Heat-resistant glucose dehydrogenase mutant and preparation method thereof

Abstract

The invention discloses a heat-resistant glucose dehydrogenase mutant and a preparation method thereof, and the heat-resistant glucose dehydrogenase mutant specifically comprises five glucose dehydrogenase mutants, namely E96I, I183V, D255M, E96I / I183V and E96I / D255M. Results of enzyme activity determination show that the glucose dehydrogenase mutant provided by the invention has good heat resistance, and after high-temperature treatment, the glucose dehydrogenase mutant still has higher enzyme activity compared with an original enzyme; the glucose dehydrogenase mutant provided by the invention is suitable for establishing NADH and NADPH regeneration systems under a high-temperature condition, and provides an efficient and low-cost new choice for industrial biological catalysis and pharmaceutical application.

Description

Technical Field

[0001] The invention relates to a glucose dehydrogenase mutant, in particular to a heat-resistant glucose dehydrogenase mutant and a preparation method thereof, and belongs to the field of protein engineering. Background Art

[0002] Glucose dehydrogenase (GDH) is an important oxidoreductase found in Gram-positive and Gram-negative bacteria, including Bacillus amyloides, Bacillus subtilis, and Bacillus sphaeroides, as well as in plants and mammalian cells. GDH is a tetrameric protein composed of four identical subunits, and its overall folding and oligomeric structure are similar to its homologous subunits. GDH participates in the key steps of glucose metabolism and can catalyze the oxidation of D-glucose to produce D-glucono-1,5-lactone and the reduction of the cofactor NAD(P)+ to NAD(P)H. Therefore, it is also used in food processing, synthesis of pharmaceutical intermediates, biosynthesis of natural products and other fields. Due to its dual cofactor specificity, high activity, easy preparation and inexpensive substrates, GDH as a biocatalytic coenzyme has been widely used in the industrial field, especially in the synthesis of biopharmaceuticals and fine chemicals. Since many enzymatic reactions rely on cofactors, the high cost of cofactors will limit the industrial application of biocatalysis. GDH has good activity towards NAD+ and NADP+ and can be used to establish a regeneration system for NADH and NADPH to solve the problems of difficult cofactor circulation and high manufacturing costs in biocatalysis.

[0003] The environment of industrial manufacturing is complex and diverse, and some processes need to be carried out at high temperatures. However, high temperatures can greatly reduce enzyme activity, which in turn leads to low production efficiency and high manufacturing costs. Although GDH from various microorganisms has been used as a coenzyme regenerator in industrial biocatalysis, thermostable GDH that can adapt to high temperatures remains a goal in the field of enzyme engineering. Heat-resistant GDH has a wider range of applications and can optimize biomanufacturing processes. It is of great significance for establishing efficient and low-cost cofactor regeneration systems and is a more competitive solution for manufacturing products such as pharmaceutical intermediates and chiral chemicals. Summary of the invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a glucose dehydrogenase mutant that is tolerant to high temperatures, and to provide a nucleic acid molecule encoding the mutant, a vector or recombinant cell or product containing the mutant, and a preparation method and application of the mutant.

[0005] Technical solution: In the first aspect, the present invention provides 5 glucose dehydrogenase mutants, the amino acid sequence of the glucose dehydrogenase mutant is obtained by mutation of the sequence shown in SEQ ID NO.1, and the mutation is E96I or I183V or D255M or E96I / I183V or E96I / D255M.

[0006] The present invention uses glucose dehydrogenase derived from Lysinibacillus sphaericus as the original enzyme, and its amino acid sequence is shown in SEQ ID No.1, and its nucleotide sequence is shown in SEQ ID No.2. The present invention simulates the single point mutation of the enzyme in the YASARA software, and uses FoldX to calculate its protein folding free energy, and performs point mutation after screening to finally obtain the glucose dehydrogenase mutant. The present invention uses the standard single letter and standard substitution notation of amino acids: E96I means that glutamic acid (E) at the 96th position of the N-terminus is replaced by isoleucine (I); E96I / I183V means that glutamic acid (E) at the 96th position of the N-terminus is replaced by isoleucine (I), and isoleucine (I) at the 183rd position of the N-terminus is replaced by valine (V).

[0007] In a second aspect, the present invention provides a nucleic acid molecule encoding the glucose dehydrogenase mutant described in the first aspect. The nucleotide sequence of the nucleic acid molecule is obtained by base mutation of the sequence shown in SEQ ID NO.2.

[0008] In a third aspect, the present invention provides a vector comprising the nucleotide sequence described in the second aspect. The vector may be a cloning vector or an expression vector.

[0009] In a fourth aspect, the present invention provides a recombinant cell, wherein the recombinant cell comprises the vector described in the third aspect.

[0010] In a fifth aspect, the present invention provides a method for preparing the glucose dehydrogenase mutant described in the first aspect, comprising the following steps: (1) designing a point mutation primer, using a plasmid containing the nucleotide sequence of SEQ ID NO.2 as a template, performing a PCR reaction, digesting the template with an endonuclease, and then recombining the digestion product to obtain an expression vector carrying a mutant gene; (2) transferring the expression vector into a host bacterium for fermentation expression; (3) collecting the host bacterium expressing the glucose dehydrogenase mutant, resuspending the bacteria, breaking the cells, and centrifuging to obtain the supernatant to obtain the glucose dehydrogenase mutant.

[0011] In a sixth aspect, the present invention provides a product, comprising the glucose dehydrogenase mutant described in the first aspect, or the nucleic acid molecule described in the second aspect, or the vector described in the third aspect, or the recombinant cell described in the fourth aspect.

[0012] In a seventh aspect, the present invention provides a use of the product of the sixth aspect in catalyzing D-glucose to produce D-glucono-1,5-lactone, wherein the catalysis is accompanied by the reduction of NAD(P)+ to NAD(P)H.

[0013] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The five glucose dehydrogenase mutants provided by the present invention have good heat resistance, and after high-temperature treatment, they still have higher enzyme activity than the original enzyme; 2. The glucose dehydrogenase mutants provided by the present invention are suitable for establishing a NADH and NADPH regeneration system under high temperature conditions, providing a new high-efficiency and low-cost option for industrial biocatalysis and pharmaceutical applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 A schematic diagram of the structure of glucose dehydrogenase used in the present invention;

[0015] Figure 2 NADH-OD 340 Standard curve;

[0016] Figure 3 is the enzymatic activity of glucose dehydrogenase and mutant enzyme after treatment at different temperatures. DETAILED DESCRIPTION

[0017] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0018] Example 1 Thermostable Glucose Dehydrogenase Mutant E96I

[0019] In this example, the glutamic acid at position 96 of the original enzyme sequence of glucose dehydrogenase as shown in SEQ ID No.1 is mutated to isoleucine; the nucleic acid sequence of the original enzyme of glucose dehydrogenase is shown in SEQ ID No.2, and the structure is as shown in Figure 1 The preparation method of mutant E96I is as follows: 1. constructing a recombinant plasmid; 2. expressing the enzyme mutant and preparing a crude enzyme solution. The specific method is as follows:

[0020] 1. Construction of recombinant plasmid

[0021] Using the pET22b plasmid carrying the original enzyme gene as a template, a plasmid carrying a site-directed mutation gene was constructed by PCR reaction, the template plasmid was digested with DpnI endonuclease, and the digest was subjected to a recombination reaction.

[0022] Plasmids pET-22b and E. coli BL21 (DE3) are both preserved by the applicant's laboratory and are sourced from commercial sources. The original glucose dehydrogenase gene from Lysinibacillus sphaericus was synthesized by Jin Weizhi (Suzhou) Company and inserted between the NdeI and XhoI restriction sites of plasmid pET-22b. The primers used to introduce mutation sites are shown in Table 1, the PCR reaction system is shown in Table 2, the template for point mutation PCR is a pET-22b plasmid with a wild-type glucose dehydrogenase gene sequence, and the other components used for point mutation PCR are all from MutUFO Fast Mutagenesis Kit Rapid Mutation Kit (Nanjing Jujiang Biology). Point mutation PCR reaction conditions are shown in Table 3.

[0023] Table 1 Primers for mutant E96I point mutation

[0024] Point mutation primer name Sequence (5'-3') E96I-F GCGGGCATTATTAACCCGGTGGCGAGCCATGAAATG E96I-R CACCGGGTTAATAATGCCCGCGTTGTTAATCATCAC

[0025] Note: "F" in the primer name stands for upstream primer, "R" stands for downstream primer, and the underlined part in the primer sequence is the mutation site.

[0026] Table 2 Point mutation PCR reaction system

[0027] Composition volume 2×ProofastMaxMasterMix 12.5μL 10pmol / μLForwardPrimer 1μL 10pmol / μLReversePrimer 1μL pET22b plasmid with the original enzyme gene <50ng <![CDATA[ddH2O]]> up to 25 μL

[0028] Table 3 Point mutation PCR reaction conditions

[0029]

[0030] After PCR, since the product contains the original template plasmid, it must be digested with DpnI to prevent it from forming false positive transformants in subsequent transformation. The digestion reaction system is described in Table 4.

[0031] Table 4 DpnI digestion system

[0032] Composition content Point mutation PCR reaction products 25μl DpI 1μl

[0033] The above reaction system was placed in a constant temperature reaction at 37°C for 2 hours.

[0034] After the DpnI digestion reaction was completed, the DpnI digestion product was subjected to a recombination reaction to form a complete circular plasmid. The reaction system was as described in Table 5.

[0035] Table 5 Recombination reaction system

[0036] Composition content DpnI digestion products 4μl 5×UFOBuffer 4μl UvsXase 2μl <![CDATA[ddH2O]]> up to 20 μL

[0037] The reaction system was placed at 37°C for 1 hour. The resulting product was a recombinant plasmid containing the designed point mutation, which was sequenced by GENEWIZ (Suzhou) Co., Ltd. to confirm the mutation result.

[0038] 2. Expression of enzyme mutants and preparation of crude enzyme solution

[0039] The recombinant product was transformed into E.coli BL21 (DE3), and IPTG was used to induce the expression of heterologous protein; the cells were collected by centrifugation of the fermentation broth, and then ultrasonically disrupted and centrifuged again, and the supernatant was the crude enzyme solution containing the glucose dehydrogenase mutant.

[0040] The recombinant plasmid was transformed into the host bacteria of E. coli BL21 (DE3), and spread on the surface of LB solid medium (tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L, agar powder 15g / L) containing 100μg / mL ampicillin, and cultured overnight at 37°C. A single colony of E. coli was picked and inoculated into 3mL of LB liquid medium (tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L) containing 100μg / mL ampicillin, and cultured in a shaker at 37°C and 200rpm for 10h as the seed liquid for fermentation. The seed solution was inoculated at 5% and transferred to a 250 mL conical flask containing 30 mL TB medium (tryptone 11.8 g / L, yeast extract 23.6 g / L, 9.4 g / L K2HPO4, 2.2 g / L KH2PO4, 4 ml / L glycerol) and cultured in a shaker at 37 ° C and 200 rpm. When the culture reached 6 hours, IPTG was added to a final concentration of 0.4 mM, the culture temperature was set to 24 ° C, and the culture was continued for 18 hours. The fermentation broth was centrifuged at 4000 g for 10 minutes, the bacteria were collected, resuspended with a pre-prepared Tris-Hcl buffer solution (pH 8.5), and the cells were ultrasonically disrupted for 3-5 minutes until the liquid was slightly clear, centrifuged at 4000 g for 10 minutes, and the supernatant was taken as the crude enzyme solution of the mutant E96I. The above strain culture and crude enzyme solution preparation experiments were performed in triplicate.

[0041] Example 2 Thermostable Glucose Dehydrogenase Mutant I183V

[0042] In this example, the isoleucine at position 183 of the original enzyme sequence of glucose dehydrogenase shown in SEQ ID No. 1 was mutated to valine. The primers are shown in Table 6, and the rest of the preparation method is the same as in Example 1.

[0043] Table 6 Primers for mutant I183V point mutation

[0044]

[0045]

[0046] Example 3 Thermostable glucose dehydrogenase mutant D255M

[0047] In this example, the aspartic acid at position 255 of the original enzyme sequence of glucose dehydrogenase as shown in SEQ ID No. 1 was mutated to methionine. The primers are shown in Table 7, and the rest of the preparation method is the same as in Example 1.

[0048] Table 7 Primers for mutant D255M point mutation

[0049] Point mutation primer name Sequence (5'-3') D255M-F GTATCCGATGTTTCAAGCGGGCCGCGGCCTC D255M-R GCTTGAAACATCGGATACAGGGTCATGCCGCC

[0050] Example 4 Thermostable Glucose Dehydrogenase Mutant E96I / I183V

[0051] In this example, the isoleucine at position 183 of glucose dehydrogenase E96I in Example 1 was mutated to valine. The primers are shown in Table 6, and the rest of the preparation method is the same as that in Example 1.

[0052] Example 5 Thermostable Glucose Dehydrogenase Mutant E96I / D255M

[0053] In this example, the aspartic acid at position 255 of glucose dehydrogenase E96I in Example 1 was mutated to methionine. The primers are shown in Table 7, and the rest of the preparation method is the same as in Example 1.

[0054] Example 6 Determination of the enzyme activity of glucose dehydrogenase after treatment at different temperatures

[0055] The method in Example 1 was used to express the original glucose dehydrogenase and prepare the crude enzyme solution.

[0056] Based on the principle that glucose dehydrogenase catalyzes glucose and NAD+ to synthesize gluconic acid and NADH, and the characteristic that NADH has specific absorption at 340nm, the enzyme activities of the glucose dehydrogenase mutants and the original glucose dehydrogenase in Examples 1-5 after treatment at different temperatures were measured respectively. Enzyme activity definition: 1 nmol of NADH produced per minute per 1 mL of sample is defined as one enzyme activity unit (U). The specific determination method is as follows:

[0057] Prepare 0.50, 0.25, 0.10, 0.05, and 0.00 mM NADH solutions respectively, take 250 μL into a clean ELISA plate, measure the absorbance at 340 nm and draw a standard curve. Figure 2. Add 100μL 20mM glucose solution, 100μL 20mM NAD solution, and 50μL crude enzyme solution to a clean ELISA plate, and quickly measure the absorbance at 340nm. After reacting at 30℃ for 10min, measure the absorbance at 340nm again, and calculate the difference between the two measurements. When the absorbance is greater than 1.5, dilute appropriately and retest. Treat the supernatant of the crude enzyme solution of the original enzyme and the mutant at 30℃, 40℃, 50℃, and 60℃ for 30min, centrifuge at 4000g for 10min, and take the supernatant to measure the enzyme activity according to the above method.

[0058] The results are as follows Figure 3 As shown. The enzyme activities of the five glucose dehydrogenase mutants were improved after treatment at 30℃, 40℃, 50℃, and 60℃ compared with the original enzyme. After treatment at 40℃ for 30min, the residual enzyme activity of mutant D255M was 57.4% higher than that of the original enzyme; after treatment at 50℃ for 30min, the residual enzyme activity of mutant E96I / I183V was 79.2% higher than that of the original enzyme; after treatment at 60℃ for 30min, the enzyme activities of the original enzyme, mutant I183V, and mutant E96I / D255M lost more than 90%, while mutants E96I, D255M, and E96I / I183V still retained high enzyme activities, and the residual enzyme activities were increased by 23.1 times, 21.2 times, and 27.4 times, respectively, compared with the original enzyme.

Claims

1. A glucose dehydrogenase mutant, characterized in that: The amino acid sequence of the glucose dehydrogenase mutant is obtained by mutation of the sequence shown in SEQ ID NO.1, wherein the mutation is E96I or I183V or D255M or E96I / I183V or E96I / D255M.

2. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the glucose dehydrogenase mutant according to claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that The nucleotide sequence of the nucleic acid molecule is obtained by base mutation of the sequence shown in SEQ ID NO.

2.

4. A carrier, characterized in that Comprising the nucleotide sequence of claim 3.

5. The carrier according to claim 4, characterized in that The vector is a cloning vector or an expression vector.

6. A recombinant cell, characterized in that The recombinant cell comprises the vector of claim 4.

7. A method for preparing the glucose dehydrogenase mutant according to claim 1, characterized in that: The following steps are involved: (1) Designing point mutation primers, using a plasmid containing the nucleotide sequence of SEQ ID NO.2 as a template, performing a PCR reaction, digesting the template with an endonuclease, and then recombining the digestion product to obtain an expression vector carrying a mutant gene; (2) Transforming the expression vector into a host bacterium for fermentation expression; (3) Collecting the host bacterium, disrupting the cells, and centrifuging to obtain the supernatant to obtain a glucose dehydrogenase mutant.

8. A product, characterized in that The product comprises the glucose dehydrogenase mutant according to claim 1 or the nucleic acid molecule according to any one of claims 2 to 3 or the vector according to claim 4 or the recombinant cell according to claim 6.

9. Use of the product according to claim 8 in catalyzing D-glucose to produce D-glucono-1,5-lactone.

10. The use according to claim 9, characterized in that: The catalysis is accompanied by NAD(P) + Reduced to NAD(P)H.

Images