Multivalent lysosome targeting chimera and application thereof in protein degradation and immunotherapy

Abstract

The invention discloses a multivalent lysosome targeting chimera and application thereof in protein degradation and immunotherapy, and belongs to the technical field of immunotherapy. The multivalent lysosome targeting chimera provided by the invention can efficiently recognize and combine a target protein and a lysosome shuttle receptor to cause degradation of the target protein through a lysosome way. The lysosome targeting chimera can continuously act at a target part, achieves the beneficial effects of low dosage and high curative effect, can effectively block a PDL1 / PD1 signal axis, causes tumor cell immunogenic death, induces strong anti-tumor immune response, and has multiple effects of inducing tumor apoptosis and blocking immune checkpoints.

Description

Technical Field

[0001] The invention belongs to the technical field of immunotherapy, and in particular relates to a multivalent lysosome targeting chimera and its application in protein degradation and immunotherapy. Background Art

[0002] Immune checkpoint blockade therapy is the main means of tumor immunotherapy. A variety of antibody drugs have been used clinically, but the actual clinical response rate of existing immune checkpoint blockade therapies is low, and there is a need to develop efficient and safe immune checkpoint blockade drugs.

[0003] Recent studies have shown that in addition to the function of immune checkpoints, the intracellular part of the transmembrane structure of PDL1 is also widely involved in related signal pathways such as tumor cell growth, proliferation and metastasis, promoting the occurrence and development of tumor cells. Therefore, blocking the immune checkpoint function of PDL1 by means of antibodies and other means can only achieve the goal of tumor immunotherapy to a certain extent. There are currently several strategies to downregulate the expression level of PDL1 on the surface of tumor cells. For example, based on the signal pathway of PDL1 expression, some small molecule inhibitors are introduced to reduce the expression of PDL1, but this strategy can only interfere with one of the expression pathways. Tumor cells may increase the expression of PDL1 through other compensatory pathways, making it difficult to achieve the expected PDL1 downregulation effect. In addition to the strategy of interfering with PDL1 expression, PDL1 can also be downregulated by silencing PDL1-related genes, such as using siRNA or gene editing tools CRISPR to achieve silencing of the PDL1 gene, but this strategy involving gene editing still faces problems such as low delivery efficiency in practice, which makes it difficult to be widely used.

[0004] In recent years, with the development of emerging technologies, the protein degradation targeted chimera (PROTAC) structure has received widespread attention. The two ends of the PROTAC molecule recognize the target protein and the E3 ubiquitin ligase respectively, and realize the connection between the target protein and the E3 ubiquitin ligase. Through a series of biological processes, the target protein is labeled with a ubiquitin tag, which is then recognized by the proteasome in the cell and further degraded by the proteasome. Since the ubiquitination process mainly occurs in the cell, this strategy has limited effect on the degradation of membrane proteins.

[0005] In 2020, American chemist Professor Carolyn Bertozzi pioneered the development of a lysosome-targeted chimera (LYTAC) technology to target membrane protein degradation. One end of the chimera targets the target protein through an antibody, and the other end targets the cation-independent mannose 6-phosphate receptor (CI-M6PR) through an oligosaccharide peptide group. This lysosome-targeted chimera can connect with the target membrane protein and the lysosomal shuttling receptor to form a ternary complex, and further mediate the target membrane protein to the lysosome for complete degradation through the lysosomal shuttling activity of CI-M6PR, thereby achieving the effect of downregulating the level of the target protein on the cell membrane.

[0006] In addition, existing technologies mainly focus on the development of new molecular tools and their applications at the cellular level, and have not yet been practiced and promoted at the organism level and in actual applications. The difficulties of existing technologies lie in the difficulty of the process, stability and safety risks in organisms, high production costs, and unstable degradation efficiency.

[0007] In the current existing technology, the use of LYTAC molecules is limited by connection stability, binding efficiency, etc., which affects the degradation efficiency. Summary of the invention

[0008] To solve the above problems, the present invention provides a multivalent lysosomal targeting chimera (LYTAC), which contains a target protein recognition structure and a ligand structure targeting a lysosomal shuttling receptor, and one target protein recognition structure is connected to more than one ligand structure. This multivalent protein degrader has better stability in vivo and higher degradation efficiency.

[0009] The first object of the present invention is to provide a multivalent lysosomal targeting chimera, comprising any one of the following structures: a target protein recognition structure and a lysosomal shuttle receptor recognition structure connected by a connecting molecule, and the molar ratio n of the lysosomal shuttle receptor recognition structure to the target protein recognition structure is >1.

[0010] Furthermore, the 1 <n≤15。

[0011] Furthermore, the lysosomal shuttle receptor recognition structure or the target protein recognition structure is connected to the connecting molecule via a flexible segment or directly.

[0012] Furthermore, the linker molecule is a molecule that is non-degradable in the tumor microenvironment.

[0013] Furthermore, the linker molecule contains at least one of the following structures: an amide bond, a triazole ring, a thioether bond, and a disulfide bond.

[0014] Furthermore, the linker molecule contains at least one of the following structures:

[0015]

[0016] Furthermore, the target protein recognition structure includes PDL1 antibody, HER2 antibody, platelet-derived growth factor antibody, protein tyrosine kinase 7 antibody, mesenchymal epithelial transition factor antibody, G protein coupled receptor 65 antibody, CD47 antibody, CD71 antibody, EGFR antibody, ABCG2 antibody, etc.

[0017] Furthermore, the target protein recognition structure is selected from commercially available or homemade monoclonal or polyclonal antibodies.

[0018] Furthermore, the lysosomal shuttle receptor recognition structure includes one or more of CI-M6PR nucleic acid aptamer, ASGPR nucleic acid aptamer, transferrin receptor (CD71) nucleic acid aptamer, and poly-oligonucleotide.

[0019] Preferably, the CI-M6PR nucleic acid aptamer is selected from one or more of the following sequences:

[0020] 5'-GGGCGCGTAGATGACGAGCAGTCCTAACATCGTTTAGGAC-3'

[0021] (SEQ ID NO.1);

[0022] 5'-GGGGAGGGCGATTCGGTGTGTCCTCCAGAAGATATTTCCGA-3'

[0023] (SEQ ID NO.2);

[0024] 5'-CGGGCACGGATGGAGTTCGTTGCAGGGGCCCTTCCCCTTGG-3'

[0025] (SEQ ID NO.3);

[0026] 5'-CCGACCGTGACCAGACAAACGTTTGAGTAGGCGCCCGACA-3' (SEQ ID NO. 4);

[0027] The ASGPR nucleic acid aptamer is the following sequence:

[0028] 5'-UUGAUUGCGUGUCAAUCAUGGCGUAGUAAAAGACAAGUAGCU ACGAGGUCAUGUGUAUGUUGGGGAUUAGGACCUGAUUGAGUUCAGC CCACAUAC-3' (SEQ ID NO. 5).

[0029] Furthermore, the structure of the multivalent lysosomal targeting chimera includes but is not limited to any one of the following structures:

[0030]

[0031] Among them, X is the target protein recognition structure, R1 and R2 are flexible segments, and Y is the lysosomal shuttle receptor recognition structure.

[0032] Wherein, R1 and R2 are independently selected from PEG, a carbon chain or a base chain.

[0033] The second object of the present invention is to provide the use of the above-mentioned multivalent lysosome targeting chimera in the preparation of protein degradation agents or immunotherapy drugs.

[0034] Furthermore, the immunotherapy drug can be prepared into immune checkpoint blocking drugs and the like for anti-tumor use.

[0035] Beneficial effects of the present invention:

[0036] 1) The lysosome targeting chimera of the present invention has a multivalent effect, so that after the target protein recognition structure is connected to multiple lysosomal shuttle receptor recognition structures, the efficiency of binding to the lysosomal shuttle receptor is higher, thereby improving the degradation efficiency of the target protein.

[0037] 2) The multivalent lysosome targeting chimera of the present invention is prepared by covalent coupling reaction, the synthesis method is simple, the reaction efficiency is high, it is conducive to purification operation, and the overall preparation cost is low.

[0038] 3) The multivalent lysosome targeting chimera of the present invention has good stability in vivo, does not cause adverse reactions to physiological activities, and due to its high recognition efficiency, can be better enriched in the tumor site, thereby improving safety in use.

[0039] 4) The multivalent lysosome targeting chimera of the present invention can continuously act at the target site to achieve the beneficial effect of low dose and high efficacy. In addition to achieving the results of immune checkpoint blockade, it can also induce the degradation of cell surface PDL1 to cause tumor cell apoptosis, release tumor antigens, stimulate immune cells to enhance anti-tumor immune response, and integrate the continuous reaction of immunogenic death-antigen presentation and immune cell activation-immune checkpoint blockade effect, thereby achieving a coherent anti-tumor immune response and amplifying the efficacy. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Example B1 is a protein blot of PDL1 contained in B19F10 tumor cells in different samples;

[0041] Figure 2 is a Western blot of PDL1 of tumor cells in different groups in Example B2;

[0042] Figure 3 is a statistical graph of PDL1 content after cells were incubated for 24 hours at different sample concentrations in Example B3;

[0043] Figure 4 is a statistical graph of the relative content of cell membrane PDL1 protein at different time points during the co-incubation of samples and cells in Example B4;

[0044] Figure 5 is a statistical graph of the apoptosis ratios of different groups of cells in Example B5;

[0045] Figure 6 is a statistical diagram of relative activity of cells in different groups in Example B6;

[0046] Figure 7 is a fluorescence signal image of cell surface calreticulin captured by laser confocal microscopy in Example B7;

[0047] Figure 8 is a statistical graph of ATP release of cells in different groups in Example B7;

[0048] Fig. 9 is a statistical graph of the maturation ratios of dendritic cells in different groups in Example B8;

[0049] Fig.10 It is a graph showing the tumor growth curves of mice in different groups in Example C1. DETAILED DESCRIPTION

[0050] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0051] As shown in this specification and claims, the words "a", "an", "an" and / or "the" do not refer to the singular and may include the plural unless the context clearly indicates an exception. The terms "include" and "comprise" only indicate that the elements explicitly identified are included, and these elements do not constitute an exclusive list. The term "one embodiment" means "at least one embodiment"; the term "another embodiment" means "at least one other embodiment".

[0052] The detection equipment and methods used in the embodiments of this specification are:

[0053] Flow cytometer, BD, model FACSCalibur.

[0054] Confocal microscope, Leica, model TCS SP8.

[0055] Protein blot, Western Blot.

[0056] Example A1: A multivalent lysosome targeting chimera, including a target protein recognition structure and a lysosome shuttle receptor recognition structure. The specific structural composition is shown in the following table:

[0057]

[0058] Example A2: A method for preparing a multivalent lysosomal targeting chimera:

[0059] The amino group of the PDL1 antibody was replaced with azide to obtain an azide-modified PDL1 antibody; the CI-M6PR nucleic acid aptamer was modified with DBCO to obtain a DBCO-modified CI-M6PR nucleic acid aptamer;

[0060] The azide-modified PDL1 antibody and DBCO-modified CI-M6PR nucleic acid aptamer were linked via click chemistry reaction.

[0061] The experimental method for preparing LYTAC by azide-modified antibody and click chemistry reaction is:

[0062] 1) 30 μM of PDL1 antibody was mixed with 1.5 mM of bifunctional cross-linker NHS-PEG4-N3 in a neutral PBS buffer, and reacted under mild stirring conditions for 1 hour (300 rpm, 25° C.) to obtain a product, namely, an azide-modified PDL1 antibody.

[0063] 2) After the reaction is completed, the product is filtered using a 50 kD ultrafiltration centrifuge tube and washed with a neutral PBS buffer to fully remove excess bifunctional cross-linking agent NHS-PEG4-N3.

[0064] 3) 10 μM of PDL1 antibody with an azide group was mixed with the DBCO-modified nucleic acid aptamer and incubated at 25° C. for 1 to 24 hours to obtain a lysosome-targeted chimera. In order to remove excess DBCO-oligonucleotide, the lysosome-targeted chimera was ultrafiltered using a 50 kD ultrafiltration centrifugal filter and washed with a neutral PBS buffer.

[0065] 4) Finally, the lysosome-targeted chimera was collected and stored at 4°C for future use.

[0066] By adjusting the feed ratio of the azide-modified PDL1 antibody and the DBCO-modified CI-M6PR nucleic acid aptamer, a multivalent lysosome-targeting chimera can be obtained. Corresponding to Examples A1.1 to A1.4, the feed amounts are shown in the following table:

[0067]

[0068]

[0069] The multivalent lysosome targeting chimera is an antibody connected with multiple nucleic acid aptamers, which can increase the affinity (efficiency) of the antibody binding to the lysosomal shuttle protein after recognition and coordination, thereby improving the effect of lysosome targeting.

[0070] Example B1: Experiment on detecting the PDL1 degradation efficiency of lysosome targeting chimera.

[0071] 10 5 B19F10 tumor cells were co-incubated with 10 nM of the lysosome targeting chimeras of Examples A1.1 to A1.4, and then the content of PDL1 on the tumor cells was detected using western blot technology. In addition, the amount of lysosome targeting chimeras was increased, 10 5 Each tumor cell was co-incubated with 50 nM of the lysosome targeting chimera of Example A1.1 to Example A1.4, and the PDL1 content of the tumor cells was detected by western blot technology.

[0072] Figure 1 The test is a protein blot of PDL1 contained in B19F10 tumor cells in different samples. The depth of the band represents the PDL1 content. The darker the band, the higher the PDL1 content, and the lighter the band, the lower the PDL1 content. Figure 1 It can be seen that the lysosome targeting chimeras of Examples A1.1 to A1.4 can all reduce the content of PDL1 in tumor cells, which means that the lysosome targeting chimeras of the present invention have the ability to downregulate the level of PDL1. Secondly, as the amount of lysosome targeting chimeras increases, the efficiency of degrading PDL1 increases, among which the efficiency and dosage of PDL1 degradation in Examples A1.1, A1.2 and A1.3 are more highly correlated. The lysosome targeting chimeras of Example A1.4, whose dosage increases, cannot improve the degradation efficiency to a corresponding degree. It is speculated that the reason may be that too many nucleic acid aptamers are coupled to the antibodies, which will affect the recognition efficiency between the antibodies and PDL1, thereby interfering with the binding of the lysosome targeting chimeras and the target protein, and further affecting the efficiency of lysosome targeted dissolution.

[0073] In summary, the lysosome targeting chimera described in the present invention can cause a significant multivalent effect by increasing the number of nucleic acid aptamers connected to the antibody. Compared with connecting a single nucleic acid aptamer, the efficiency of the lysosome targeting chimera in degrading the target protein is significantly improved, and the target protein content can be downregulated at a lower dose, thereby enhancing the effect of anti-tumor immunotherapy.

[0074] Example B2: By adding different inhibitors, it was verified that the pathway for degrading PDL1 by the lysosome targeting chimera of the present invention is the lysosomal degradation pathway.

[0075] Experimental method: 10 5B16F10 cells were co-incubated with 50 nM of the lysosome targeting chimera of Example A1.2, and 5 μM of MG132 proteasome inhibitor or 100 μM of Chloroquine lysosome inhibitor was added. After 24 hours of co-incubation, the content of PDL1 protein on tumor cells was detected by western blot.

[0076] Blank control: cells were not treated in any way;

[0077] Comparative Example B2.1: B16F10 cells were co-incubated with the lysosome-targeting chimera of Example A1.2;

[0078] Example B2.2: B16F10 cells were co-incubated with the lysosome targeting chimera of Example A1.2 and the MG132 proteasome inhibitor;

[0079] Example B2.3: B16F10 cells were co-incubated with the lysosome targeting chimera of Example A1.2 and Chloroquine lysosomal inhibitor.

[0080] Figure 2 It is a protein blot of PDL1 of tumor cells in different groups in Example B2. The results show that the addition of proteasome inhibitors in Example B2.2 has no effect on the efficiency of the lysosome targeting chimera of Example A1.2 in degrading PDL1 protein; while in Example B2.3, the addition of lysosome inhibitors can significantly interfere with the degradation of PDL1 protein by the lysosome targeting chimera of Example A1.2, and almost no degradation of PDL1 can be achieved, indicating that the lysosome targeting chimera of the present invention achieves degradation of PDL1 through the lysosome pathway rather than the proteasome pathway.

[0081] Embodiment B3:

[0082] Experimental method: The method of Example B1 was followed, except that the multivalent lysosomal targeting chimera was from Example A1.2, and the concentrations were 2 nM, 5 nM, 10 nM, 50 nM, and 100 nM, respectively. Each group of samples was mixed with 10 5 B16F10 cells were co-incubated for 24 hours.

[0083] Experimental results: Figure 3It is a statistical graph of the PDL1 content after the cells were incubated for 24 hours at different sample concentrations in Example B3, wherein the abscissa is the concentration of the multivalent lysosome targeting chimera, and the ordinate is the relative content of PDL1 on the cell surface. The results show that as the concentration of the multivalent lysosome targeting chimera increases, the more PDL1 protein on the cell surface is degraded in the same time, indicating that the efficiency of degrading the PDL1 protein on the cell membrane surface by the high-concentration multivalent lysosome targeting chimera is higher. It also shows that the multivalent lysosome targeting chimera of the present invention has good uniformity, which can ensure the consistency of degradation efficiency and concentration.

[0084] Example B4: Experimental verification of the sustained effect of the lysosome-targeted chimera of the present invention in degrading PDL1.

[0085] Will be about 10 5 B16F10 cells were co-incubated with 50 nM of the lysosome-targeted chimera sample of Example A1.2, and the relative content of PDL1 protein on the cell membrane was detected at different time points (4 hours, 8 hours, 12 hours, 20 hours, and 30 hours). Figure 4 It is a statistical graph of the relative content of cell membrane PDL1 protein at different time points during the incubation process. The results show that within 12 hours, the content of PDL1 antibody is significantly downregulated. After about 12 hours, the PDL1 antibody is almost completely degraded. After 20 hours, the rate of downregulation of the content of PDL1 protein on the membrane surface of the sample decreases, and the relative content reaches a very low level, indicating that the lysosome targeting chimera of the present invention can achieve continuous downregulation of PDL1 antibody expression on the cell membrane surface and maintain the content of PDL1 at a low level, that is, the lysosome targeting chimera of the present invention can downregulate the PDL1 antibody on the cell membrane surface of the tumor in the organism for a long time, thereby achieving the effect of anti-tumor immunotherapy.

[0086] Example B5: The lysosome targeting chimera described in the present invention downregulates the level of PDL1 protein on the surface of tumor cells, which can cause cell apoptosis.

[0087] Since the intracellular part of PDL1 protein is also involved in signaling pathways such as cell proliferation and metastasis, it is speculated that degradation of cell membrane PDL1 can cause a decrease in tumor cell proliferation, and this example is designed to verify this.

[0088] Grouping:

[0089] Comparative Example B5.1: No treatment

[0090] Example B5.2: PDL1 Antibody

[0091] Example B5.3: Unconjugated PDL1 antibody and CI-M6PR nucleic acid aptamer

[0092] Example B5.4: Lysosomal targeting chimera of Example A1.2

[0093] Experimental method: About 10 5 B16F10 cells were incubated with different samples (to be supplemented at different concentrations) for 24 hours, and the proportion of apoptotic cells was detected by flow cytometry.

[0094] Figure 5 It is a statistical graph of the apoptosis ratio of different groups of cells in Example B5. The results show that the lysosome targeting chimera of the present invention can cause apoptosis of most tumor cells. That is, when the PDL1 protein on the cell membrane is degraded, it will directly lead to apoptosis of tumor cells. This phenomenon has never been reported in the prior art. It is unexpected that the lysosome targeting chimera of the present invention has the effect of inducing apoptosis of tumor cells. The lysosome targeting chimera with multivalent effect described in the present invention has a stronger targeted degradation efficiency than the lysosome targeting chimera in the prior art. Therefore, in addition to having an immune checkpoint blocking effect, it can also cause spontaneous apoptosis of tumor cells. The lysosome targeting chimera of the present invention has an unexpected technical effect.

[0095] Example B6: MTT assay

[0096] This example is used to explore the effective concentration of the multivalent lysosome targeting chimera.

[0097] B16F10 cells in the logarithmic phase were inoculated into a 96-well plate, with 10,000 cells in each well. After overnight culture, different samples of different concentrations were added for incubation. After 24 hours of incubation, the culture medium was removed, replaced with fresh culture medium, and MTT solution (1 mg / mL) was added. The cells were incubated for about 4 hours, the culture medium was removed, and 150 μL of dimethyl sulfoxide was added to each well to fully dissolve the crystals in the cells. Then, the absorbance of the OD value at 570 nm was detected using an enzyme-linked immunosorbent assay (ELISA). The cell survival rate was calculated as follows: survival rate = (absorbance of the experimental group / absorbance of the control group) × 100%.

[0098] Group Description:

[0099]

[0100]

[0101] Experimental results:

[0102] Figure 6It is a statistical diagram of the relative activity of cells in different groups in Example B6. The experimental results show that the relative survival rate of cells in the blank control group is 100%. Compared with the blank control group, the concentration of the multivalent targeting chimera sample increases, and the killing effect of the multivalent lysosome targeting chimera on tumor cells gradually increases in the same period of time. The half-inhibitory concentration (IC50) of the lysosome targeting chimera of the present invention is about 4.2nM. The smaller the IC50, the stronger the ability to kill tumor cells, indicating that the lysosome targeting chimera of the present invention has the effect of inducing tumor cell death.

[0103] The lysosome targeting chimera of the present invention has a multivalent effect, which greatly improves the degradation efficiency of PDL1 protein, and a large amount of PDL1 degradation leads to the death of tumor cells. Therefore, the lysosome targeting chimera of the present invention can not only achieve the complete removal of PDL1, cause immune checkpoint blockade, and enhance the effect of immune cells recognizing and killing tumor cells, but also directly lead to apoptosis of tumor cells, expose tumor-associated antigens, stimulate immune cells to enhance anti-tumor immune response, have multiple effects, and significantly enhance the effect of tumor treatment.

[0104] Example B7: To prove that the apoptosis of tumor cells caused by the lysosome targeting chimera of the present invention can enhance the immunogenicity of tumor cells, this example is designed to prove that after the action of the lysosome targeting chimera, the calreticulin on the surface of tumor cells increases.

[0105] Comparative Example B7.1: Blank Control

[0106] Comparative Example B7.2: Co-incubation of PDL1 antibody with tumor cells

[0107] Comparative Example B7.3: Unconjugated PDL1 antibody and CI-M6PR nucleic acid aptamer, co-incubated with tumor cells

[0108] Example B7.4: Co-incubation of the lysosome-targeting chimera of Example A1.2 with tumor cells

[0109] Experimental methods: dosage to be supplemented, detection method, etc.

[0110] The treated cells in different groups were labeled with calreticulin using a calreticulin detection kit, and the labeling method was carried out according to the instructions. Then, the cells were fixed with 4% paraformaldehyde and stained with Hoechst to mark the cell nucleus, and then the stained cells were examined with a laser confocal microscope.

[0111] The increase of calreticulin on the surface of tumor cells makes tumor cells easier to be recognized by immune cells, promotes tumor antigen presentation, causes immune activation effects, and then induces anti-tumor immune responses. Figure 7 This is a fluorescence signal image of cell surface calreticulin captured by laser confocal microscopy in Example B7.

[0112] Figure 7 The results show that the expression of calreticulin in the cells of Example B7.4 increased, indicating that the lysosome targeting chimera caused an increase in surface calreticulin in tumor cells, thereby helping immune cells to recognize tumor cells and enhancing the efficacy of anti-tumor immunotherapy.

[0113] In addition, ATP release is another indicator of the immunogenicity of tumor cells. The higher the ATP release, the stronger the immunogenicity.

[0114] Figure 8 It is a statistical graph of ATP release of cells in different groups in Example B7. The results show that after the lysosome targeting chimera of Example A1.2 acts on tumor cells, it can cause a significant increase in the amount of ATP released by tumor cells. The above released ATP and exposed reticular protein are damage-associated molecular patterns (DAMPs), which are positively correlated with the immunogenicity of tumor cells, indicating that the lysosome targeting chimera of the present invention can enhance the immunogenicity of tumor cells. The enhanced immunogenicity of tumor cells will cause a strong anti-tumor immune response. Therefore, the lysosome targeting chimera of the present invention can cause a strong anti-tumor immune response, thereby achieving the purpose of anti-tumor immunotherapy.

[0115] Example B8: The apoptotic cell products in Example 9 were used to stimulate the maturation of bone marrow-derived dendritic cells (BMDC).

[0116] Grouping:

[0117] Comparative Example B8.1: The apoptotic products of Comparative Example B7.1 were co-incubated with bone marrow-derived dendritic cells

[0118] Comparative Example B8.2: The apoptotic products of Comparative Example B7.2 were co-incubated with bone marrow-derived dendritic cells

[0119] Example B8.3: Co-incubation of apoptotic products of Example B7.4 with bone marrow-derived dendritic cells

[0120] Experimental methods:

[0121] Bone marrow cells were isolated from the femur and tibia of male C57BL / 6 mice, and medium containing granulocyte macrophage colony stimulating factor (GM-CSF, concentration 20 ng / mL) and interleukin-4 (IL-4, concentration 10 ng / mL) was added to culture the isolated bone marrow cells. After 5 days of culture, a small amount of cells were taken to test the maturity by CD11c flow antibody staining to confirm that the myeloid cells had differentiated into DC cells. At the same time, B16F10 tumor cells were co-incubated with different samples (50nM) for 48 hours, and then the tumor cells treated with different samples were co-incubated with DC cells in a 1:1 ratio for 3 days. Finally, DC cells were collected and the expression of CD80 and CD86 of DC cells was determined by flow cytometry. CD80 and CN86 are key markers for the maturation of DC cells, and cells with double positive CD80 and CD86 are mature myeloid DC cells.

[0122] Bone marrow-derived dendritic cells are the most powerful antigen-presenting cells discovered so far, and they are the only antigen-presenting cells that can significantly stimulate the proliferation of naive T cells. Therefore, dendritic cells are a key link in the initiation of adaptive T cell immune responses in organisms and play a very important role in tumor immunotherapy. The maturity ratio of dendritic cells will affect the degree of subsequent anti-tumor immune response. The higher the maturity, the stronger the expected anti-tumor immune response.

[0123] Fig. 9 It is a statistical graph of the maturation ratio of dendritic cells in different groups in Example B8. The results show that the apoptotic products of Example B7.4 can induce the maturation of bone marrow-derived dendritic cells, indicating that the lysosome-targeted chimera of the present invention can induce an anti-tumor immune response and achieve anti-tumor immunotherapy at the in vivo level.

[0124] Example C1: Animal experiments have demonstrated that the lysosome-targeted chimera of the present invention can induce anti-tumor immune responses and inhibit tumor growth and metastasis.

[0125] The mice were inoculated with tumor cells (about 5×10 5 B16F10 cells), and wait until the tumor grows to 25 mm 3 , random grouping, the grouping is as follows:

[0126] Comparative Example C1.1: Blank control group, no treatment of mouse tumors

[0127] Comparative Example C1.2: Tumor-bearing mice treated with PDL1 antibody

[0128] Example C1.3: Tumor-bearing mice were treated with a mixture of PDL1 antibody and M6PR nucleic acid aptamer, with a dosage ratio of PDL1 antibody to M6PR nucleic acid aptamer of 1:6

[0129] Example C1.4: Treatment of tumor-bearing mice with the lysosome-targeted chimera of Example A1.2

[0130] Experimental methods:

[0131] Comparative Example C1.2, Example C1.3, Example C1.4 were intravenously injected with 20 μg of PDL1 antibody or LYTAC (quantified by PDL1) once every 3 days for a total of 4 times. The changes in tumor volume were recorded and tumor growth curves were prepared. The results are shown in FIG. Fig.10 shown.

[0132] Experimental results: Fig.10 It is a graph of tumor growth of mice in different groups in Example C1. The results show that the traditional immune checkpoint blockade therapy used in Comparative Example C1.2 cannot inhibit tumor growth well. In Example C1.3, only the nucleic acid aptamer of the lysosome targeting receptor is mixed with the PDL1 antibody, and its effect is no different from the immune checkpoint blockade therapy alone. In Example C1.4, the lysosome targeting chimera described in the present invention is used for treatment, which has a significant effect of inhibiting tumor growth. It shows that the lysosome targeting chimera described in the present invention has an application prospect of inducing anti-tumor treatment in vivo, and has a good therapeutic effect. The lysosome targeting chimera described in the present invention can be administered intravenously, and the administration method is convenient and efficient.

[0133] Example D: Study on the efficiency of multivalent lysosomal targeting chimeras linked to other molecules and their protein degradation.

[0134] According to the preparation method of Example A2, a variety of multivalent lysosome-targeting chimeras were prepared, all of which had the effect of degrading the target protein, and the degradation efficiency was better than that of the monovalent lysosome-targeting chimeras.

[0135]

[0136]

[0137] Obviously, the above embodiments are merely examples for clear description and are not limitations of the implementation methods.

[0138] Although the above disclosure discusses some of the invention embodiments currently considered useful through various examples, it should be understood that such details are for illustrative purposes only, and the appended claims are not limited to the disclosed embodiments. On the contrary, the claims are intended to cover all modifications and equivalent combinations that are consistent with the essence and scope of the embodiments of the present application.

[0139] Similarly, it should be noted that in order to simplify the description of the disclosure of this application and thus help understand one or more embodiments of the invention, in the above description of the embodiments of this application, multiple features are sometimes combined into one embodiment, figure or description thereof. However, this disclosure method does not mean that the features required by the object of this application are more than the features mentioned in the claims. In fact, the features of the embodiments are less than all the features of the single embodiment disclosed above.

[0140] In some embodiments, numbers describing the number of components and attributes are used. It should be understood that such numbers used in the description of the embodiments are modified by the modifiers "about", "approximately" or "substantially" in some examples. Unless otherwise specified, "about", "approximately" or "substantially" indicate that the numbers are allowed to vary by ±. Accordingly, in some embodiments, the numerical parameters used in the specification and claims are approximate values, which may vary according to the required features of individual embodiments.

[0141] Finally, it should be understood that the embodiments described in this application are only used to illustrate the principles of the embodiments of the present application. Other variations may also fall within the scope of the present application. Therefore, as an example and not a limitation, the alternative configurations of the embodiments of the present application may be considered to be consistent with the teachings of the present application. Accordingly, the embodiments of the present application are not limited to the embodiments explicitly introduced and described in the present application.

Claims

1. A multivalent lysosomal targeting chimera, characterized in that The multivalent lysosome targeting chimera comprises the following structure: a target protein recognition structure and a lysosomal shuttle receptor recognition structure connected by a connecting molecule, and the molar ratio n of the lysosomal shuttle receptor recognition structure to the target protein recognition structure is greater than 1.

2. The multivalent lysosomal targeting chimera according to claim 1, characterized in that: 1 <n≤15。 3. The multivalent lysosomal targeting chimera according to claim 1, characterized in that: The linker molecule is a molecule that is not degradable in the tumor microenvironment.

4. The multivalent lysosomal targeting chimera according to claim 1, characterized in that: The lysosomal shuttle receptor recognition structure or the target protein recognition structure is connected to the connecting molecule through a flexible segment or directly.

5. The multivalent lysosomal targeting chimera according to claim 4, characterized in that: The flexible chain segment is selected from one or more of polyethylene glycol, carbon chain and base chain.

6. The multivalent lysosomal targeting chimera according to claim 1, characterized in that The connecting molecule contains at least one of the following structures: an amide bond, a triazole ring, a thioether bond, and a disulfide bond.

7. The multivalent lysosomal targeting chimera according to claim 6, characterized in that The linker molecule contains at least one of the following structures:

8. The multivalent lysosomal targeting chimera according to claim 1, characterized in that: The target protein recognition structure includes PDL1 antibody, HER2 antibody, platelet-derived growth factor antibody, protein tyrosine kinase 7 antibody, mesenchymal epithelial transition factor antibody, G protein coupled receptor 65 antibody, CD47 antibody, CD71 antibody, EGFR antibody, and ABCG2 antibody.

9. The multivalent lysosomal targeting chimera according to claim 1, characterized in that: The lysosomal shuttle receptor recognition structure includes one or more of CI-M6PR nucleic acid aptamer, ASGPR nucleic acid aptamer, transferrin receptor nucleic acid aptamer, and poly-oligonucleotide.

10. Use of the multivalent lysosome targeting chimera according to any one of claims 1 to 9 in the preparation of a protein degrader or an immunotherapeutic drug.

Images