Bienzyme co-expression recombinant vector for synthesizing L-glufosinate-ammonium as well as construction method and application of bienzyme co-expression recombinant vector

Abstract

The invention provides a double-enzyme co-expression recombinant vector for synthesizing L-glufosinate-ammonium as well as a construction method and application of the double-enzyme co-expression recombinant vector. The recombinant vector simultaneously carries glutamate dehydrogenase and NADP (Nicotinamide Adenine Dinucleotide Phosphate) isopropanol dehydrogenase; the amino acid sequence of the glutamate dehydrogenase mutant is obtained by mutating a sequence numbered as WP171284991.1 in an NCBI (National Center of Biotechnology Information) gene sequence library, and the activity of glutamate dehydrogenase is not changed; the NADP isopropyl alcohol dehydrogenase is obtained by performing codon optimization on an amino acid sequence numbered as WP088028380.1 in an NCBI (National Center of Biotechnology Information) gene sequence library; the strain can be efficiently fermented, glutamate dehydrogenase and NADP isopropanol dehydrogenase which are equivalent in expression quantity and activity can be simultaneously obtained from fermentation liquor cultured once, the strain can be used for reaction for synthesizing L-glufosinate-ammonium by taking PPO as a substrate and cyclic regeneration of NADPH in the reaction process, and the fermentation frequency is reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of bioenzyme engineering, and in particular to a dual-enzyme co-expression recombinant vector for synthesizing L-glufosinate ammonium, and a construction method and application thereof. Background Art

[0002] Glufosinate (2-amino-4-hydroxymethylphosphinylbutanoic acid, Phosphinothricin), chemical name 2-amino-4-[hydroxy(methyl)phosphinyl]butyric acid ammonium, also known as glufosinate, is a highly effective, broad-spectrum, non-conductive contact-killing organophosphorus herbicide. The herbicidal mechanism of glufosinate is to inhibit the activity of glutamine synthetase and then inhibit photosynthesis, and further cause ammonia accumulation in the plant, leading to plant poisoning and death; at the same time, when the plant absorbs glufosinate, the synthesis of amino acids with glutamate as a precursor in the plant is blocked, blocking the amino acid metabolism in the plant.

[0003] The currently available glufosinate is usually a racemic mixture of L-type and D-type glufosinate, of which only L-glufosinate has herbicidal activity. The stems and leaves of plants can quickly absorb L-glufosinate, which is conducted in the plant body through transpiration to exert its herbicidal activity, while L-glufosinate will be degraded by microorganisms and quickly inactivated after entering the soil; D-glufosinate is non-toxic to plants, but the use of D-glufosinate will increase farmers' production costs and environmental pressure. If the pure optical isomer of L-glufosinate is used, the use of glufosinate can be reduced by 50%, which is of great significance for promoting green development of agriculture and rural areas and building a beautiful China. Glufosinate is one of the world's three major herbicides, and in recent years, the proportion of glufosinate in the global pesticide market has increased year by year. Therefore, achieving environmentally friendly industrial production of L-glufosinate has become the goal of today's pesticide production.

[0004] There are two methods for generating optically pure L-glufosinate: chemical synthesis and biocatalysis. The chiral auxiliary reagent induction method in the chemical synthesis method requires a low temperature reaction at -78°C, with harsh process conditions, expensive reagents, and low yield, which is not conducive to industrial production. The natural amino acid chiral source method not only requires expensive reagents, but also uses highly toxic reagents, which is prone to safety accidents and is not suitable for industrial production. The Strecker reaction and asymmetric Michael addition method in the asymmetric synthesis method have complex synthesis routes, require a large amount of catalysts, and the by-products easily lead to complex separation and purification processes, which greatly increases the production cost, and the yield is low, which is not conducive to industrial production. The racemic separation method is prone to waste of raw materials and increases production costs. At the same time, a large amount of "three wastes" are easily generated during the chemical synthesis process. The cost of treating industrial three wastes not only increases production costs, but also increases environmental pressure.

[0005] Biocatalysis has the advantages of mild reaction conditions, low cost, and environmental friendliness, and has gradually become a research hotspot for the synthesis of L-phosphinothricin in recent years. Traditional biocatalysis includes: (1) catalytic hydrolysis of L-phosphinothricin precursor to synthesize L-phosphinothricin. In this method, L-phosphinothricin precursor is expensive and difficult to obtain; (2) enzymatic resolution of racemic mixture D / L-phosphinothricin precursor to synthesize L-phosphinothricin, but the theoretical yield of this method is only 50%, which will cause waste of raw materials. In recent years, a method for synthesizing L-phosphinothricin by deracemization using glufosinate dehydrogenase and ω-transaminase has been discovered. Specifically, D-phosphinothricin is converted into PPO by D-amino acid oxidase or ω-transaminase, and PPO is then catalyzed by glufosinate dehydrogenase mutant or glutamate dehydrogenase to synthesize L-phosphinothricin, and alcohol dehydrogenase is combined for coenzyme regeneration. However, these two enzymatic methods have limitations such as low enzyme utilization efficiency and low L-phosphinothricin yield in industrial large-scale production. Summary of the invention

[0006] In view of this, the present invention provides a dual-enzyme co-expression recombinant vector for synthesizing L-phosphinothricin ammonium, a construction method and application thereof, wherein the recombinant vector carries gene fragments of glutamate dehydrogenase and NADP isopropanol dehydrogenase at the same time. The strain containing the recombinant vector can be fermented efficiently, and the fermentation liquid cultured once can simultaneously obtain glutamate dehydrogenase and NADP isopropanol dehydrogenase with equivalent expression amount and activity, which can be used for the reaction of synthesizing L-phosphinothricin ammonium with PPO as a substrate and the cyclic regeneration of NADPH in the reaction process, thereby reducing the number of fermentations.

[0007] The technical solution of the present invention is as follows: A glutamate dehydrogenase mutant, wherein the glutamate dehydrogenase is derived from Acinetobacter tandoii; the glutamate dehydrogenase mutant is obtained by mutation of a sequence numbered WP_171284991.1 in the NCBI gene sequence library, wherein the mutation site is one or more of I58A, A150G, G251Q, and V352A.

[0008] Preferably, the mutation sites include the following: I58A, A150G, G251Q, V352A, I58A / A150G, I58A / G251Q, I58A / V352A, A150G / G251Q, A150G / V352A, I58A / A150G / G251Q, I58A / A150G / V352A, A150G / G251Q / V352A, I58A / A150G / G251Q / V352A.

[0009] Preferably, the glutamate dehydrogenase mutant is obtained by replacing isoleucine with alanine at position 58, replacing glycine with alanine at position 150, replacing glycine with glutamine at position 251, and replacing valine with alanine at position 352 from the amino acid sequence numbered WP_171284991.1 in the NCBI gene sequence library. The base sequence of the glutamate dehydrogenase mutant is shown in SEQ ID NO.1, and the amino acid sequence is SEQ ID NO.2.

[0010] A gene fragment for co-expressing glutamate dehydrogenase and NADP isopropanol dehydrogenase, comprising a glutamate dehydrogenase mutant gene sequence and a NADP isopropanol dehydrogenase gene sequence; Wherein, the base sequence of the glutamate dehydrogenase mutant is shown in SEQ ID NO.1; NADP isopropanol dehydrogenase is derived from Stenotrophomonas maltophilia, and is obtained by codon optimization of the amino acid sequence of WP_088028380.1 in the NCBI gene sequence library, and its base sequence is shown in SEQ ID NO.3, and its amino acid sequence is shown in SEQ ID NO.4; The base sequence shown in SEQ ID NO.1 and the base sequence shown in SEQ ID NO.3 were connected by one RBS sequence to obtain a gene fragment co-expressing glutamate dehydrogenase and NADP isopropanol dehydrogenase, and the base sequence of the gene fragment is shown in SEQ ID NO.5.

[0011] A recombinant vector containing the gene fragment shown in SEQ ID NO.5, the base sequence of the recombinant vector is shown in SEQ ID NO.6.

[0012] The above-mentioned recombinant vector is constructed by: The base sequence shown in SEQ ID NO.1 was ligated between the restriction sites BamHI and XhoⅠ of the vector pet-28a(+); The base sequence shown in SEQ ID NO.3 was digested and connected between the restriction sites NdeⅠ and HindⅢ of the vector pet-28a(+); The N-termini of the base sequence shown in SEQ ID NO.1 and the base sequence shown in SEQ ID NO.3 carry His tags at the same time, which can be used for protein purification.

[0013] An application of a double enzyme co-expression strain containing the above gene fragments, the process is: (1) transferring the recombinant vector into a host cell to obtain a dual-enzyme co-expression strain for synthesizing L-phosphinothricin; (2) The strain of the dual enzyme co-expression was inoculated into LB liquid medium containing 100 mg / L kanamycin at an inoculation ratio of 1:100, and cultured at 37°C and 200 rpm for 4-6 h until the OD 600 =2.0, get seed solution; (3) Transfer the seed liquid to a 5L fermenter at a ratio of 1:100 for high-density fermentation and culture until OD 600 =25-30, add IPTG to a final concentration of 0.1mmol / L, induce expression at 25℃ for 16h, centrifuge at 4℃, 10000rpm for 15min, discard the supernatant and harvest the wet cells; (4) The wet cells are crushed and centrifuged to obtain a crude enzyme solution containing glutamate dehydrogenase and NADP isopropanol dehydrogenase, which can be directly used for PPO conversion to produce L-phosphinothricin.

[0014] Preferably, the host cell is Escherichia coli E. coli BL 21(DE3).

[0015] Preferably, during the application process, when the crude enzyme solution catalyzes PPO as a substrate to generate L-phosphinothricin, the PPO substrate concentration is ≤50 g / L, the catalytic temperature is 35° C., and the catalytic reaction is completed within 3 hours.

[0016] An enzyme-loaded resin is obtained after the crude enzyme solution is purified by protein, and the enzyme-loaded resin can be reused.

[0017] Compared with the prior art, the beneficial effects of the present invention are: 1. Compared with the existing strains expressing NADP isopropanol dehydrogenase and glutamate dehydrogenase separately, the present invention provides a strain capable of co-expressing NADP isopropanol dehydrogenase and glutamate dehydrogenase, so that NADP isopropanol dehydrogenase and glutamate dehydrogenase with substantially the same protein expression levels can be obtained simultaneously by fermenting the strain once. In the process of catalyzing PPO to produce L-glufosinate ammonium, there is no need to add alcohol dehydrogenase for the recycling of coenzyme NADPH, which effectively reduces the amount of enzyme used, reduces the process flow in industrial large-scale production, and reduces the production cost.

[0018] 2. The present invention provides the base sequence and amino acid sequence of a glutamate dehydrogenase mutant. The expressed enzyme can efficiently catalyze PPO to generate L-phosphinothricin ammonium. At a concentration of 100 g / L, the substrate conversion rate can reach 95% within a catalytic time of 3 h.

[0019] 3. After the codon optimization of NADP isopropanol dehydrogenase, the present invention can simultaneously perform protein purification with the glutamate dehydrogenase mutant. The enzyme loading amounts of NADP isopropanol dehydrogenase and glutamate dehydrogenase in the purified enzyme-loading resin are substantially the same and can be reused to meet the requirements of high-concentration PPO catalytic synthesis of L-phosphinothricin, reduce the number of enzyme fermentation times, and significantly reduce production costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a schematic diagram of the construction of the recombinant vector in Example 1.

[0021] Figure 2 This is the gel electrophoresis diagram of the crude enzyme solution prepared in Example 3.

[0022] Figure 3 This is the gel electrophoresis diagram of the immobilized enzyme in Example 4.

[0023] Figure 4 It is a bar graph of the L-glufosinate content in Example 6. DETAILED DESCRIPTION

[0024] In order to enable those skilled in the art to better understand the technical solutions of the present invention, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0025] Example 1 Preparation of a recombinant engineered strain for the synthesis of L-phosphinothricin-ammonium dual enzyme co-expression strain (1) Co-expressed gene fragments Glutamate dehydrogenase mutant The amino acid sequence numbered WP_171284991.1 in the NCBI gene sequence library was replaced by alanine at position 58 for isoleucine, alanine at position 150 for glycine, glutamine at position 251 for glycine, and alanine at position 352 for valine to obtain the amino acid sequence of the glutamate dehydrogenase mutant SEQ ID NO.2; the base sequence of the glutamate dehydrogenase mutant is shown in SEQ ID NO.1; the glutamate dehydrogenase is derived from Acinetobacter tandoii; NADP isopropanol dehydrogenase obtained after codon optimization The amino acid sequence of WP_088028380.1 in the NCBI gene sequence library was codon optimized to obtain a base sequence of NADP isopropanol dehydrogenase as shown in SEQ ID NO.3 and an amino acid sequence as shown in SEQ ID NO.4; the NADP isopropanol dehydrogenase is derived from Stenotrophomonas maltophilia; There is a T7 promoter in front of each of the glutamate dehydrogenase mutant gene fragment and the NADP isopropanol dehydrogenase gene fragment. The glutamate dehydrogenase mutant gene fragment and the codon-optimized NADP isopropanol dehydrogenase gene fragment are delivered to a gene synthesis company for gene synthesis. The base sequence shown in SEQ ID NO.1 and the base sequence shown in SEQ ID NO.3 are connected with an RBS sequence to obtain a co-expressed gene fragment. The base sequence of the co-expressed gene fragment is shown in SEQ ID NO.5. (2) Select the expression vector pet-28a(+), and ligate the base sequence shown in SEQ ID NO.1 between the restriction sites BamHI and XhoⅠ of the vector pet-28a(+); The base sequence shown in SEQ ID NO.3 was digested and connected between the restriction sites NdeⅠ and HindⅢ of the vector pet-28a(+); After sequencing confirmed that the two vectors were constructed, the part between the T7 promoter and XhoⅠ in the glutamate dehydrogenase vector was constructed between the NotⅠ and XhoⅠ restriction sites of the NADP isopropanol dehydrogenase vector. Figure 1 , and obtain the recombinant vector SmKRED-AtGluDH-pET28a, the base sequence of which is shown in SEQ ID NO.6; wherein, the RBS and T7 promoter are both sequences on the pET28a vector; The N-termini of the base sequence shown in SEQ ID NO.1 and the base sequence shown in SEQ ID NO.3 carry a His tag at the same time, which can be used for protein purification; (3) Transform the recombinant vector SmKRED-AtGluDH-pET28a into competent Escherichia coli by heat shock E. coli BL 21(DE3), spread on 100 mg / L kanamycin-resistant LB plates, culture at 37°C overnight, select single colonies for culture, add IPTG to a final concentration of 0.1 mmol / L to induce expression, and analyze the expressed protein by SDS-PAGE. The single clone with high soluble expression level was preserved to obtain a dual-enzyme co-expression strain.

[0026] Example 2 Preparation of wet bacterial cells of a dual enzyme co-expression strain for synthesizing L-phosphinothricin High-density fermentation medium formula: 12.5g / L disodium hydrogen phosphate dodecahydrate, 2.3g / L potassium dihydrogen phosphate, 5g / L glycerol, 5g / L yeast powder, 5g / L peptone, 0.7g / L anhydrous sodium sulfate, pH 7.0-7.2.

[0027] S1, the strain of the dual enzyme co-expression strain preserved in Example 1 was inoculated into LB liquid culture medium containing 100 mg / L kanamycin at an inoculation ratio of 1:100, and cultured at 37°C and 200 rpm for 5 h. OD 600 =2.0, get seed solution; S2, the seed solution was transferred to a 5L fermenter at a ratio of 1:100 for high-density fermentation at 37°C and 200rpm. 600 =25, add IPTG to a final concentration of 0.1mmol / L, induce expression at 25℃ for 16h, then centrifuge at 4℃, 10000rpm for 15min, discard the supernatant and harvest the wet cells.

[0028] Example 3 Preparation of crude enzyme solutions of NADP isopropanol dehydrogenase and glutamate dehydrogenase Weigh 100 g of the wet cells collected in Example 2, add 400 mL of 7.16 g / L sodium hydrogen phosphate dodecahydrate and 2.72 g / L potassium dihydrogen phosphate buffer at pH 7.4, resuspend the wet cells collected in Example 2 into a 200 g / L suspension, and use a high-pressure homogenizer to break it twice, the power of the high-pressure homogenizer is 900 bar; centrifuge the cell lysate at 4 ° C and 10000 rpm for 15 min to obtain a supernatant, which is a crude enzyme solution containing NADP isopropanol dehydrogenase and glutamate dehydrogenase; perform gel electrophoresis on the obtained crude enzyme solution, and the results are shown in FIG. Figure 2 ; Figure 2 In the figure, lane M is a protein marker, lane 1 is glutamate dehydrogenase and NADP isopropanol dehydrogenase in the whole strain (before centrifugation), and lane 2 is glutamate dehydrogenase and NADP isopropanol dehydrogenase in the supernatant (crude enzyme solution).

[0029] Example 4 Preparation of immobilized enzymes of NADP isopropanol dehydrogenase and glutamate dehydrogenase Weigh 100g of the pretreated nickel-loaded resin, add 750mL of a crude enzyme solution with a concentration of 200g / L (i.e., the weight of the wet bacteria in each liter of the crude enzyme solution is 200g), mix well, and shake at 150rpm for 4h in a constant temperature shaker at 25℃. After the shaking is completed, filter the resin and wash it 5 times with a 20mmol / L PB phosphate buffer solution with a pH of 7.4, and then store it with the buffer solution at 4℃ to obtain immobilized enzymes of NADP isopropanol dehydrogenase and glutamate dehydrogenase, which can be reused. The obtained immobilized enzymes were subjected to gel electrophoresis, and the results are shown in Figure 3 ; Figure 3 In the figure, M is a protein marker, and lane 1 is the purified glutamate dehydrogenase and NADP isopropanol dehydrogenase on the immobilized enzyme.

[0030] Example 5 Application of NADP isopropanol dehydrogenase and glutamate dehydrogenase in the synthesis of L-phosphinothricin Dissolve L / D glufosinate in 20mmol / L phosphate buffer at pH 7.5 at a concentration of 100g / L and adjust the volume to 3L. Use D-amino acid oxidase to completely convert 50% of the substrate D-glufosinate into PPO. The conversion conditions are 37℃ and pH 7.8. After 24h of reaction, the residual amount of D-glufosinate was 2.5% as determined by HPLC. To the 3L reaction solution of D-phosphinothricin converted to PPO, 0.75g NAD (0.25g / L), 66mL isopropanol (0.288mol / L), and 50.4g ammonium chloride (0.314mol / L) were added respectively. After the raw materials were dissolved and mixed evenly, the crude enzyme solution prepared in Example 3 was added to a final wet bacterial concentration of 100g / L, and then catalyzed at 35°C for 3h. HPLC monitored that the substrate PPO was completely converted to L-phosphinothricin.

[0031] Example 6 Application of dual enzyme immobilized enzymes of NADP isopropanol dehydrogenase and glutamate dehydrogenase in the synthesis of L-phosphinothricin ammonium Take 3L of the PPO reaction solution with a residual amount of 2.5% of D-glufosinate obtained in Example 5, add 0.75g NAD (final concentration 0.25g / L), 66mL isopropanol (final concentration 0.288mol / L), and 50.4g ammonium chloride (final concentration 0.314mol / L), wherein the mass ratio of D-glufosinate to NAD is 200:1, the molar ratio of D-glufosinate to isopropanol is 1:1, and the molar ratio of D-glufosinate to ammonium chloride is 1:1.2; dissolve and mix, then add 300g of the immobilized enzyme obtained in Example 4 to a final concentration of 100g / L, and then catalyze at 35°C for 3h, and detect the content of L-glufosinate by HPLC; in the reaction solution, the content of L-glufosinate changes as shown in FIG. Figure 4 ; Combine Figure 4 It can be seen that the content of L-glufosinate detected after 3 hours of reaction is 95.4 g / L. It can be seen that the dual enzyme solution of the present invention, with an amount of 100 g / L of immobilized enzyme, can directly catalyze the conversion of PPO into L-glufosinate, and the yield of L-glufosinate reaches 95.4%. After 3 hours of reaction, 50 g / L of substrate PPO can be converted into L-glufosinate.

[0032] In the present invention, the HPLC detection conditions are as follows: the chromatographic column is Thermo C18 (hypersil GOLD 4.6×250mm), the mobile phase A is 50mmol / L ammonium acetate solution (containing 0.1% triethylamine, pH5.5), the mobile phase B is methanol, the flow rate is 1mL / min, the ultraviolet detection wavelength is 338nm, the injection volume is 10L, the column temperature is 30°C, the retention time of L-glufosinate is 5.7min, and the retention time of D-glufosinate is 6.1min.

[0033] Although the present invention has been described in detail by reference to the preferred embodiments, the present invention is not limited thereto. Without departing from the spirit and essence of the present invention, a person of ordinary skill in the art may make various equivalent modifications or substitutions to the embodiments of the present invention, and these modifications or substitutions shall be within the scope of the present invention. Any person of ordinary skill in the art may easily think of changes or substitutions within the technical scope disclosed by the present invention, and these shall be within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be subject to the scope of protection of the claims.

[0034] SEQ ID NO.1 SEQ ID NO.2 MGSSHHHHHHSSGLVPRGSHMASMTGGQQMGRGSMSLSYEMENSGAWQTYLAQINRVAPYLEEDLIPFINTLKRPKRALIVDVPIVMDDGSIQHFEGYRVQHNLSRGPGKGGIRYHPDVELNEVMALSAWMTIKTAVLNLPYGGAKGGIRVDPRKLSPRELERLTRRFTTEISPIIGPQIDIPGPDVGTNADIMGWMMDTYSTIKGHTVTGVVTGKPVHLGGSLGRVRATGRGVFVTGLEVAKKINLALEGSRIAVQGFGNVGSEAAYLFHKANAKVVCVQDHTGTIFNADGFDVKQLQDYVAIHKGVAGFPNATVIEDEAFWTVEMDILIPAALEGQITAERAQKLTAKLVLEGANGPTYPEAEDILLQRQIMIVPDVLCNAGGATVSYFEWVQDMASYFWTEEEINERLDKLMIKAVEDVWHTADDKDCSLRTAAYILACERILKARKERGIFPG* SEQ ID NO.3 ATGATTGATTACCAGTTGACCGGCAAAACCGCGATCGTGACCGGCGGCGTGTCGGGCATCGGCCTGGCCGTGGCGCAGACGCTGGCCGCGTCCGGTGCCCGTATTTCGGTCTGGGACCTGAAACAGGATGCAGTCGATGCCACCGTGGCGCAGCTGCGCAGTGCCGGTACACAGGCCATCGGCATCGCGCTGGACGTCACCGACGACGCGGCGGTAGAGGCAGCAGTGCAGCGCACGATCAAGGAACTCAACGGCCTGCATGTGGCGGTCAACAATGCGGGCATCAGTGGGCCGGCCGCCAGCAGTGGTGATTATCCGATCGATGGCTGGCAGCGGGTAATCGACGTCAACCTCACCAGCGTGTTCCTGTGCCAGCGTGCGCAGATCCAGGCGATGCGCGCGGCCGGAACCGGCGGCAGCATCATCAACATGGCCTCGATCCTGGGCCAGGTGGGCTATGCCGGTTCCACTGCGTACGTGGCGGCCAAGCACGGCGTGGTCGGGCTGACCCAGACTGCCGCCTGGGAGCATGCGGGCGACGGTATCCGTGTCAACGCGGTCGGCCCGGGCTTCATCAGCACACCGCTGCTGGAGAAGATGGACCCGAAGGTGCGTGCCACGCTGGAAGGACGGCACGCACTGAAGCGGCTGGGCACGGCCGAGGAAGTAGCGGCACTGGTGGCCTGGTTGGCCAGCGACGACGCCTCGTTCGCGACCGGTACCTATTACGCCATTGATGGTGGCTACCTGGCGCAGTGA SEQ ID NO.4 MGSSHHHHHHSSGLVPRGSHMIDYQLTGKTAIVTGGVSGIGLAVAQTLAASGARISVWDLKQDAVDATVAQLRSAGTQAIGIALDVTDDAAVEAAVQRTIKELNGLHVAVNNAGISGPAASSGDYPIDGWQRVIDVNLTSVFLCQRAQIQAMRAAGTGGSIINMASILGQVGYAGSTAYVAAKHGVVGLTQTAAWEHAGDGIRVNAVGPGFISTPLLEKMDPKVRATLEGRHALKRLGTAEEVAALVAWLASDDASFATGTYYAIDGGYLAQ* SEQ ID NO.5 SEQ ID NO.6

Claims

1. A glutamate dehydrogenase mutant, characterized in that: The glutamate dehydrogenase is derived from Acinetobacter tandoii; the glutamate dehydrogenase mutant is obtained by mutation of a sequence numbered WP_171284991.1 in the NCBI gene sequence library, and the mutation site is one or more of I58A, A150G, G251Q, and V352A.

2. The glutamate dehydrogenase mutant according to claim 1, characterized in that The mutation sites include the following: I58A, A150G, G251Q, V352A, I58A / A150G, I58A / G251Q, I58A / V352A, A150G / G251Q, A150G / V352A, I58A / A150G / G251Q, I58A / A150G / V352A, A150G / G251Q / V352A, I58A / A150G / G251Q / V352A.

3. The glutamate dehydrogenase mutant according to claim 2, characterized in that The glutamate dehydrogenase mutant is obtained by replacing isoleucine with alanine at position 58, replacing glycine with alanine at position 150, replacing glycine with glutamine at position 251, and replacing valine with alanine at position 352 from the amino acid sequence numbered WP_171284991.1 in the NCBI gene sequence library. The base sequence of the glutamate dehydrogenase mutant is shown in SEQ ID NO.1, and the amino acid sequence is SEQ ID NO.

2.

4. A gene fragment co-expressing glutamate dehydrogenase and NADP isopropanol dehydrogenase, characterized in that: Comprising the glutamate dehydrogenase mutant gene sequence and the NADP isopropanol dehydrogenase gene sequence according to claim 3; Wherein, the base sequence of the glutamate dehydrogenase mutant is shown in SEQ ID NO.1; NADP isopropanol dehydrogenase is derived from Stenotrophomonas maltophilia, and is obtained by codon optimization of the amino acid sequence of WP_088028380.1 in the NCBI gene sequence library, and its base sequence is shown in SEQ ID NO.3, and its amino acid sequence is shown in SEQ ID NO.4; The base sequence shown in SEQ ID NO.1 and the base sequence shown in SEQ ID NO.3 were connected by one RBS sequence to obtain a gene fragment co-expressing glutamate dehydrogenase and NADP isopropanol dehydrogenase, and the base sequence of the gene fragment is shown in SEQ ID NO.

5.

5. A recombinant vector containing the gene fragment shown in SEQ ID NO.5, characterized in that: The base sequence of the recombinant vector is shown in SEQ ID NO.

6.

6. The recombinant vector according to claim 5, characterized in that The construction method is: The base sequence shown in SEQ ID NO.1 was ligated between the restriction sites BamHI and XhoⅠ of the vector pet-28a(+); The base sequence shown in SEQ ID NO.3 was digested and connected between the restriction sites NdeⅠ and HindⅢ of the vector pet-28a(+); The N-termini of the base sequence shown in SEQ ID NO.1 and the base sequence shown in SEQ ID NO.3 carry His tags at the same time, which can be used for protein purification.

7. Use of a dual enzyme co-expression strain containing the recombinant vector according to claim 5, characterized in that: The process is: (1) transferring the recombinant vector into a host cell to obtain a dual-enzyme co-expression strain for synthesizing L-phosphinothricin; (2) The strain of the dual enzyme co-expression was inoculated into LB liquid medium containing 100 mg / L kanamycin at an inoculation ratio of 1:100, and cultured at 37°C and 200 rpm for 4-6 h until the OD 600 =2.0, get seed solution; (3) Transfer the seed liquid to a 5L fermenter at a ratio of 1:100 for high-density fermentation and culture until OD 600 =25-30, add IPTG to a final concentration of 0.1mmol / L, induce expression at 25℃ for 16h, centrifuge at 4℃, 10000rpm for 15min, discard the supernatant and harvest the wet cells; (4) The wet cells are crushed and centrifuged to obtain a crude enzyme solution containing glutamate dehydrogenase and NADP isopropanol dehydrogenase, which can be directly used for PPO conversion to produce L-phosphinothricin.

8. The use of the double enzyme co-expression strain as claimed in claim 7, characterized in that: The host cell is Escherichia coli E. coli BL 21(DE3).

9. The use of the dual enzyme co-expression strain according to claim 7, characterized in that: When the crude enzyme solution catalyzes the generation of L-glufosinate with PPO as substrate, the PPO substrate concentration is ≤50g / L, the catalytic temperature is 35°C, and the catalytic reaction is completed within 3h.

10. An enzyme-loaded resin, characterized in that: The crude enzyme solution in claim 7 is obtained by protein purification.

Images