Molecular marker for evaluating myocardial injury in cold environment

Abstract

The invention discloses a piRNA (Ribonucleic Acid) molecular marker hsapiR021717 for evaluating myocardial injury in a cold environment, wherein the nucleotide sequence of the piRNA molecular marker hsapiR021717 is TCACATAACTCCGGCCCTACTTCCTACC. The piRNA molecular marker hsapiR021717 can be used for evaluating myocardial injury in a cold environment. The invention further provides a primer pair for specifically recognizing the hsapiR021717, the primer pair comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is CAGTGCAGGGTCCGAGGT, and the nucleotide sequence of the downstream primer is AACAAGTCACATAACTCCGGCC. By adopting the technical scheme provided by the invention, the technical problems that in the prior art, the specificity of a commonly-used myocardial injury biomarker in diagnosis is still insufficient, and early recognition cannot be well carried out can be solved.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and in particular to a molecular marker for evaluating myocardial damage in a cold environment. Background Art

[0002] Under exposure to cold environments, the functions of multiple organs and tissues undergo significant changes, and the cardiovascular system is particularly sensitive and particularly affected. Due to the intensification of sympathetic nervous system activity, the peripheral vasoconstriction effect and myocardial contraction mediated by it are significantly enhanced. Long-term or excessive cold stimulation will not only increase the preload and afterload of the heart, but also promote the increase in myocardial oxygen consumption, causing direct damage to the myocardium, thereby affecting the overall function of the heart. This series of changes may lead to the appearance of clinical symptoms such as chest tightness, fatigue, palpitations and syncope, and in extreme cases, it is more likely to induce acute cardiovascular events, posing a serious threat to the health of the body. Therefore, early and efficient identification of myocardial damage caused by exposure to cold environments is crucial to ensuring the personal safety of those working in cold outdoor environments in winter, and it also helps to improve their work efficiency and task completion quality in such environments.

[0003] Given the hidden nature of myocardial injury caused by cold environments, the currently commonly used biomarkers of myocardial injury in clinical practice are still insufficient in diagnostic specificity. Therefore, it is urgent to explore new markers of myocardial injury caused by cold environments in order to facilitate early identification and assessment of myocardial injury in cold environments. Summary of the invention

[0004] In view of the shortcomings of the prior art, the present invention proposes a molecular marker for evaluating myocardial injury in a cold environment, so as to solve the technical problem that the commonly used myocardial injury biomarkers in the prior art are insufficient in diagnostic specificity and cannot perform early identification well.

[0005] The technical solution adopted by the present invention is as follows:

[0006] In a first aspect, a molecular marker for evaluating myocardial injury in a cold environment is provided, wherein the molecular marker is the piRNA marker hsa_piR_021717, and its nucleotide sequence is shown in SEQ ID No.1.

[0007] In a second aspect, an application of a substance for detecting piRNA markers is provided, including one or more of the following applications:

[0008] Application in the preparation of products for diagnosing myocardial injury in cold environments;

[0009] Application in the preparation of products for screening myocardial injury in cold environments;

[0010] Application in the preparation of products for assessing the risk of myocardial injury in cold environments;

[0011] Application in the preparation of products for evaluating the prognosis of myocardial injury in cold environments;

[0012] The piRNA marker is hsa_piR_021717, and its nucleotide sequence is shown in SEQ ID No.1.

[0013] Furthermore, the product is a product for diagnosing myocardial injury in a cold environment by detecting the expression level of hsa_piR_021717 through RT-PCR, qPCR, in situ hybridization, chip or high-throughput sequencing platform.

[0014] Furthermore, the substance is a reagent for detecting the expression level of hsa_piR_021717, or a reagent for specifically identifying hsa_piR_021717, or a reagent for detecting the content of hsa_piR_021717.

[0015] Further, the substance is a substance for detecting hsa_piR_021717, including:

[0016] (a) primers for detecting or specifically recognizing hsa_piR_021717;

[0017] (b) a reagent set comprising (a);

[0018] (c) A kit comprising (a) or (c).

[0019] Furthermore, the primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0020] In a third aspect, a kit for detecting piRNA markers is provided, wherein the kit comprises one or more of the following applications:

[0021] Application in the preparation of products for diagnosing myocardial injury in cold environments;

[0022] Application in the preparation of products for screening myocardial injury in cold environments;

[0023] Application in the preparation of products for assessing the risk of myocardial injury in cold environments;

[0024] Application in the preparation of products for evaluating the prognosis of myocardial injury in cold environments;

[0025] The piRNA marker is hsa_piR_021717, and its nucleotide sequence is shown in SEQ ID No.1; the kit includes a reagent for detecting or specifically identifying hsa_piR_021717, or a reagent for detecting the expression level of hsa_piR_021717.

[0026] Furthermore, the reagent used in the kit to detect or specifically identify hsa_piR_021717 is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0027] In a fourth aspect, a primer for detecting a piRNA marker is provided, wherein the primer comprises one or more of the following applications:

[0028] Application in the preparation of products for diagnosing myocardial injury in cold environments;

[0029] Application in the preparation of products for screening myocardial injury in cold environments;

[0030] Application in the preparation of products for assessing the risk of myocardial injury in cold environments;

[0031] Application in the preparation of products for evaluating the prognosis of myocardial injury in cold environments;

[0032] The primers are primers for detecting the expression level of hsa_piR_021717 or specifically identifying hsa_piR_021717, and the piRNA marker is hsa_piR_021717, and its nucleotide sequence is shown in SEQ ID No.1.

[0033] Furthermore, the primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0034] It can be seen from the above technical solution that the beneficial technical effects of the present invention are as follows:

[0035] The hsa_piR_021717 provided by the present invention is a new molecular marker that can be used to evaluate myocardial injury in a cold environment, can achieve early identification, and has good specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following is a brief introduction to the drawings required for the specific embodiments or the prior art description. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn according to the actual scale.

[0037] Figure 1 A volcano plot of the difference in plasma piRNA expression between the myocardial injury group and the control group under cold conditions obtained by RNA transcriptome sequencing in Example 1 of the present invention;

[0038] Figure 2 This is a comparison chart of the hsa_piR_021717 content in plasma of the myocardial injury group and the control group under cold environment determined by the RT-qPCR method in Example 1 of the present invention;

[0039] Figure 3 This is the ROC curve of hsa_piR_021717 in Example 1 of the present invention for diagnosing myocardial injury in cold environment;

[0040] Figure 4 It is a line graph of the correlation between plasma cTnI and hsa_piR_021717 expression level in Example 1 of the present invention;

[0041] Figure 5 This is a RT-qPCR verification diagram of knocking down piR_021717 by transfection with lentiviral piR_021717-inhibitor in Example 2 of the present invention;

[0042] Figure 6 This is a comparison chart of the expression levels of cTnI in the mice cold exposure-induced myocardial injury group, the control group, and the piR_021717 knockdown group in Example 2 of the present invention;

[0043] Figure 7 This is a comparison of myocardial tissue pathological staining of the mouse cold exposure-induced myocardial injury group, the control group, and the piR_021717 knockdown group in Example 2 of the present invention;

[0044] Figure 8 This is a comparison chart of the expression levels of cTnI in the myocardial cell injury group, control group, lentivirus piR_021717-inhibitor transfection knockdown group and negative control virus transfection group under a simulated cold environment at the cell level of Example 2 of the present invention. DETAILED DESCRIPTION

[0045] The following embodiments of the technical solution of the present invention are described in detail in conjunction with the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and are therefore only used as examples, and cannot be used to limit the protection scope of the present invention.

[0046] It should be noted that, unless otherwise specified, the technical terms or scientific terms used in this application should have the common meanings understood by those skilled in the art to which the present invention belongs.

[0047] Piwi-interacting RNA (piRNA) is a small non-coding RNA that binds to PIWI protein and mainly silences transposable elements and regulates protein-coding genes in animal germ cells to maintain the integrity of the germline genome. piRNA has been shown to be expressed in tissue cells other than germ cells and plays an important regulatory role in many physiological and pathological processes such as myocardial hypertrophy and cardiac remodeling.

[0048] The inventors of the present application have found through research that piRNA is associated with a variety of cardiovascular diseases, and that piRNA is located upstream of transcription and changes earlier than proteins. Therefore, this example uses piRNA as a marker for testing.

[0049] Example 1

[0050] In this embodiment, the screening and correlation study of piRNA markers of myocardial injury in cold environment was carried out. 70 subjects who worked in cold areas for a long time were selected to exclude the possibility of other heart diseases. After venous blood sampling, Arraystar Human piRNA Array of Arraystar was used to detect the difference in piRNA expression spectrum in the serum of individuals with myocardial injury and those without myocardial injury among these subjects. Then, the results were analyzed using R software, and the test results were analyzed to screen out piRNAs with significant differences in expression (Fold change ≥ 2.0, P value < 0.05). Subsequently, the contents of the top 10 piRNA chip results in the plasma of the subjects were determined by real-time fluorescence quantitative reverse transcription polymerase chain reaction (RT-qPCR) technology, and the first one with significant increase was selected for subsequent analysis. The details are as follows:

[0051] 1. Clinical samples:

[0052] Venous blood samples were collected from 70 subjects (aged 20-40 years old, and other heart diseases were excluded) who had lived in Mohe area of ​​Heilongjiang Province (located at 52-53°N, with a winter lasting 8 months, an average minimum temperature of -23°C in winter, and a historical minimum temperature of -53°C) for more than 1 year and had been engaged in long-term outdoor cold environment work.

[0053] 2. Definition and grouping of myocardial injury:

[0054] Myocardial injury was considered to exist if any of the following conditions occurred: (1) the ejection fraction of the heart ultrasound decreased by more than 5% after exposure to cold environment compared with the baseline level before exposure; (2) ischemic changes were found in electrocardiogram; (3) clinical symptoms such as chest tightness, chest pain and shortness of breath after activity appeared; (4) myocardial injury markers in serological examination exceeded the upper limit of normal reference value. All subjects were divided into myocardial injury group and control group under cold environment.

[0055] 3. RNA extraction:

[0056] Human peripheral blood was collected using EDTA anticoagulation blood collection tubes, centrifuged at 2500g for 15min, and the upper plasma was taken to a 2ml sterile tube. Total RNA was extracted using the RNA extraction and separation kit (DP419). According to the instructions, 1ml TRIZOL reagent and 200u1 chloroform were added to the plasma, oscillated for 20s, and allowed to stand at room temperature for 10min. Centrifuged at 13000rpm and 4℃ for 15min. Carefully aspirate the supernatant, add 800u1 isopropanol, gently mix upside down, and stand at -20℃ for 1h. Then centrifuge at 13000rpm and 4℃ for 15min, and discard the supernatant. Next, add 1ml 75% ethanol, gently wash the precipitate, centrifuge at 13000rpm and 4℃ for 5min, remove the supernatant, and blow dry. Finally, add an appropriate amount of nuclease-free H2O, dissolve at 65℃ for 10min to detect the OD value and concentration of RNA, and store at -80℃ for later use.

[0057] 4. piRNA sequencing analysis:

[0058] Total RNA was extracted from blood samples of the myocardial injury group and the control group under cold environment and sent to Arraystar Biotech for piRNA sequencing. The piRNAs with significant expression differences (Fold chang ≥ 2.0, P value < 0.05) were screened and then RT-qPCR was used to determine the content of the piRNA results in the patient's plasma. The measurement results are shown in the following table. The first significantly increased hsa_piR_021717 was selected for subsequent experiments.

[0059] piRNA log2FoldChange pvalue Adjust up / down hsa_piR_021717 2.81 1.69437E-05 Up hsa_piR_626026 1.86 0.021119202 Up hsa_piR_1638599 1.68 0.045052057 Up hsa_piR_1522391 1.67 0.015565688 Up hsa_piR_5324836 1.59 0.020642256 Up hsa_piR_7501433 1.59 0.000138123 Up hsa_piR_6729860 1.55 0.005325291 Up hsa_piR_000691 1.52 0.005678601 Up hsa_piR_005854 1.52 0.000322983 Up hsa_piR_2106027 1.51 0.007096521 Up

[0060] 5.RT-qPCR detection:

[0061] Use a reverse transcription kit (RR037A) to reverse transcribe 500 ng of RNA into cDNA. Refer to the instructions to build a reaction system of 20u1 (as shown in the table below). The reaction procedure is: 37°C for 45 min, 85°C for 5 min, and maintain at 4°C.

[0062]

[0063] Design piRNA primer sequences, dilute the cDNA obtained by reverse transcription reaction at 1:10, use high-specificity qPCR reagent kit (RR820A) for reaction, refer to the instructions, build the reaction system 20u1 (as shown in the table below), the reaction procedure is: 95℃ pre-denaturation for 2min; 95℃ denaturation for 5s, 60℃ annealing for 30s, 95℃ extension for 15s, repeat 40 cycles. Use GAPDH protein to quantify the relative level of piRNA and express it as a relative ratio.

[0064]

[0065] 6. Plasma Troponin Determination

[0066] Human cardiac troponin I (cTnI) EILSA assay kit (ZC-35149) was used for determination. The operation was carried out according to the instructions of the kit. First, 100ul of standard or sample to be tested was added to each well. The kit was equilibrated at room temperature for 30 minutes, and then the required strips were taken out of the aluminum foil bag. Standard wells and sample wells were set up, and 50μl of standard of different concentrations was added to each standard well. 50μL of sample to be tested was added to the sample well, and nothing was added to the blank well. Except for the blank well, 100μL of HRP-labeled detection antibody was added to each well of the standard well and sample well. The reaction wells were sealed with a sealing film and incubated in a 37℃ water bath or incubator for 60 minutes. The liquid was discarded, patted dry on absorbent paper, and each well was filled with washing solution, left for 1 minute, the washing solution was shaken off, and patted dry on absorbent paper. Repeat the washing process 5 times. Substrate was added to each well and incubated at 37℃ in the dark for 15 minutes. Add 50 μL of stop solution to each well, and measure the OD value of each well at a wavelength of 450 nm within 15 minutes.

[0067] 7. Statistical analysis:

[0068] The t-test and analysis of variance were used for normally distributed variables, and the MannWhitney U test and Kruskal Wallis test were used for non-normally distributed variables. Statistical analysis was performed using R software (v 4.3.2) and GraphPad Prism software (v8.01). Biological replicates were shown as single data points superimposed on the bar graph. P < 0.05 was considered to be significantly different. Linear regression was used to analyze the potential relationship between variables, and the Spearman correlation coefficient was used to evaluate the data effect. The receiver operating characteristic (ROC) curve was used to determine the diagnostic efficacy of the marker for endpoint events.

[0069] 8. Verification results:

[0070] like Figure 1 , 2As shown, the results of RNA sequencing and RT-qPCR showed that the expression level of hsa_piR_021717 in the plasma of subjects in the myocardial injury group under cold environment was significantly increased compared with the expression level of hsa_piR_021717 in the plasma of subjects in the control group, indicating that hsa_piR_021717 is a potential biomarker for myocardial injury under cold environment.

[0071] like Figure 3 As shown, the ROC curve of hsa_piR_021717 for diagnosing myocardial injury in cold environment suggests that hsa_piR_021717 has good diagnostic efficacy;

[0072] like Figure 4 As shown, it is the relationship between the expression of cTnI and hsa_piR_021717 in the subject's plasma; cTnI is a marker protein of myocardial injury, and it can be seen from the figure that cTnI and hsa_piR_021717 expression are significantly positively correlated;

[0073] The above results indicate that the level of hsa_piR_021717 in plasma can reflect the severity of myocardial damage in a cold environment.

[0074] Example 2

[0075] hsa_piR_021717 is a human-derived piR_021717. Due to the high conservatism of piR_021717 among species, it is also expressed in mice. Therefore, in this example, the relationship between piR_021717 and myocardial injury in cold environment was further confirmed at the cellular level using mouse modeling. The details are as follows:

[0076] 1. Animal modeling:

[0077] Six-week-old C57 mice were purchased from Beijing Sibeifu Biotechnology Co., Ltd. and randomly divided into two groups. One group of mice was placed in a temperature-controlled box that simulated a cold environment (the temperature was set at -20°C for 6 hours a day), while the other group was kept at room temperature (21°C) as a control group. After two weeks, blood samples and heart tissues were collected from the two groups of mice for subsequent analysis.

[0078] 2. Pathological staining:

[0079] Masson staining was used to reflect the degree of myocardial tissue fibrosis. According to the instructions for use of the Masson staining kit (RY-0003), the paraffin sections were dewaxed to water, and the sections were placed in xylene I for 20 minutes, xylene II for 20 minutes, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, and 75% alcohol for 5 minutes, and then washed with tap water. The sections were immersed in Masson A solution overnight and washed with tap water. After that, the sections were immersed in a dye solution mixed with Masson B solution and Masson C solution in equal proportions, immersed for 1 minute, washed with tap water, differentiated with 1% hydrochloric acid alcohol, and washed with tap water. The sections were immersed in Masson D solution for 6 minutes and rinsed with tap water. Then, the sections were immersed in Masson E solution for 1 minute, without washing with water, and directly immersed in Masson F solution for 2-30 seconds after draining. Finally, the slices were rinsed and differentiated with 1% glacial acetic acid, and then placed in anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, anhydrous ethanol III for 5 min, xylene I for 5 min, and xylene II for 5 min to make them transparent, and then sealed with neutral gum. Microscope examination and image acquisition and analysis were performed.

[0080] 3. Mouse plasma RNA extraction and RT-qPCR methods were the same as in Example 1.

[0081] 4. Determination of cTnI in mouse plasma / cell culture supernatant:

[0082] Mouse cardiac troponin I EILSA assay kit (ZC-38813) was used for the assay. The operation was carried out according to the instructions of the kit, and the steps were the same as those in Example 1.

[0083] 5. piRNA knockdown method:

[0084] The knockdown virus piR_021717-inhibitor and its corresponding negative control virus were purchased from Shanghai GeneCare Gene Medical Technology Co., Ltd. According to the instructions, transfection was performed by tail vein injection, and the effect was detected 24 hours after injection.

[0085] 6. In vitro culture of mouse cardiomyocytes:

[0086] Mouse cardiomyocyte cell line (HL-1) was purchased from Wuhan Shanen Bio (SNL-319). The culture medium used: 89% MEM medium + 10% FBS + 1% double antibody. Growth conditions: gas phase: 95% air + 5% carbon dioxide; temperature: 37°C; humidity: 70-80%. Passaging method: 1:2 to 1:4, 2-3 times a week. Studies have shown that myocardial H2O2 levels are significantly increased in cold environments, and H2O2 is considered to be a potential mechanism of myocardial damage caused by cold stimulation. HL-1 cells were treated with H2O2 (concentration 2mmol / L) to simulate myocardial cell damage caused by cold stimulation.

[0087] 7. Experimental results:

[0088] Figure 5 After mice were transfected with the lentiviral piR_021717-inhibitor, the expression of plasma piR_021717 decreased, indicating that the transfection was successful. Subsequent experiments were completed on this basis.

[0089] Figure 6 The expression levels of cTnI in the cold exposure-induced myocardial injury group, control group and piR_021717 knockdown group of mice show that cold exposure can increase the expression of piR_021717, while the expression level of cTnI decreases after knockdown of piR_021717. This may be the molecular biological basis for piR_021717 to serve as a biomarker for diagnosing myocardial injury in cold environments.

[0090] Figure 7 Pathological staining of myocardial tissue in the mouse cold exposure-induced myocardial injury group, control group and piR_021717 knockdown group. The results showed that exposure to cold environment can cause myocardial fibrosis, and the degree of myocardial fibrosis was significantly reduced after knocking down piR_021717, indicating that the degree of damage was reduced.

[0091] Figure 8 The expression levels of cTnI in the mouse myocardial cell injury group, control group, lentivirus piR_021717-inhibitor transfection knockdown group and negative control virus transfection group were simulated at the cellular level under cold environment. The results showed that the expression level of cTnI in H2O2-treated cardiomyocytes was reduced after knocking down piR_021717. The in vitro cell level verified that reducing piR_021717 expression had a significant improvement effect on myocardial injury.

[0092] The above implementation results show that hsa_piR_021717 is significantly correlated with myocardial injury in cold environment, and can be used as a new molecular marker for diagnosing myocardial injury in cold environment; plasma cTnI is significantly positively correlated with hsa_piR_021717 expression; the results of ROC curve suggest that hsa_piR_021717 has good efficacy in diagnosing myocardial injury in cold environment. In addition, the expression of piR_021717 in animal models under cold environment is significantly upregulated; and piR_021717 knockdown significantly reduces cTnI levels and improves the phenotype of myocardial injury induced by cold exposure.

[0093] In summary, hsa_piR_021717 can be used as a new molecular marker and therapeutic target for evaluating myocardial injury in cold environment.

[0094] Example 3

[0095] Based on the research results of Example 1 and Example 2, this example provides a piRNA marker hsa_piR_021717, whose nucleotide sequence is shown in SEQ ID No. 1:

[0096] SEQ ID No.1: TCACATAACTCCGGCCCTACTTCCTACTC

[0097] This embodiment also provides a primer pair for specifically identifying hsa_piR_021717, including an upstream primer as shown in SEQ ID No.2 and a downstream primer as shown in SEQ ID No.3:

[0098] SEQ ID No.2: CAGTGCAGGGTCCGAGGT

[0099] SEQ ID No.3: AACAAGTCACATAACTCCGGCC

[0100] This embodiment also provides a kit, wherein the reagent for detecting or specifically identifying hsa_piR_021717 is a specific primer, and the specific primer is an upstream primer shown in SEQ ID No. 2 and a downstream primer shown in SEQ ID No. 3. The kit includes:

[0101] Prime Script buffer (5x), Prime Script Prime Script reverse transcriptase mix I, Random6mers, nuclease-free H2O, SYBR Premix Ex Taq II (Tli RNaseH Plus) (2x), PCR primers (F+R) (10uM), ROX control dye (50x).

[0102] By adopting the above technical solution, a new molecular marker hsa_piR_021717 is provided, which can be used to evaluate myocardial damage in cold environments, achieve early identification, and has good specificity.

[0103] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. These modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be included in the scope of the claims and specification of the present invention.

Claims

1. A molecular marker for evaluating myocardial damage in a cold environment, characterized in that: The molecular marker is the piRNA marker hsa_piR_021717, and its nucleotide sequence is shown in SEQ ID No.

1.

2. An application of a substance for detecting piRNA markers, characterized in that: Includes one or more of the following applications: Application in the preparation of products for diagnosing myocardial injury in cold environments; Application in the preparation of products for screening myocardial injury in cold environments; Application in the preparation of products for assessing the risk of myocardial injury in cold environments; Application in the preparation of products for evaluating the prognosis of myocardial injury in cold environments; The piRNA marker is hsa_piR_021717, and its nucleotide sequence is shown in SEQ ID No.

1.

3. The use of the substance for detecting piRNA markers according to claim 2, characterized in that: The product is a product for diagnosing myocardial injury in a cold environment by detecting the expression level of hsa_piR_021717 through RT-PCR, qPCR, in situ hybridization, chip or high-throughput sequencing platform.

4. The use of the substance for detecting piRNA markers according to claim 2, characterized in that: The substance is a reagent for detecting the expression level of hsa_piR_021717, or a reagent for specifically identifying hsa_piR_021717, or a reagent for detecting the content of hsa_piR_021717.

5. The use of the substance for detecting piRNA markers according to claim 2, characterized in that: The substance is a substance for detecting hsa_piR_021717, including: (a) primers for detecting or specifically recognizing hsa_piR_021717; (b) a reagent set comprising (a); (c) A kit comprising (a) or (c).

6. The use of the substance for detecting piRNA markers according to claim 5, characterized in that: The primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.

3.

7. A kit for detecting piRNA markers, characterized in that: The kit includes one or more of the following applications: Application in the preparation of products for diagnosing myocardial injury in cold environments; Application in the preparation of products for screening myocardial injury in cold environments; Application in the preparation of products for assessing the risk of myocardial injury in cold environments; Application in the preparation of products for evaluating the prognosis of myocardial injury in cold environments; The piRNA marker is hsa_piR_021717, and its nucleotide sequence is shown in SEQ ID No.1; the kit includes a reagent for detecting or specifically identifying hsa_piR_021717, or a reagent for detecting the expression level of hsa_piR_021717.

8. The kit for detecting piRNA markers according to claim 7, characterized in that: The reagent used in the kit for detecting or specifically identifying hsa_piR_021717 is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.

3.

9. A primer for detecting piRNA markers, characterized in that: The primers include one or more of the following applications: Application in the preparation of products for diagnosing myocardial injury in cold environments; Application in the preparation of products for screening myocardial injury in cold environments; Application in the preparation of products for assessing the risk of myocardial injury in cold environments; Application in the preparation of products for evaluating the prognosis of myocardial injury in cold environments; The primers are primers for detecting the expression level of hsa_piR_021717 or specifically identifying hsa_piR_021717, and the piRNA marker is hsa_piR_021717, and its nucleotide sequence is shown in SEQ ID No.

1.

10. The primer for detecting piRNA markers according to claim 9, characterized in that: The primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

Images