Construction method and application of kluyveromyces marxianus capable of producing succinic acid

Abstract

The invention discloses a construction method and application of Kluyveromyces marxianus capable of producing succinic acid, and belongs to the technical field of biology. According to the invention, an ethanol metabolism pathway gene PDC1 is knocked out, succinic acid reduction synthesis pathway related genes are overexpressed in cells, the PDC1 gene is knocked out by adopting a CRISPR-Cas9 technology, overexpression of the pathway gene in the cells is realized by adopting an NHEJ technology, and an excellent strain for high yield of succinic acid is constructed. After the strain constructed by the invention is subjected to fed-batch fermentation culture in a 5L fermentation tank, the yield of succinic acid reaches 42.9 g / L, and the conversion rate reaches 0.37 g / g glucose. The strain constructed by the invention has a good application prospect in the fields of chemical engineering, degradable materials and food.

Description

Technical Field

[0001] The invention relates to a construction method of a succinic acid-producing Kluyveromyces marxianus strain and application thereof, belonging to the field of biotechnology. Background Art

[0002] Succinic acid is an important C4 platform compound and is listed as the first of the 12 most promising bulk bio-based chemicals by the U.S. Department of Energy. As a starting material for the synthesis of general chemicals, succinic acid has a wide range of applications in food, chemistry, medicine and other fields. Succinic acid can also be used as a precursor for the production of high-value chemicals (such as 1,4-butanediol and tetrahydrofuran), as well as a monomer for the synthesis of biodegradable polymers (such as polybutylene succinate).

[0003] At present, the production of succinic acid is mainly synthesized by chemical synthesis route, that is, hydrogenation of maleic anhydride obtained from the C4 fraction of crude oil refineries. With the increasing demand for reducing carbon emissions in the production process of chemicals, the production of succinic acid from biomass materials rather than crude oil products has received more and more attention. The production of succinic acid by fermentation can get rid of the dependence on non-renewable strategic resource oil, use renewable resources, fix carbon dioxide to reduce the greenhouse effect, and show good development prospects. At present, the biological synthesis hosts of succinic acid are mainly various bacteria, such as succinic acid-producing actinobacillus, Mannheim succinic acid-producing bacteria, glutamicum and Escherichia coli. The production strain determines the fermentation yield, yield and production intensity, and then determines the economic benefits of biological production. The production strain also determines the supporting fermentation and downstream separation process, thereby determining the overall production cost of succinic acid. The genetic background of strictly anaerobic bacteria such as succinic acid-producing actinobacillus and Mannheim succinic acid-producing bacteria is unclear, and the production of succinic acid requires a strictly anaerobic fermentation environment, which is extremely difficult to achieve in industrial applications.

[0004] Compared with bacterial production strains, yeast has the characteristics of high acid and high osmotic pressure resistance. The biggest advantage of yeast as an organic acid production strain is that it can directly convert carbon sources into succinic acid under low pH conditions, which makes the downstream purification of the product only include filtration, distillation and crystallization steps, which are fewer steps and lower cost than bacteria. In the long run, considering the cost of industrial production, if the problems of low yield and productivity in production are solved, yeast is more suitable for the biomanufacturing of succinic acid than bacteria. Saccharomyces cerevisiae is a model eukaryotic organism with a clear genetic background and fast molecular manipulation, making it the first host selected in succinic acid production. However, Saccharomyces cerevisiae grows slowly, the TCA cycle flux is naturally small, and Saccharomyces cerevisiae has a glucose effect, a large ethanol metabolic flux, and tends to produce ethanol under high glucose concentrations and anaerobic conditions. At the same time, the irreversible catalysis of Saccharomyces cerevisiae's natural fumarase also limits the ability to produce succinic acid. Kluyveromyces marxianus is an unconventional yeast with strong pentose and inulin metabolism ability, and can tolerate high temperature of 52°C. It has certain advantages in ethanol production and simultaneous saccharification and fermentation, and can reduce the cooling cost and risk of contamination. At the same time, Kluyveromyces marxianus is the fastest growing eukaryotic organism known so far. These excellent traits make Kluyveromyces marxianus a potential host for succinic acid production, with great industrial application value. However, the currently disclosed Kluyveromyces marxianus engineered bacteria do not have the function of being resistant to low pH and producing succinic acid efficiently at the same time. Summary of the invention

[0005] The present invention provides a genetic engineering bacterium for producing succinic acid, which can produce succinic acid by fermentation in a medium containing glucose.

[0006] In one embodiment, the starting strain of the genetically engineered bacteria is Kluyveromyces Marxianus NBRC 1777.

[0007] In one embodiment, the genetically engineered bacteria also knocks out the pyruvate decarboxylase gene PDC1 located in the genome.

[0008] In one embodiment, the nucleotide sequence of the pyruvate decarboxylase gene PDC1 is as shown in GenBank: L09727.1.

[0009] In one embodiment, the genetically engineered bacteria overexpress pyruvate carboxylase, malate dehydrogenase, fumarase and fumarate reductase, and overexpress a dicarboxylate transporter.

[0010] In one embodiment, the pyruvate carboxylase (EC 6.4.1.1) is encoded by a PYC gene; the pyruvate carboxylase is RoPYC derived from Rhizopus oryzae, and the nucleotide sequence of RoPYC is shown in SEQ ID NO.1.

[0011] In one embodiment, malate dehydrogenase (EC 1.1.1.37 (NADH-dependent)) is encoded by an MDH gene; the malate dehydrogenase is KmMDH from Kluyveromyces marxianus, and the nucleotide sequence of KmMDH is shown in SEQ ID NO.2.

[0012] In one embodiment, fumarase (EC 4.2.1.2) is encoded by the FUM gene; the fumarase is EcFUM derived from Escherichia coli, and the nucleotide sequence of EcFUM is shown in SEQ ID NO.3.

[0013] In one embodiment, the fumarate reductase (EC 1.3.1.6) is encoded by the FRD gene; the fumarate reductase is TbFRD derived from Trypanosoma brucei, and the nucleotide sequence of TbFRD is shown in SEQ ID NO.4.

[0014] In one embodiment, the dicarboxylic acid transporter is SpMAE derived from Schizosaccharomyces pombe, and the nucleotide sequence of SpMAE is shown in SEQ ID NO.5.

[0015] The present invention also provides a method for producing succinic acid by fermentation using the genetically engineered bacteria. The method comprises culturing and fermenting the yeast using glucose as a carbon source and yeast powder and ammonium sulfate as nitrogen sources.

[0016] In one embodiment, the initial glucose concentration is controlled to be 70 g / L. When the glucose concentration is lower than 10 g / L, 800 g / L of glucose mother solution is added to control the glucose concentration between 10 g / L and 40 g / L.

[0017] In one embodiment, the concentration of yeast powder is 5-10 g / L.

[0018] In one embodiment, the pH of the fermentation process is controlled at 3 to 3.5.

[0019] In one embodiment, the fermentation process has an aeration rate of 0.5 to 2 vvm.

[0020] In one embodiment, the stirring speed during the fermentation process is 100-400 rpm.

[0021] In one embodiment, the dissolved oxygen in the fermentation process is controlled at 5-15%.

[0022] In one embodiment, the fermentation process temperature is 37-42°C.

[0023] The present invention also provides application of the Kluyveromyces marxianus engineered bacteria or the method for producing succinic acid in the fields of chemical industry, degradable materials and food.

[0024] Beneficial effects:

[0025] The present invention discloses a new engineered strain of Kluyveromyces marxianus, which exhibits the ability to accumulate succinic acid at low pH. In the fermentation of the engineered strain K.marxianus SA1 in a 5L fermenter, the pH gradually decreases from 6.0 to 3.0-3.5 during the fermentation process, and the output and yield of succinic acid after 96h of fermentation reach 42.9g / L and 0.37g / g, respectively. The strain constructed by the present invention effectively reduces the addition of neutralizers, the difficulty and cost of downstream separation and purification, and the risk of bacterial contamination during the fermentation process, and has the potential for industrial application in the production of succinic acid by low pH fermentation. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 1 is a map of plasmid pCAS9-PDC1 constructed in one embodiment of the present invention.

[0027] Figure 2 Agarose gel electrophoresis verification of the PCR product of the PDC1 gene knockout in the strain K. marxianus 002 in Example 1 of the present invention, lane M represents a 5000 bp marker, lane 1 represents the band of the PDC1 gene on the genome of the control strain NBRC 1777, and lanes 2-8 represent the bands of PDC1 on the genomes of seven different transformants.

[0028] Figure 3 1 is a map of plasmid pY26-RoPYC-TbFRD constructed in one embodiment of the present invention.

[0029] Figure 4 The figure is a map of the plasmid pIPTT131-MDH-FUM-MAE constructed in one embodiment of the present invention.

[0030] Figure 5Agarose gel electrophoresis verification of PCR products overexpressing genes of the succinate reduction synthesis pathway in the strain K. marxianus 003 constructed in Example 2 of the present invention, lane M represents a 5000 bp marker, lanes 1 to 6 represent the control strain K. marxianus 003, lanes 7 to 12 represent bands of PYC, MAE, MDH, FUM, FRD, and URA genes on the integrated plasmid, and lanes 13 to 18 represent bands of PYC, MAE, MDH, FUM, FRD, and URA genes on the genome of the strain K. marxianus SA1.

[0031] Figure 6 The results are shown in Figure 1 and Figure 2. The results are shown in ...

[0032] Figure 7 The succinic acid yield after fermentation of the recombinant bacteria constructed in the examples and comparative examples. DETAILED DESCRIPTION

[0033] LB medium: 10g / L NaCl, 5g / L yeast extract, 10g / L peptone. LB medium is used for the construction and purification of free expression vectors. When the cells contain recombinant plasmids, the final concentrations of the corresponding antibiotics added to the medium are: ampicillin 100mg / L, kanamycin 50mg / L.

[0034] YPD medium: 20 g / L glucose, 10 g / L yeast extract, 20 g / L peptone.

[0035] YNB medium: 6.67 g / L yeast basal nitrogen source, 20 g / L glucose, and appropriate concentrations of defective amino acid mixtures.

[0036] Fermentation medium: 70 g / L glucose, 2 g / L (NH4)2SO4, 0.5 g / L KH2PO4, 5 g / L yeast extract, metal ion solution (15 mg / L EDTA, 4.5 mg / L ZnSO4·7H2O, 0.3 mg / L CoCl2·6H2O, 1 mg / L MnCl2·4H2O, 4.5 mg / L MnCl2·4H2O, 4.5 mg / L CaC12·H2O, 0.3 mg / L CuSO4·4H2O, 3 mg / L FeSO4·7H2O, 1 mg / L H3BO4, 0.1 mg / L KI, 0.4 mg / L NaMoO4·2H2O), 1 mL / L vitamin solution;

[0037] The vitamin solution contains (calculated by final concentration): 0.05 mg / L D-(+)-biotin, 1 mg / L D-pantothenic acid hemi-calcium salt, 1 mg / L nicotinic acid, 25 mg / L inositol, 1 mg / L thiamine hydrochloride, 1 mg / L pyridoxine hydrochloride, and 0.2 mg / L p-aminobenzoic acid.

[0038] Adding 1.5-2% agar powder to the above culture medium can make the corresponding solid culture medium, among which YPD and YNB culture media are sterilized at 115℃ for 15 minutes, other culture media are sterilized at 121℃ for 15 minutes, CaCO3 is packaged in glass test tubes and sterilized separately at 115℃ for 30 minutes, and urea and vitamin solution are sterilized by filtration.

[0039] Determination of organic acids, glycerol and ethanol: Detection was performed using a high performance liquid chromatograph (Dionex UltiMate3000Series, Thermo Scientific, USA). The chromatographic columns for succinic acid, malic acid, pyruvic acid, lactic acid, fumaric acid and α-ketoglutaric acid were Aminex HPX-87H from BioRad, the mobile phase was 5mmol / L H2SO4, the flow rate was 0.6mL / min, the column temperature was 52°C, the injection volume was 10μL, the detector was an ultraviolet detector, and the detection wavelength was 210nm. The chromatographic columns for glycerol and ethanol were C18 (5μm 4.6×250mm), mobile phase: 5mmol / L H2SO4; column temperature: 52℃; flow rate: 0.6mL / min; injection volume: 10μL; detector: differential detector.

[0040] Glucose determination method: Shenzhen Silman biosensor analyzer M-100 was used for detection.

[0041] Biomass determination method: Use Shimadzu UV-visible spectrophotometer to detect. Dilute the fermentation broth to an appropriate multiple with 0.2M dilute hydrochloric acid, let it stand for 10 minutes, and then take 2 mL to measure its absorbance at a wavelength of 600 nm.

[0042] Example 1: Construction of uracil- and leucine-deficient Kluyveromyces marxianus

[0043] Homologous recombination was used to knock out the URA3 gene of Kluyveromyces marxianus NBRC 1777 to construct a uracil auxotrophic strain. The specific steps are as follows: primers were designed based on the upstream and downstream sequences of the URA3 gene region of Kluyveromyces marxianus. According to the genome sequence of Kluyveromyces marxianus NBRC 1777 published on NCBI, the URA3 locus region and its corresponding nucleotide sequence (GenBank: 81249988) were found, and the upstream homology arm and downstream homology arm of URA3 were amplified by PCR. The primers were designed as follows:

[0044] URA3-UF:TTAGGCGCCTGTCACGGCTCT;

[0045] URA3-UR:GTATTCTGGGCCTCCATGTCCCTCCTTTGATTAGTTTATG;

[0046] URA3-DF:GAATGCTGGTCGCTATACTGGAGTTCTCCGAGAACAAGCAG;

[0047] URA3-DR:GAGTATAGACGCATGAAGTC.

[0048] The kanMX kanamycin tag was amplified from the pUG6 vector by PCR, and the primers were designed as follows:

[0049] kanMX-F: CATAAAACTAATCAAAGGAGGGACATGGAGGCCCAGAATAC;

[0050] kanMX-R:CTGCTTGTTCCGGAGAACTCCAGTATAGCGACCAGCATTC.

[0051] The upstream and downstream homologous arms and kanamycin tags were connected into a gene fragment, namely Donor DNAΔURA3, by one-step homologous recombination technology, and amplified by PCR. This fragment was transformed into the wild-type strain of K. marxianus NBRC 1777 to verify the primers. PCR screening was performed and the engineered bacteria with successful knockout of the URA3 gene were isolated by streaking on a plate supplemented with kanamycin. The engineering bacteria were named K. marxianus001 (ΔURA3). The verification primers were designed as follows:

[0052] YZ-ΔURA3-F: AAGTGACGAATTCTGATTGG;

[0053] YZ-ΔURA3-R: AGAGGTAAAGTCGTTGACAC.

[0054] On the basis of K.marxianus001 (ΔURA3), the CRISPR-Cas9 method was further used to knock out the LEU2 gene. The specific steps are as follows: Design primers based on the upstream and downstream sequences of the LEU2 gene region of Kluyveromyces marxianus. According to the genome sequence of Kluyveromyces marxianus NBRC 1777 published on NCBI, find the LEU2 locus region and its corresponding nucleotide sequence (GenBank: 81249990), and select the cutting site N20-LEU2 (GATGAAGCTTCCGTCATTCC) in the region. Design the reverse amplification primers for the pCAS9 full plasmid PCR to obtain the pCAS9-LEU2 knockout plasmid, and the primers are designed as follows:

[0055] sgRNA-LEU2-F:

[0056] CTATTTCTAGCTCTAAAACGGAATGACGGAAGCTTCATCGACGAGCTTACTCGTTTCGT;

[0057] sgRNA-LEU2-R:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTAT C.

[0058] The upstream homology arm and downstream homology arm of LEU2 were amplified by PCR, and the primers were designed as follows:

[0059] LEU2-UF:ATCACGTGTACAAAAACTCT;

[0060] LEU2-UR:GTAATATTAGAGTCAAAGCCGTTTTATTATGTGGTTGATG;

[0061] LEU2-DF:CATCAACCACATAATAAAACGGCTTTGACTCTAATATTAC;

[0062] LEU2-DR:CAGAGCTTCTAAATACTCTG.

[0063] The upstream and downstream homologous arms were connected into a gene fragment, namely Donor DNAΔLEU, by one-step homologous recombination technology, and amplified by PCR. Then, pCAS9-LEU1 and this fragment were co-transformed into the engineering strain K.marxianus001 constructed above, and the gene was knocked out by CRISPR-Cas9 technology. The engineered bacteria with successful knockout of the LEU2 gene were screened by PCR to verify the primers and separated by streaking on uracil-deficient plates, named K.marxianus002 (ΔURA3, ΔLEU2). The verification primers were designed as follows:

[0064] YZ-LEU2-F:TGTTGAAACTTGTGTCCCCT;

[0065] YZ-LEU2-R: CAGGCTTTGGTGAAGCTGCT.

[0066] After gene editing is completed, the strain containing the pCAS9 plasmid is inoculated into the YPD medium, cultured at 37°C for 1-2 days, and then diluted and spread on the YNB plate with a certain concentration of uracil and 5-FOA, and cultured at 37°C for 2-3 days. The isolated colonies are screened on the YNB plate with uracil added and the YNB plate without uracil added in turn. Pick a single colony that does not grow on the YNB plate without uracil but can grow on the YNB plate with uracil added. This single colony is the engineered strain that has eliminated the pCAS9 plasmid.

[0067] Example 2: Construction of Kluyveromyces marxianus with Eliminated Ethanol Production Capability

[0068] Based on the strain constructed in Example 1, the CRISPR-Cas9 method was used to knock out the PDC1 gene to reduce ethanol accumulation. The specific implementation method is as follows: primers are designed based on the upstream and downstream sequences of the PDC1 gene region of Kluyveromyces marxianus. According to the genome sequence of Kluyveromyces marxianus NBRC 1777 published on NCBI, the PDC1 locus region and its corresponding nucleotide sequence (GenBank: L09727.1) were found, and the cutting site N20-PDC1 (ACGAAGTCCCAGGTATGAGA) was selected in the region. Reverse amplification primers for pCAS9 full plasmid PCR were designed to obtain the pCAS9-PDC1 knockout plasmid (such as Figure 1 The primers were designed as follows:

[0069] sgRNA-PDC1-F: CTATTTCTAGCTCTAAAACTCTCATACCTGGGACTTCGTGACGAGCTTACTCGTTTCGT;

[0070] sgRNA-PDC1-R:

[0071] ACGAAGTCCCAGGTATGAGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC;

[0072] The upstream homology arm and downstream homology arm of PDC1 were amplified by PCR, and the primers were designed as follows:

[0073] PDC1-UF:GAAGGCTGCCAGTGACTGCTACT;

[0074] PDC1-UR: GTAATTTATCTCTTTATCCTCTCCCTCTTGCAATTATTTGGTTTGGGTGTGG;

[0075] PDC1-DF:CCACACCCAAACCAAATAATTGCAAGAGGGAGAGGATAAAGAGATAAATTAC;

[0076] PDC1-DR:GAAGTCGATCTCGTCTCCTTC;

[0077] The upstream and downstream homologous arms were connected into a gene fragment, namely Donor DNA1, by one-step homologous recombination technology, and amplified in large quantities by PCR. Subsequently, pCAS9-PDC1 and this fragment were co-transformed into the engineering strain K. marxianus002 (NBRC 1777ΔURA3, ΔLEU2) constructed in Example 1, and the gene was knocked out by CRISPR-Cas9 technology. The engineering bacteria K. marxianus003 (ΔURA3, ΔLEU2, ΔPDC1) with successful knockout of the PDC1 gene was obtained by PCR screening of the verification primers and streaking on a uracil-deficient plate. The verification primers were designed as follows:

[0078] YZ-ΔPDC1-F: AACAACCGTCCAGCTT;

[0079] YZ-ΔPDC1-R: ATCTTCGGACTCATGAGTTG.

[0080] After gene editing is completed, the strain containing the pCAS9 plasmid is inoculated into the YPD medium, cultured at 37°C for 1-2 days, and then diluted and spread on the YNB plate with a certain concentration of uracil and 5-FOA, and cultured at 37°C for 2-3 days. The isolated colonies are screened by copying on the YNB plate with uracil added and the YNB plate without uracil added. Pick the single colony that does not grow on the YNB plate without uracil added but grows on the YNB plate with uracil added. This single colony is the engineered strain that has eliminated the pCAS9 plasmid.

[0081] Example 3: Construction of succinic acid producing yeast with a reductive TCA pathway

[0082] Based on the strain constructed in Example 2, this example uses non-homologous end joining (NHEJ) to integrate the linearized plasmid pY26-RoPYC-TbFRD and 131-MDH-FUM-MAE carrying the overexpression frame of the pathway gene into the yeast genome. The yeast strain provided by the present invention optionally has or has enhanced at least one of the following activities: (i) pyruvate carboxylase activity, (ii) malate dehydrogenase activity, (iii) fumarase activity, (iv) soluble fumarate reductase activity and (v) dicarboxylate transporter activity. The specific implementation method is as follows: Primers are designed based on the codon-optimized TbFRD nucleotide sequence (shown in SEQ ID NO.4), the RoPYC nucleotide sequence (shown in SEQ ID NO.1) and the integration plasmid pY26 sequence:

[0083] RoPYC-F: TCTAGAACTAGCGCGGCCGCATGCCTGCTGCACCAGTACG;

[0084] RoPYC-R:CAAACCTCTGGCGAAGAATTTTAGGCTTCCTCTTTGACAACC;

[0085] TbFRD-F: AACTAGTGGATCCCCCGGGCATGGTTGACGGTAGATCCTC;

[0086] TbFRD-R: TTACATGACTCGAGGTCGACTCAGGACCCGCTTGGTTCAG;

[0087] pY26-Scaffold-F: CTGAACCAAGCGGTCCTGAGTCGACCTCGAGTCATGTAA;

[0088] pY26-Scaffold-R: TTGTCAAAGAGGAAGCCTAAAATTCTTCGCCAGAGGTTTG;

[0089] pY26-TEF-GPD-F:CGTACTGGTGCAGCAGGCATGCGGCCGCGCTAGTTCTAGAAAACTT;

[0090] pY26-TEF-GPD-R:GAGGATCTACCGTCAACCATGCCCGGGGGATCCACTAGTT;

[0091] Using the codon-optimized TbFRD gene sequence (shown in SEQ ID NO.4) and the RoPYC gene sequence (shown in SEQ ID NO.1) as templates, PCR amplification was used to obtain the assembly fragments carrying the corresponding terminal homologous sequences. Using the pY26-TEF-GPD plasmid as a template, PCR amplification was used to obtain the plasmid backbone and promoter fragments carrying the corresponding terminal homologous sequences. The plasmid backbone, promoter fragment and gene fragment were combined into a circular plasmid, namely pY26-RoPYC-TbFRD (shown in SEQ ID NO.1) by a one-step multi-fragment homologous recombination method. Figure 3 The integration plasmid pY26-RoPYC-TbFRD was linearized and purified, and then transformed into the engineering strain K. marxianus 003 constructed in Example 2. The gene integration was completed by non-homologous end ligation. The engineering strain K. marxianus SA1 with successful integration of PYC and FRD was obtained by PCR screening with verification primers and streaking on a YNB plate with leucine added. The verification primers were designed as follows:

[0092] YZ-PYC-F: GGCCACCAAATCACCAGCGGATAA;

[0093] YZ-PYC-R: CCATTCGTAGAAATAGCGAAGTGAT;

[0094] YZ-FRD-F: TGCCTCTATTGTTGCTGTCGATCC;

[0095] YZ-FRD-R:TTCATCGACGGTTTCTAACCAAGTTC.

[0096] On the basis of the YePlac181 vector, promoters PGK (nucleotide sequence as shown in SEQ ID NO.6), TDH (nucleotide sequence as shown in SEQ ID NO.7) and Tpi (nucleotide sequence as shown in SEQ ID NO.8) were introduced to construct the integration vector pIPTT131; primers were designed based on the nucleotide sequence of KmMDH (shown in SEQ ID NO.2), EcFUM nucleotide sequence, SpMAE nucleotide sequence and the gene sequence of the integration vector pIPTT131:

[0097] KmMDH-F:TCGACGGTATCGATAAGCTTTCACAACTTTGTCTGCTGCG;

[0098] KmMDH-R: ATTCTAGAACTAGTGGATCCATGGTTAGCGTTGCAGTATT;

[0099] EcFUM-F: ATCAATTAATTTGAATTAACGTCGACTTAACGCCCGGCTT;

[0100] EcFUM-R: TACATAAACTAAAACCGCGGATGAATACAGTACGCAGCGA;

[0101] SpMAE-F: CTAAGTTTTCTAGAACTAGTATGGGTGAACTCAAGGAAAT;

[0102] SpMAE-R: TCCTGCAGCCCGGGGGATCCTTAAAACGCTTTCATGTTCAC;

[0103] 131-Scaffold-F:TCCGCTGCGTACTGTATTCATCCGCGGTTTTAGTTTATGTA;

[0104] 131-Scaffold-R:CGCAGCAGACAAAGTTGTGAAAGCTTATCGATACCGTCGA;

[0105] 131-PGK-TDH-F:AATACTGCAACGCTAACCATGGATCCACTAGTTCTAGAAT;

[0106] 131-PGK-TDH-R:ATTTCCTGAGTTCACCCATACTAGTTCTAGAAAACTTAG;

[0107] 131-CYC-FBA-F:GTGAACATGAAAGCGTTTAAGGATCCCCCGGGCTGCAGGA;

[0108] 131-CYC-FBA-R:AAGCCGGGCGTTAAGTCGACGTTAATTCAAATTAATTGAT;

[0109] Using the codon-optimized EcFUM gene sequence (shown in SEQ ID NO.3) and the SpMAE gene sequence (shown in SEQID NO.5) as templates, PCR amplification was used to obtain the assembly fragments carrying the corresponding terminal homologous sequences. Using the NBRC 1777 genome (GenBank: GCA_001417835.1) as a template, PCR amplification was used to obtain the assembly fragments carrying the corresponding terminal homologous sequences. Using the pIPTT131 plasmid as a template, PCR amplification was used to obtain the plasmid backbone and promoter fragments carrying the corresponding terminal homologous sequences. The plasmid backbone, promoter fragment and gene fragment were combined into a circular plasmid using a one-step multi-fragment homologous recombination method, namely pIPTT131-MDH-FUM-MAE (as shown in FIG. Figure 4 The integration plasmid pIPTT131-MDH-FUM-MAE was linearized and recovered and purified, and then transformed into the engineering strain K. marxianus SA constructed in Example 3. The gene integration was completed by non-homologous end ligation. The engineering strain K. marxianus SA1 with successful integration of the pathway gene was obtained by PCR screening with verification primers and streaking on a YNB plate. The verification primers were designed as follows:

[0110] YZ-MDH-F:AAAAGGCGAGACCCTTCTTGATGTT;

[0111] YZ-MDH-R: AGGATCATCCGGAGGCATTGGCCAA;

[0112] YZ-FUM-F: GCCGACCATCTGTTCTGGCCGTACC;

[0113] YZ-FUM-R: AGATTCGATGGGGGCGATTGATGTC;

[0114] YZ-MAE-F: TTGAAACAGAGGTATCATGAGTTGC;

[0115] YZ-MAE-R: TACTAGGAGGATCCGATTCACCACC.

[0116] Example 4: Fed-batch fermentation of recombinant strain K. marxianus SA1 in a fermenter

[0117] The seed culture medium was YPD medium containing 20 g / L tryptone, 10 g / L yeast extract, and 40 g / L glucose.

[0118] The succinic acid-producing K. marxianus SA1 constructed in Example 3 was subjected to fed-batch fermentation in a 5 L fermenter, and the specific steps were as follows:

[0119] Primary seed culture: Pipette 10 μL of bacterial solution from the glycerol tube, streak it on a YPD plate, and culture it at 37°C for 24 hours. Pick a single clone and inoculate it into a 250 mL shake flask containing 50 mL of seed culture medium, and culture it at 200 rpm and 37°C for 10 to 16 hours to obtain the OD 600 The first-grade seed solution is between 6.0 and 10.0;

[0120] Secondary seed culture: Inoculate the primary seed solution into a 500 mL Erlenmeyer flask containing 100 mL of seed culture medium at a 2% inoculation rate, and culture at 200 rpm and 37°C for 8 to 10 hours to obtain an OD 600 Secondary seed solution between 8.0 and 12.0;

[0121] Batch fed fermentation in a 5L fermenter: The initial liquid volume of the fermenter is 2.7L. The secondary seed liquid is inoculated into the fermentation medium at an inoculation rate of 10% (volume fraction) of the total volume. The temperature is 37°C, the initial ventilation volume is 1vvm, and the rotation speed is 300rpm. After the fermentation pH drops below 3.0, CaCO3 is added and the pH is controlled (3.5±0.5). When performing slightly soluble oxygen fermentation, the ventilation volume is reduced to 0.5vvm and the rotation speed is reduced to 100-200rpm. Samples are taken every 8 hours to detect the glucose concentration in the fermenter. When the glucose concentration is lower than 10g / L, glucose is added until the glucose concentration in the fermentation liquid is 40g / L. At the same time, the organic acids and bacterial biomass of the samples are tested. Figure 6 As shown, at 96h of fermentation, the OD 600 The highest value was 18.1, and the yield and conversion rate of succinic acid were 42.9 g / L and 0.37 g / g glucose, respectively.

[0122] Comparative Example 1:

[0123] The specific implementation method is the same as Example 3, except that the PYC gene is replaced by the AfPYC gene derived from Aspergillus flavus, and the nucleotide sequence of AfPYC is shown in SEQ ID NO.9.

[0124] Comparative Example 2:

[0125] The specific implementation method is the same as Example 3, except that the PYC gene is replaced by the ScPYC gene from Saccharomyces cerevisiae, and the nucleotide sequence of ScPYC is shown in SEQ ID NO.10.

[0126] Comparative Example 3:

[0127] Specific implementation method is the same as Example 3, except that the PYC gene is replaced by the KmPYC gene from Kluyveromyces marxianus, and the nucleotide sequence of KmPYC is shown in SEQ ID NO.11.

[0128] Comparative Example 4:

[0129] The specific implementation method is the same as Example 3, except that the MDH gene is replaced by the AsMDH gene derived from Actinobacillus succinogenes, and the nucleotide sequence of AsMDH is shown in SEQ ID NO.12.

[0130] Comparative Example 5:

[0131] The specific implementation method is the same as Example 3, except that the MDH gene is replaced by the RoMDH gene derived from Rhizopus oryzae, and the nucleotide sequence of RoMDH is shown in SEQ ID NO.13.

[0132] Comparative Example 6:

[0133] The specific implementation method is the same as Example 3, except that the MDH gene is replaced by the IoMDH gene from I. orientalis. The nucleotide sequence of IoMDH is shown in SEQ ID NO.14.

[0134] Comparative Example 7:

[0135] The specific implementation method is the same as Example 3, except that the FUM gene is replaced by the CgFUM gene derived from Corynebacterium glutamicum, and the nucleotide sequence of CgFUM is shown in SEQ ID NO.15.

[0136] Comparative Example 8:

[0137] The specific implementation method is the same as Example 3, except that the FUM gene is replaced by the RoFUM gene derived from Rhizopus oryzae, and the nucleotide sequence of RoFUM is shown in SEQ ID NO.16.

[0138] Comparative Example 9:

[0139] The specific implementation method is the same as Example 3, except that the FUM gene is replaced with the TtFUM gene from Thermus thermophilus, and the nucleotide sequence of TtFUM is shown in SEQ ID NO.17.

[0140] The recombinant bacteria constructed in Comparative Examples 1 to 9 were fermented according to the method of Example 4, and the succinic acid production after 96 hours of fermentation was measured. Figure 7 As shown, the recombinant strain K. marxianus SA1 constructed in Example 3, whose pathway gene sources are RoPYC, KmMDH and EcFUM, produces succinic acid at a yield of 42.9 g / L, which is better than the combination of other pathway gene sources.

[0141] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A genetically engineered bacterium producing succinic acid, characterized in that: Based on the starting strain, the pyruvate decarboxylase gene PDC1 located on the genome was knocked out, and pyruvate carboxylase, malate dehydrogenase, fumarase and fumarate reductase were overexpressed, and the dicarboxylate transporter was overexpressed.

2. The genetically engineered bacterium according to claim 1, characterized in that: The starting strain is Kluyveromyces marxianus NBRC 1777.

3. The genetically engineered bacterium according to claim 1 or 2, characterized in that: The nucleotide sequence of the pyruvate decarboxylase gene PDC1 is shown in GenBank: L09727.

1.

4. The genetically engineered bacterium according to any one of claims 1 to 3, characterized in that: The pyruvate carboxylase is RoPYC derived from Rhizopus oryzae, and the nucleotide sequence of RoPYC is shown in SEQ ID NO.1; the malate dehydrogenase is KmMDH derived from Kluyveromyces marxianus, and the nucleotide sequence of KmMDH is shown in SEQ ID NO.2; the fumarase is EcFUM derived from Escherichia coli, and the nucleotide sequence of EcFUM is shown in SEQ ID NO.3; the fumarate reductase is TbFRD derived from Trypanosoma brucei, and the nucleotide sequence of TbFRD is shown in SEQ ID NO.4; the dicarboxylate transporter is SpMAE derived from Schizosaccharomyces pombe, and the nucleotide sequence of SpMAE is shown in SEQ ID NO.

5.

5. A method for improving the succinic acid production capacity of Kluyveromyces marxianus, characterized in that: Based on the starting strain, the pyruvate decarboxylase gene PDC1 located on the genome was knocked out, and pyruvate carboxylase, malate dehydrogenase, fumarase and fumarate reductase were overexpressed, and the dicarboxylate transporter was overexpressed.

6. The method according to claim 5, characterized in that The pyruvate carboxylase RoPYC and fumarate reductase TbFRD are integrated into the genome of the starting strain via a linearized plasmid; the malate dehydrogenase KmMDH, fumarase EcFUM and dicarboxylic acid transporter SpMAE are integrated into the genome of the starting strain via a linearized plasmid.

7. The method according to claim 5 or 6, characterized in that: The starting strain is Kluyveromyces marxianus NBRC 1777.

8. A method for producing succinic acid by fermentation, characterized in that: The genetically engineered bacteria according to any one of claims 1 to 4 are cultured and fermented using glucose as a carbon source and yeast powder and ammonium sulfate as nitrogen sources.

9. The method according to claim 8, characterized in that The initial glucose concentration was controlled at 70 g / L. When the glucose concentration was lower than 10 g / L, glucose was added to control the glucose concentration at 10 g / L to 40 g / L.

10. Use of the genetically engineered bacteria according to any one of claims 1 to 4, or the method according to any one of claims 5 to 9 in the fields of chemical industry, degradable materials and food.

Images