Shank3 gene knockout mouse model as well as construction method and application thereof

Abstract

The invention provides a Shank3 gene knockout mouse model as well as a construction method and application thereof, and belongs to the technical field of biomedicine. According to the CRISPR / Cas9 gene editing system provided by the invention, complete knockout of the whole Shank3 gene can be realized, and the CRISPR / Cas9 gene editing system can be used for constructing a Shank3 gene complete knockout model. In a mouse model provided by the invention, due to the complete knockout of the whole Shank3 gene, the homozygote has no Shank3 protein expression, and the heterozygote expression quantity is also reduced compared with that of a WT type, so that the Shank3 gene has important significance in functional development of the Shank3 gene or research of related diseases. The mouse model provided by the invention is applied to research on autism spectrum disorder, has higher similarity with the SHANK3 gene defect degree of a human autism spectrum disorder (ASD) patient, can be more properly used for simulating possible clinical phenotypes of human diseases, and has a wider application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a Shank3 gene knockout mouse model and a construction method and application thereof. Background Art

[0002] The Shank3 gene encodes a postsynaptic scaffold protein that is mainly present in the postsynaptic density (PSD) of neurons and plays an important role in the formation, maturation and maintenance of synapses. Mutations or deletions of the Shank3 gene are closely associated with a variety of neurodevelopmental disorders, such as ASD, schizophrenia and intellectual disability. The deletion or mutation of the Shank3 gene is considered to be one of the important pathogenic factors of ASD. Mouse models can provide unique insights into the basic biological mechanisms of ASD, but the development of existing related models has certain defects.

[0003] A variety of subtype-specific Shank3 mouse models have been disclosed in the prior art, however, multiple intragenic promoters and alternatively spliced ​​exons are responsible for the formation of many subtypes, and the existing Shank3 gene knockout models are mostly partial exon knockouts, most of which only destroy some subtypes, and there may be residual expression of Shank3 protein. In contrast, the vast majority of known SHANK3 mutations found in patients involve deletions that destroy all subtypes, affecting the comprehensive understanding of gene function and disease mechanisms. Due to multiple intragenic promoters and alternatively spliced ​​coding exons within the gene, point mutations usually lead to limited disruption of SHANK3 subtype-specific expression. However, the vast majority of SHANK3 mutations found in ASD are deletions of the entire gene, and most patients carrying 22q13.3 deletions or deletions of the entire SHANK3 gene in Phelan-McDermid syndrome (PMS) are diagnosed with ASD.

[0004] Prior art 1 discloses a gene knockout strategy that uses traditional gene knockout technology and homologous recombination to introduce mutations into the Shank3 gene, resulting in partial gene inactivation (hemizygous) (Bozdagi O, et al., Haploinsufficiency of the autism-associated Shank3 gene leads to deficits insynaptic function, social interaction, and social communication. Mol Autism. 2010; 1(1): 15), but it is mainly based on a hemizygous deletion model, which is only partially inactivated, which is not completely consistent with the degree of gene defects in human autism spectrum disorder (ASD) patients and may not be able to fully simulate the phenotype of human diseases. In addition, the model only simulates one type of gene defect and fails to cover the behavioral and functional changes caused by other types of mutations or deletions in the Shank3 gene.

[0005] Prior art 2 discloses an improved mouse model, which completely knocks out the Shank3 gene to simulate some behavioral phenotypes of Phelan-McDermid syndrome (PMS) (Drapeau E, et al., Behavioral Phenotyping of an Improved Mouse Model of Phelan-McDermid Syndrome with a Complete Deletion of the Shank3 Gene. eNeuro. 2018 May-Jun; 5(3): ENEURO.0046-18.201). However, it is still a deletion of exons 4-22, which does not fully reflect the diversity of human PMS patients. The degree and impact of gene deletion in these patients may have a large variability, so this model may not cover all possible clinical phenotypes. Summary of the invention

[0006] The purpose of the present invention is to provide a Shank3 gene knockout mouse model and a construction method and application thereof, which can achieve complete knockout of the entire Shank3 gene, and the constructed model has better application prospects.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a sgRNA for targeted knockout of the mouse Shank3 gene, including sgRNA-1 and sgRNA-2;

[0009] The nucleotide sequence of the sgRNA-1 is shown in SEQ ID NO.1;

[0010] The nucleotide sequence of the sgRNA-2 is shown in SEQ ID NO.2.

[0011] The present invention also provides a CRISPR / Cas9 system for targeted knockout of the mouse Shank3 gene, wherein the CRISPR / Cas9 system comprises the above-mentioned sgRNA.

[0012] The present invention also provides a kit for targeted knockout of the mouse Shank3 gene, wherein the kit comprises the above-mentioned CRISPR / Cas9 system.

[0013] The present invention also provides the use of the CRISPR / Cas9 system or the kit in preparing a cell line for knocking out the mouse Shank3 gene.

[0014] The present invention also provides the use of the CRISPR / Cas9 system or the kit in preparing a Shank3 gene knockout mouse model.

[0015] The present invention also provides a method for constructing a Shank3 gene knockout mouse model, comprising the following steps:

[0016] The CRISPR / Cas9 system for targeted knockout of the Shank3 gene in mice was transfected into mouse fertilized eggs, and fertilized eggs of Shank3 gene knockout mice were obtained through positive screening to obtain a Shank3 gene knockout mouse model.

[0017] Preferably, the method further comprises the following steps:

[0018] Cultivating the fertilized eggs of the Shank3 gene knockout mice to obtain F0 mice;

[0019] F0 mice were crossed with wild-type mice, and homozygous and heterozygous mice were obtained through multiplication and propagation;

[0020] The F0 mice, homozygous mice or heterozygous mice are used as Shank3 gene knockout mouse models.

[0021] The present invention also provides a Shank3 gene knockout mouse model obtained by the construction method.

[0022] The present invention also provides the use of the Shank3 gene knockout mouse model as a research material for autism spectrum disorders, schizophrenia or intellectual disability.

[0023] The present invention also provides a method for identifying a double sgRNA site-targeted knockout of the Shank3 gene in mice, comprising the following steps:

[0024] Extract genomic DNA from cells to be tested;

[0025] Using the genomic DNA as a template, performing PCR amplification with an amplification primer pair, and detecting the obtained PCR amplification product;

[0026] If the length of the genomic fragment after gene knockout is 76 kb compared with the wild type, the double sgRNA site-targeted knockout of the mouse Shank3 gene is achieved;

[0027] In the amplification primer pair, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4;

[0028] The dual sgRNA site includes sgRNA-1 and sgRNA-2;

[0029] The nucleotide sequence of the sgRNA-1 is shown in SEQ ID NO.1;

[0030] The nucleotide sequence of the sgRNA-2 is shown in SEQ ID NO.2.

[0031] Beneficial effects of the present invention:

[0032] The CRISPR / Cas9 gene editing system provided by the present invention can achieve complete knockout of the entire Shank3 gene, and can be used to construct a model for complete knockout of the Shank3 gene.

[0033] In the Shank3 KO mouse model provided by the present invention, due to the complete knockout of the entire Shank3 gene, the homozygotes no longer express Shank3 protein, and the expression level of the heterozygotes is also lower than that of the WT type, which is of great significance in the functional development of the Shank3 gene or the research of related diseases.

[0034] The Shank3 gene knockout mouse model provided by the present invention is used in the study of autism spectrum disorders, which can cover a variety of phenotypes such as homozygous and heterozygous, and has a higher degree of similarity with the gene defects of human autism spectrum disorder (ASD) patients, can be more appropriately used to simulate possible clinical phenotypes of human diseases, and has a wider application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Schematic diagram of the design scheme for identification primers;

[0036] Figure 2 This is the result of the identification of the tail genotype of F0 generation mice;

[0037] Figure 3Schematic diagram of the Shank3 mouse propagation and generation scheme;

[0038] Figure 4 This is the result of Western Blot verification of Shank3 protein expression. DETAILED DESCRIPTION

[0039] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0040] Gene information targeted in the embodiment:

[0041] The mouse Shank3 gene is located on the positive strand of chromosome 15, with a total length of 67.5 kb, NCBI ID: 58234.

[0042] The mouse Shank3 gene has 10 transcripts, and the examples of the present invention refer to transcript 203.

[0043] Example

[0044] The Enhanced Genome Editing (EGE) system in CRISPR / Cas9 gene editing technology is used to construct a small model to improve editing efficiency and accuracy. In the present invention, sgRNAs are designed before Shank3 Exon1 and after Exon22, respectively, resulting in a genome deletion of approximately 76kb, thereby achieving the purpose of Shank3 gene knockout.

[0045] The mouse strain in this example is C57BL / 6J.

[0046] Model preparation:

[0047] 1. Sequencing confirmation of target sequence: The target gene DNA sequences of different strains may be different. In order to ensure the correctness of the designed Cas9 / sgRNA, the C57BL / 6J mouse tail target gene DNA sequence was first amplified by PCR and sequenced for verification. The verification results showed that the sgRNA target sequence was completely consistent with the standard sequence given in the Genebank database.

[0048] 2. Cas9 / sgRNA design: Based on the design principles of sgRNA, one sgRNA was designed in the 5' target site and one in the 3' target site, and the corresponding targeting sequences are as follows (5'-3'):

[0049] 5'Guide#1: GGGTGGACCCCTCCGTGCTTGGG, as shown in SEQ ID NO.1.

[0050] 3'Guide#2: TGGTCGTGGGGATCACGAGCTGG, as shown in SEQ ID NO.2.

[0051] 3. Preparation of RNA for Cas9 / sgRNA: Shank3-sgRNA1, Shank3-sgRNA2 and Cas9 were transcribed in vitro using a commercial kit (mMESSAGE T7Ultra Kit, catalog number AM1345). In vitro transcription was performed in a PCR instrument, incubated at 37°C for 6 h (the temperature of the hot cover of the PCR instrument was set to 50°C. After the reaction, 1.5 μL DNase was added to each tube to remove the template DNA), and the reaction was carried out at 37°C for 30 min to remove all DNA. 1 μL of the product was taken for electrophoresis and the bands were observed.

[0052] 4. Microinjection of Cas9 / sgRNA: Injection solution ratio: The ratio content is 100ng / μL Cas9 mRNA and 200ng / μL sgRNA. Cas9 / sgRNA is microinjected into mouse fertilized eggs.

[0053] 5. Genotype identification of F0 generation mice

[0054] 5.1 Identification primer design: Design scheme as follows Figure 1 shown.

[0055] The primer information is shown in Table 1 below:

[0056] Table 1 Identification primer information

[0057]

[0058] PCR conditions:

[0059] Enzyme: 2x Taq Plus Master Mix II (Dye Plus)

[0060]

[0061] 5.2 Identification of the genotype of the tail of F0 mice

[0062] Primers used: Shank3-WT-F / Shank3-Mut-R

[0063] The identification results are as follows Figure 2 shown.

[0064] 6. Identification and propagation of Shank3 mice

[0065] The genotype identification method and primers were the same as those of the F0 generation.

[0066] The passaging scheme is as follows Figure 3 shown.

[0067] 7. Genotype identification of F6 generation adult mice

[0068] Verification of Shank3 protein expression by Western Blot:

[0069] 1. Adult Mouse Brain Protein Extraction

[0070] 1) Obtain the mouse brain tissue by decapitation, then wash away the blood in PBS buffer, place the brain tissue on filter paper soaked in PBS, separate and weigh each brain region.

[0071] 2) Add 100 μl of RIPA lysis buffer containing protease inhibitors for every 20 mg (the ratio of lysis buffer to protease inhibitors is 100:1), put 2 3 mm grinding beads, grind in a grinder, set the parameters to 60 Hz, 60 s, and grind thoroughly. Then place on ice for 30 minutes. Centrifuge at 13000g, 4℃ for 15 minutes, and aspirate the supernatant into a new EP tube.

[0072] 2. BCA quantitative determination of protein concentration

[0073] 1) Prepare BSA standard: dilute 20mg protein standard with 800μl protein preparation solution to prepare 25mg / ml standard solution, take an appropriate amount and make it into 0.5mg / ml concentration with PBS. Take 0μl, 1μl, 2μl, 4μl, 8μl, 12μl, 16μl, 20μl of 0.5mg / ml standard respectively, add 20μl, 19μl, 18μl, 16μl, 12μl, 8μl, 4μl, 0μl of PBS buffer respectively to make up, that is, prepare 0μg / ml, 25μg / ml, 50μg / ml, 100μg / ml, 200μg / ml, 300μg / ml, 400μg / ml, 500μg / ml standard.

[0074] 2) The protein was diluted 10 times, and two replicate wells were set for both the sample and the protein standard.

[0075] 3) Prepare BCA assay working solution A:B=50:1, add 200 μl / well of working solution to each well, mix carefully by pipetting, and incubate at 37°C incubator for 30 min (samples can be loaded when they turn purple).

[0076] 4) Measure the absorbance at A562nm with an enzyme-labeled instrument, draw a standard curve, and calculate the total protein concentration of the sample.

[0077] 5) Calculate the actual protein concentration according to the dilution multiple and dilute each tube of protein to the same concentration with PBS.

[0078] 6) Add 5X loading buffer to each tube of protein sample to make the final concentration 1X, and mix well by pipetting. Boil the protein in a metal bath at 95℃ for 5 minutes to denature it. After denaturation, immediately place it on ice, centrifuge it at 4℃, 12000g, for 5 minutes, and store it at -80℃ or use it for the next experiment.

[0079] 3. Electrophoresis

[0080] Place the precast gel in the electrophoresis tank and add sufficient MOPS electrophoresis buffer. Take out the comb vertically and add the protein sample and pre-stained color protein marker of appropriate size into the gel tank. The sample volume should not exceed 15μl. Cover the electrophoresis tank and run the electrophoresis at a constant voltage of 130V for 1 hour.

[0081] 4. Transfer

[0082] After electrophoresis, the PVDF membrane was activated by soaking in methanol. The transfer clip was placed in the transfer tank, and the membrane was transferred using a fast transfer buffer at a constant current of 400 mA for 35 minutes.

[0083] 5. Closure

[0084] Block the cells with 5% milk diluted in TBST for 1 hour at room temperature.

[0085] 6. Antibody incubation and development

[0086] Dilute the antibody with Western primary antibody diluent and incubate overnight on a shaker at 4 degrees. Wash the membrane three times with TBST the next day, 10 minutes each time. Dilute the secondary antibody with western secondary antibody diluent, shake at 40-60rpm, incubate at room temperature for 1 hour, and wash the membrane three times with TBST again, 10 minutes each time. Let the membrane dry slightly, absorb the ECL luminescent solution, incubate in the dark for 1 minute, and put it into the instrument for exposure.

[0087] 7. ImageJ software was used for grayscale quantitative analysis of protein bands.

[0088] Note: Antibody: SHANK3 (sc-377088, 180kDa)

[0089] The results are as follows Figure 4 As shown, the results showed that Shank3 homozygous mice (- / -) had no expression of SHANK3 in various brain regions, indicating that the technical solution provided by the present invention achieved complete knockout of the entire Shank3 gene in the mouse model.

[0090] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A sgRNA for targeting and knocking out the Shank3 gene in mice, characterized in that: Includes sgRNA-1 and sgRNA-2; The nucleotide sequence of the sgRNA-1 is shown in SEQ ID NO.1; The nucleotide sequence of the sgRNA-2 is shown in SEQ ID NO.

2.

2. A CRISPR / Cas9 system for targeted knockout of the Shank3 gene in mice, characterized in that: The CRISPR / Cas9 system comprises the sgRNA according to claim 1.

3. A kit for targeted knockout of the Shank3 gene in mice, characterized in that: The kit comprises the CRISPR / Cas9 system according to claim 2.

4. Use of the CRISPR / Cas9 system according to claim 2 or the kit according to claim 3 in preparing a cell line for knocking out the mouse Shank3 gene.

5. Use of the CRISPR / Cas9 system according to claim 2 or the kit according to claim 3 in preparing a Shank3 gene knockout mouse model.

6. A method for constructing a Shank3 gene knockout mouse model, characterized in that: The following steps are involved: The CRISPR / Cas9 system for targeted knockout of the Shank3 gene in mice according to claim 2 is transfected into mouse fertilized eggs, and fertilized eggs of Shank3 gene knockout mice are obtained through positive screening to obtain a Shank3 gene knockout mouse model.

7. The method for constructing a Shank3 knockout mouse model according to claim 6, characterized in that: The following steps are also included: Cultivating the fertilized eggs of the Shank3 gene knockout mice to obtain F0 mice; F0 mice were crossed with wild-type mice, and homozygous and heterozygous mice were obtained through multiplication and propagation; The F0 mice, homozygous mice or heterozygous mice are used as Shank3 gene knockout mouse models.

8. A Shank3 gene knockout mouse model obtained by the construction method according to claim 6 or 7.

9. Use of the Shank3 gene knockout mouse model according to claim 8 as research material for autism spectrum disorders, schizophrenia or intellectual disability.

10. A method for identifying a double sgRNA site-targeted knockout of the Shank3 gene in mice, characterized in that: The following steps are involved: Extract genomic DNA from cells to be tested; Using the genomic DNA as a template, performing PCR amplification with an amplification primer pair, and detecting the obtained PCR amplification product; If the length of the genomic fragment after gene knockout is 76 kb compared with the wild type, the double sgRNA site-targeted knockout of the mouse Shank3 gene is achieved; In the amplification primer pair, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4; The dual sgRNA site includes sgRNA-1 and sgRNA-2; The nucleotide sequence of the sgRNA-1 is shown in SEQ ID NO.1; The nucleotide sequence of the sgRNA-2 is shown in SEQ ID NO.2.

Images