medium, respectively, and then cultured at 32° C. with shaking at 200 rpm for 60 hours to produce L-isoleucine.

[0145] The composition of the production medium used in this example is as follows.

[0146] <Production medium>

[0147] 10% glucose, 0.2% yeast extract, 1.6% ammonium sulfate, 0.1% potassium dihydrogen phosphate, 0.1% magnesium sulfate heptahydrate, 10 mg / l ferrous sulfate heptahydrate, 10 mg / l manganese sulfate monohydrate, 200 μg / l biotin, pH 7.2

[0148] After the cultivation was completed, the production amounts of L-isoleucine and α-aminobutyric acid (AABA) were measured using high performance liquid chromatography (HPLC), and the concentrations are shown in Table 6 below.

[0149] [Table 6]

[0150] L-Isoleucine concentration (g / L) AABA concentration (g / L) CA10-3101 (parent strain) 2.4 0.8 CA10-3135 2.5 1.6 CA10-3136 2.6 1.4 CA10-3137 2.5 1.7 CA10-3138 2.6 0.8 CA10-3139 2.5 0.7 CA10-3140 2.7 2.1

[0151] As a result, as shown in Table 6, it was confirmed that L-isoleucine increased by 8.3% in CA10-3136 and CA10-3138, increased by 4.2% in CA10-3135, CA10-3137 and CA10-3139, and increased by 12.5% ​​in CA10-3140 compared with the parent strain. It was confirmed that the byproduct AABA increased by 100% in CA10-3135, increased by 75% in CA10-3136, increased by 112.5% ​​in CA10-3137, and increased by 162.5% in CA10-3140 compared with the parent strain, while the byproduct AABA in CA10-3138 was the same as the parent strain, and decreased by 12.5% ​​in CA10-3139.

[0152] Therefore, confirm that compared with parent strain Corynebacterium glutamicum CA10-3101, the production of α-aminobutyric acid (AABA) is reduced relative to the production of L-isoleucine in the bacterial strain (CA10-3138, CA10-3139) having imported rocG (b.su) or gdh (Rhodospirillales). Also confirm that compared with Corynebacterium glutamicum ATCC13032 (i.e. CA10-3135) having imported gdh, the production of L-isoleucine is at the same level, but the production of α-aminobutyric acid (AABA) reduces. Therefore, confirm that when importing various exogenous gdh genes, from the gene of the coding glutamate dehydrogenase of rocG (b.su) or gdh (Rhodospirillales), by-products reduce, and the output of L-isoleucine is maintained simultaneously, thereby improving the fermentation purity of L-isoleucine.

[0153] Example 4: Preparation of exogenous gdh-enhanced strain from L-isoleucine-producing Corynebacterium glutamicum KCCM11248P strain and evaluation

[0154] The rocG (derived from b.su) or gdh (derived from Rhodospirillales) confirmed in Example 3 to effectively improve the production capacity of L-isoleucine and reduce by-products was introduced into KCJI-38 (KCCM11248P, Korean Patent No. 10-1335789) by the electric pulse method-KCJI-38 is an L-isoleucine production strain treated with N-methyl-N'-nitro-N-nitrosoguanidine (NTG), and then it was spread on the selection medium containing 25mg / L kanamycin for transformation. Through the secondary exchange process, a strain with exogenous gdh introduced on the chromosome was obtained. Thereafter, the concentration of L-isoleucine and by-products in the culture medium was measured in the same manner as in Example 3, and the results are shown in Table 7 below.

[0155] [Table 7]

[0156] L-Isoleucine(g / L) AABA concentration (g / L) KCCM11248P (parent strain) 1.4 0.7 KCCM11248PΔN2872::Pn_gdh(C.gl) 1.6 1.4 KCCM11248PΔN2872::Pn_rocG(B.su) 1.6 0.7 KCCM11248PΔN2872::Pn_gdh (Rhodospirillales) 1.7 0.6

[0157] As shown in Table 7, it was confirmed that the byproduct AABA was reduced in the strains into which rocG (b.su) or gdh (Rhodospirillales) was introduced compared to the parent strain KCCM11248P. Specifically, it was confirmed that the byproduct AABA was reduced in the KCCM11248PΔN2872::Pn_rocG (B.su) and KCCM11248PΔN2872::Pn_gdh (Rhodospirillales) strains, while the L-isoleucine productivity was maintained and the fermentation purity of L-isoleucine was improved, which was different from the KCCM11248PΔN2872::Pn_gdh (C.gl) strain in which the concentrations of L-isoleucine and AABA were increased.

[0158] Therefore, it was confirmed that the microorganism of the present disclosure into which the foreign gene encoding glutamate dehydrogenase derived from Bacillus subtilis or Rhodospirillales was introduced can produce L-isoleucine at a high yield by improving the purity of L-isoleucine.

[0159] Based on the above description, those skilled in the art will understand that it can be realized in different specific forms without changing the technical spirit or its basic features of the present disclosure. In this regard, it should be understood that the above-mentioned embodiments are not restrictive, but illustrative in all aspects. The scope of the present disclosure is limited by the attached claims rather than by their previous description, so all changes and modifications falling within the limits of the claims or the equivalents of such limits are intended to be covered by the claims.

Claims

1. A microorganism capable of producing L-isoleucine, wherein a foreign gene encoding glutamate dehydrogenase derived from Bacillus subtilis or Rhodospirillales is introduced into the microorganism.

2. The microorganism according to claim 1, wherein the exogenous gene encoding glutamate dehydrogenase derived from Bacillus subtilis; and the exogenous gene encoding glutamate dehydrogenase derived from Rhodospirillales have the nucleotide sequences of SEQ ID NOs: 2 and 4, respectively.

3. The microorganism according to claim 1, wherein the production of α-aminobutyric acid (AABA) by the microorganism is reduced relative to the production of L-isoleucine. The microorganism according to claim 1 , wherein the microorganism is a microorganism of the genus Corynebacterium . The microorganism according to claim 4 , wherein the Corynebacterium microorganism is Corynebacterium glutamicum .

6. A method for producing L-isoleucine, comprising the step of culturing in a culture medium a microorganism capable of producing L-isoleucine, into which a foreign gene encoding glutamate dehydrogenase originating from Bacillus subtilis or Rhodospirillales is introduced.

7. The method according to claim 6, further comprising the step of recovering L-isoleucine from the cultured microorganism or culture medium.

8. The method according to claim 6, wherein the exogenous gene encoding glutamate dehydrogenase derived from Bacillus subtilis; and the exogenous gene encoding glutamate dehydrogenase derived from Rhodospirillales have the nucleotide sequences of SEQ ID NOs: 2 and 4, respectively.

9. The method of claim 6, wherein the method reduces the production of alpha-aminobutyric acid (AABA) relative to the production of L-isoleucine.

10. A composition for producing L-isoleucine, comprising a microorganism capable of producing L-isoleucine, into which a foreign gene encoding glutamate dehydrogenase originating from Bacillus subtilis or Rhodospirillales is introduced.

11. The composition according to claim 10, wherein the exogenous gene encoding glutamate dehydrogenase derived from Bacillus subtilis; and the exogenous gene encoding glutamate dehydrogenase derived from Rhodospirillales have the nucleotide sequences of SEQ ID NOs: 2 and 4, respectively.

12. The composition of claim 11, wherein the composition reduces the production of alpha-aminobutyric acid (AABA) relative to the production of L-isoleucine.

Images