Molecular marker nucleic acid combination for primary liver cancer, kit and application of molecular marker nucleic acid combination

Abstract

The invention discloses a molecular marker nucleic acid combination for primary liver cancer, a kit and application thereof, and belongs to the technical field of gene detection. By detecting the methylation level of the CpG site in the sequence of the chr6: 26250425-26250945 region, whether the target sample is the primary liver cancer or not can be identified. The methylation of the CpG site in the region has good sensitivity and specificity for the detection or diagnosis of the primary liver cancer, and can be used for distinguishing a liver cancer sample, a healthy sample and a liver benign disease sample. A good molecular marker is provided for early screening of liver cancer, the detection rate of early liver cancer of a blood sample can be remarkably increased, and due to noninvasiveness of liquid biopsy, the molecular marker is suitable for large-scale popularization and application, so that the morbidity and mortality of hepatocellular carcinoma are reduced.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and in particular relates to a molecular marker nucleic acid combination, a kit and applications thereof for primary liver cancer. Background Art

[0002] Liver cancer ranks among the top cancers in terms of morbidity and mortality, with more than 900,000 new cases and more than 800,000 deaths worldwide each year. Hepatocellular carcinoma (HCC) is the most common primary liver cancer, accounting for 90% of liver cancer cases, and usually occurs in patients with chronic liver disease, such as cirrhosis caused by hepatitis B or C virus infection. Worldwide, 350 million people have chronic viral hepatitis infection and 50 million have cirrhosis, and these people are at increased risk of liver cancer. Patient survival rates depend largely on the stage of the disease at diagnosis.

[0003] The five-year survival rate for advanced liver cancer is less than 5%. According to the "Guidelines for Stratified Screening and Monitoring of Primary Liver Cancer (2020)", the 5-year overall survival rate for patients with stage 0 or stage A liver cancer can be as high as 69.0%-86.2%. Risk stratification of patients at risk for liver cancer and the use of different monitoring methods can help detect cancer earlier. The current detection method for high-risk populations is abdominal ultrasound imaging with or without alpha-fetoprotein (AFP). About half of patients with advanced HCC have high levels of AFP, a glycoprotein produced in early fetal development that is also produced in the liver and various tumors (including HCC). However, compared with advanced disease, the screening sensitivity of these tests for early disease ranges from 47%-84%, and the specificity ranges from 67%-90% or more. Therefore, there is a great need to develop available and sensitive non-invasive HCC screening methods.

[0004] In recent years, liquid biopsy technology based on molecular diagnostic technologies such as PCR and NGS, which uses non-solid biological tissues as specimens for sampling, has developed rapidly. It has broad application prospects in the field of early cancer screening and is also a hot spot for genetic testing research institutions and manufacturers at home and abroad. Methylation is a way of regulating gene expression. In tumor cells, demethylation of genes related to rapid tumor growth and methylation of tumor suppressor genes often occur. Changes in methylation often occur in the early stages of cancer, so clues to cancer can be found at a very early stage. Existing technologies show that circulating tumor DNA (ctDNA) in the blood is highly consistent with DNA in tumor tissue. According to the "Expert Consensus on Early Screening Strategies for Liver Cancer in China (2021)", liquid biopsies with cfDNA methylation information as the main marker show good early screening performance.

[0005] Currently, there are few blood markers for hepatocellular carcinoma reported, and their sensitivity and accuracy are low. Summary of the invention

[0006] The purpose of the present invention is to provide a molecular marker nucleic acid combination for primary liver cancer. The inventor can identify whether the target sample is primary liver cancer by detecting the methylation level of the CpG site in the chr6:26250425-26250945 region (hg38 human reference genome) sequence. When the target sample is primary liver cancer, the CpG site in the above region is a high methylation level; when the target sample is a healthy person sample or a benign liver disease sample, the CpG site in the above region is a low methylation level. The methylation of the CpG site in the above region has good sensitivity and specificity for the detection or diagnosis of primary liver cancer, and can be used to distinguish liver cancer samples, healthy samples, and benign liver disease samples.

[0007] The present invention provides a good molecular marker for early screening of liver cancer, which can significantly improve the detection rate of early liver cancer in blood samples. In view of the non-invasive nature of liquid biopsy, it is suitable for large-scale promotion and application, thereby reducing the incidence and mortality of hepatocellular carcinoma.

[0008] The present invention is achieved through the following technical solutions:

[0009] A molecular marker nucleic acid combination for primary liver cancer, wherein the molecular marker nucleic acid combination is a combination of nucleic acid molecules located at CpG sites in the chr6:26250425-26250945 region sequence;

[0010] The region is from the hg38 human reference genome.

[0011] Preferably, the molecular marker nucleic acid combination is a nucleic acid molecule containing at least one CpG site in at least one region of the following five regions: region 1, region 2, region 3, region 4 and region 5;

[0012] The region 1 is chr6:26250435-26250563; the region 2 is chr6:26250469-26250577; the region 3 is chr6:26250563-26250692; the region 4 is chr6:26250594-26250753; and the region 5 is chr6:26250696-26250942.

[0013] Preferably, the nucleic acid combination is any one or more of the nucleic acid combination 1 for detecting the region 1, the nucleic acid combination 2 for detecting the region 2, the nucleic acid combination 3 for detecting the region 3, the nucleic acid combination 4 for detecting the region 4, and the nucleic acid combination 5 for detecting the region 5;

[0014] The nucleic acid combination 1 includes a primer combination 1, the nucleic acid combination 2 includes a primer combination 2, the nucleic acid combination 3 includes a primer combination 3, the nucleic acid combination 4 includes a primer combination 4, and the nucleic acid combination 5 includes a primer combination 5.

[0015] Preferably, the base sequence of the primer combination 1 has at least 90% identity with the base sequence shown in SEQ ID NO.1-2;

[0016] The base sequence of the primer combination 2 has at least 90% identity with the base sequence shown in SEQ ID NO.4-5;

[0017] The base sequence of the primer combination 3 has at least 90% identity with the base sequence shown in SEQ ID NO.7-8;

[0018] The base sequence of the primer combination 4 has at least 90% identity with the base sequence shown in SEQ ID NO.10-11;

[0019] The base sequence of the primer combination 5 has at least 90% identity with the base sequence shown in SEQ ID NO.13-14.

[0020] Preferably, the nucleic acid combination 1 further includes probe 1, the nucleic acid combination 2 further includes probe 2, the nucleic acid combination 3 further includes probe 3, the nucleic acid combination 4 further includes probe 4, and the nucleic acid combination 5 further includes probe 5;

[0021] The base sequence of the probe 1 has at least 90% identity with the base sequence shown in SEQ ID NO.3;

[0022] The base sequence of the probe 2 has at least 90% identity with the base sequence shown in SEQ ID NO.6;

[0023] The base sequence of the probe 3 has at least 90% identity with the base sequence shown in SEQ ID NO.9;

[0024] The base sequence of the probe 4 has at least 90% identity with the base sequence shown in SEQ ID NO.12;

[0025] The base sequence of the probe 5 has at least 90% identity with the base sequence shown in SEQ ID NO.15.

[0026] The invention discloses an application of a molecular marker nucleic acid combination for primary liver cancer in the preparation of a detection product, comprising the nucleic acid combination.

[0027] Preferably, the detection product comprises any one of a reagent, a kit, a chip and a sequencing library.

[0028] The reagent can be in the form of freeze-dried powder, solution, suspension, emulsion, etc.

[0029] Preferably, the detection is performed by at least one of the following methods: methylation-specific PCR method, sequencing method, methylation-specific high-performance liquid chromatography method, digital PCR method, methylation-specific high-resolution melting curve method, methylation-specific microarray method, methylation-sensitive restriction endonuclease method and flap endonuclease method.

[0030] A primary hepatocellular carcinoma detection kit comprises the nucleic acid combination, a positive control, a negative control, a detection primer of an internal reference gene, a detection probe of an internal reference gene, a DNA polymerase and a buffer.

[0031] The detection samples of the kit are ex vivo blood samples or ex vivo tissue samples and ex vivo leukocyte samples.

[0032] Compared with the prior art, the present invention has at least the following technical effects:

[0033] (I) The present invention provides a molecular marker nucleic acid combination for primary liver cancer. The inventors can identify whether a target sample is primary liver cancer by detecting the methylation level of CpG sites in the sequence of the chr6:26250425-26250945 region (hg38 human reference genome).

[0034] When the target sample is primary liver cancer, the CpG sites in the above region are at a high methylation level; when the target sample is a healthy person sample or a benign liver disease sample, the CpG sites in the above region are at a low methylation level.

[0035] (ii) The methylation of CpG sites in the above-mentioned region has good sensitivity and specificity for the detection or diagnosis of primary liver cancer, and can be used to distinguish liver cancer samples, healthy samples and benign liver disease samples.

[0036] (III) The present invention provides a good molecular marker for early screening of liver cancer, which can significantly improve the detection rate of early liver cancer in blood samples. In view of the non-invasive nature of liquid biopsy, it is suitable for large-scale promotion and application, thereby reducing the incidence and mortality of hepatocellular carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 is a research and development flow chart of mining and screening of methylation markers for detecting liver cancer in Example 1;

[0038] Figure 2This is the ROC diagram of the detection of the methylation marker in Example 3 in the ex vivo blood sample of liver cancer. DETAILED DESCRIPTION

[0039] The embodiments of the present invention will be described in detail below in conjunction with examples. However, those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. The specific conditions not specified in the examples are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0040] Example 1: Screening process for methylation markers for liver cancer detection

[0041] This embodiment discloses a methylation marker composition for detecting early liver cancer and a screening process thereof. The specific process is as follows Figure 1 As shown,

[0042] In order to mine and screen methylation markers with excellent detection performance, this example first uses a customized hybrid capture large panel for targeted methylation sequencing. The hybrid capture panel covers 3.98 million CpG methylation sites in the human genome, including most of the CpG island regions and genes related to cancer occurrence, with a coverage range 10 times that of traditional DNA methylation chips. By performing targeted sequencing on 82 clinical frozen tissue samples and 115 ex vivo blood samples and comparing the changes in methylation patterns of cancer and non-cancer groups, this example preliminarily identified 30,008 methylation sites that can clearly distinguish cancer and non-cancer samples in both tissue and blood samples as potential cancer markers.

[0043] Furthermore, a hybrid capture panel was designed based on the 30,008 methylation sites initially screened above for the second round of targeted methylation sequencing. This round of sequencing adopted a deep sequencing strategy, with an average sequencing depth of 500X, which significantly improved the accuracy of methylation level calculation and facilitated the accurate screening of markers in the second round.

[0044] By performing targeted methylation sequencing on ex vivo plasma samples from 218 clinical liver cancer patients and 196 ex vivo plasma samples from non-cancer groups, univariate statistical analysis and machine learning methods were used to accurately screen out 12 DNA methylation markers with the best performance for liver cancer detection.

[0045] Finally, the primer and probe nucleic acid combination of the qPCR detection platform was designed for the genomic regions of the 12 methylation markers screened, and the performance of liver cancer detection was verified on the qPCR platform through the in vitro plasma samples of 32 clinical liver cancer patients and 47 in vitro plasma samples of non-cancer groups. Finally, the DNA methylation marker with the best performance in liver cancer detection was determined through univariate performance analysis, namely the methylation level of the chr6:26250425-26250945 genomic region.

[0046] The primer combination for detecting the methylation level of the marker includes any one of SEQ ID NO.1-2, SEQ ID NO.4-5, SEQ ID NO.7-8, SEQ ID NO.10-11 and SEQ ID NO.13-14.

[0047] The nucleic acid probe used for detection includes any one of SEQ ID NO.3, SEQ ID NO.6, SEQ ID NO.9, SEQ ID NO.12 and SEQ ID NO.15.

[0048] Example 2: Detection performance of the screened markers in liver cancer tissue samples

[0049] 33 clinical samples of liver cancer tissue and 49 non-cancer control tissue samples were collected. The tissue samples were subjected to genome extraction, enzyme-based methylation conversion, and targeted methylation sequencing. The specific experimental steps are as follows:

[0050] 1. DNA sample extraction: When the sample is a fresh frozen tissue sample, use QIAGEN's " The genome was extracted using Blood & Tissue Kit #69506. For specific operations, please refer to the kit instructions. Genomic DNA was sheared using a Covaris M220 ultrasonic shearer. When cfDNA was extracted from plasma samples, Guangzhou Youze Biotechnology's Free DNA Extraction Kit (Filtration Method) #C02-1 was used. For specific operations, please refer to the kit instructions.

[0051] 2. Use SPRIselect magnetic beads to screen the extracted DNA samples according to the recommended steps in the instructions, and filter out DNA molecules larger than 200 bp.

[0052] 3. Preparation of quality control products: 10 μL of 0.1 ng / μL CpG methylated pUC19 and 10 μL of 2 ng / μL unmethylated λ DNA should be added to each sample;

[0053] 4. Library construction for methylation sequencing: Use the NEBNext Enzymatic Methyl-Seq kit to construct the library.

[0054] 4.1 End repair and 3' end addition of "A"

[0055] 4.1.1 Take 50 ng of the sample to be tested, dilute it to 50 μL with NF water, and then add the following reagents for reaction.

[0056] Components Volume (μL) Control DNA working solution 20 End repair reaction solution 5 End Repair Enzyme Mix 5

[0057] 4.1.2 Place in PCR instrument and perform reaction according to the following procedure

[0058]

[0059] 4.2 Connector connection

[0060] 4.2.1 Add the following reagents to the end repair product for reaction

[0061] Components Volume (μL) EM-seq Ligation Adapter Solution 5 Connection Enhancer 5 Ligation Mix 50

[0062] 4.2.2 Place in a PCR instrument and set the PCR reaction program according to the following conditions: 60°C, 60 min, with the heated lid closed.

[0063] 4.2.3 Purification of adapter ligation products

[0064] A. Equilibrate the purified magnetic beads at room temperature for 30 minutes and mix them thoroughly on a vortex.

[0065] B. Prepare 80% ethanol according to the ratio of anhydrous ethanol to nuclease-free water = 8:2 and set aside.

[0066] C. Add 55 μL of purified magnetic beads to each ligation product, mix well by pipetting, incubate at room temperature for 5 minutes, place on a magnetic rack, and discard the supernatant after the solution is clarified; wash with freshly prepared 80% ethanol, discard the supernatant, and repeat this step once; dry, elute with 15 μL elution buffer, and aspirate 14 μL of supernatant for the next reaction.

[0067] 4.3 Methylation: Oxidation reaction

[0068] 4.3.1 Configure buffer:

[0069] a. Add 400 μL of E1 reaction buffer to 100 μL of E1 reaction buffer supplement, shake and mix, and mark the preparation date.

[0070] b. Take 10 μL of 500 mM Fe(Ⅱ) and add it to 1249 μL of nuclease-free water. Use the diluted solution immediately. It should be used immediately after preparation and cannot be stored.

[0071] cDilute the Stop Buffer 1:10 with nuclease-free water.

[0072] 4.3.2 Add the following reagents to 14 μL of the purified ligation product and mix well. Then add 10 μL of diluted Fe(Ⅱ) to the purified ligation product to which the oxidase has been added, mix well and centrifuge.

[0073] Components Volume (μL) Remark Prepared TET2 reaction solution 5 Dissolved E1 supplement solution Oxidation supplement reaction solution 0.5 - Dithiothreitol 0.5 - Oxidation Enhancement Fluid 10 - E1 2 -

[0074] 4.3.3 Place in PCR instrument and react under the following conditions: 37℃, 1h, heating cover temperature ≥ 45℃.

[0075] 4.3.4 After the reaction is completed, add 1 μL of diluted reaction stop solution to the product and place it on the PCR instrument for reaction under the following conditions: 37°C, 30 min, hot cover temperature ≧45°C.

[0076] 4.3.5 Purification of oxidation reaction products

[0077] A. Equilibrate the purified magnetic beads at room temperature for 30 minutes and thoroughly mix them on a vortex machine;

[0078] B. Prepare 80% ethanol in a ratio of 8:2, and set aside.

[0079] C. Add 45 μL of NEB Next Sample purified magnetic beads to each ligation product, mix well by pipetting, incubate at room temperature for 5 minutes, place on a magnetic rack, and discard the supernatant after the solution is clarified; wash with freshly prepared 80% ethanol, discard the supernatant, and repeat this step once; dry, elute with 9.5 μL elution buffer, and aspirate 8 μL of supernatant for the next reaction.

[0080] 4.4 Methylation: Cytosine Deamination

[0081] 4.4.1 Denaturation:

[0082] a. Preheat the PCR instrument to 85°C and open the heated cover;

[0083] b. Add 2 μL of formamide to 8 μL of the purified oxidation reaction product, vortex to mix, and centrifuge briefly.

[0084] 4.4.2 Add the following reagents to the denatured product for reaction

[0085] Components Volume (μL) Nuclease-free water 34 E2 reaction solution 5 BSA 0.5 E2 0.5

[0086] 4.4.3 Place in PCR instrument and react under the following conditions: 37℃, 3h, heating cover temperature ≥ 45℃.

[0087] 4.4.4 Purification of Cytosine Deamination Reaction Products

[0088] a. Equilibrate the purified magnetic beads at room temperature for 30 min and thoroughly mix them on a vortex machine;

[0089] b. Prepare 80% ethanol according to the ratio of anhydrous ethanol to nuclease-free water = 8:2 and set aside;

[0090] c. Add 50 μL of NEB Next Sample purified magnetic beads to each ligation product, mix well by pipetting, incubate at room temperature for 5 minutes, place on a magnetic rack, and discard the supernatant after the solution is clarified; wash with freshly prepared 80% ethanol, discard the supernatant, and repeat this step once; dry, elute with 11 μL of elution buffer, and aspirate 10 μL of supernatant for the next reaction.

[0091] 4.5 PCR amplification and purification

[0092] 4.5.1 Add the following reagents to the above purified product for reaction

[0093] Components Volume (μL) Primers 2.5 Enzyme mixture 12.5

[0094] 4.5.2 Place on PCR instrument and react according to the following conditions

[0095]

[0096] 4.5.3 Purification of PCR amplification products

[0097] a. Equilibrate the purified magnetic beads at room temperature for 30 min and thoroughly mix them on a vortex machine;

[0098] b. Prepare 80% ethanol in the ratio of anhydrous ethanol to nuclease-free water = 8:2 and set aside;

[0099] c. Add 22.5 μL of NEB purified magnetic beads to each ligation product, mix well by pipetting, incubate at room temperature for 5 minutes, place on a magnetic rack, and discard the supernatant after the solution is clarified; wash with freshly prepared 80% ethanol, discard the supernatant, and repeat this step once; dry, elute with 15 μL of elution buffer, aspirate 14 μL of supernatant, and perform quality inspection.

[0100] 5. Hybridization and elution

[0101] 5.1 Hybridization:

[0102] a Take 10 ng of each library to be hybridized, calculate the library volume required for combined hybridization, and mix the 12 libraries together;

[0103] b. Add the following reagents to the library mixture for reaction;

[0104] c. Turn on the vacuum concentrator, set the V-AQ mode, and concentrate into dry powder at room temperature;

[0105] d. Immediately take 20 μL of hybridization mixture and add it to the concentrated dry powder, mix well and let it stand at room temperature for 5 minutes, then add 30 μL of hybridization enhancement solution, mix well and centrifuge;

[0106] e was placed on a PCR instrument and reacted according to the following conditions.

[0107] Reagent composition table

[0108] Components Volume (μL) Liver cancer probe 2 Internal reference probe 2 Universal blocking solution 8 Blocking reaction solution 5

[0109] PCR reaction conditions table

[0110]

[0111] 5.2 Capture and elution

[0112] 5.2.1 buffer preheating:

[0113] Preheat the rapid binding solution and rapid washing solution 2 at 48°C until the precipitate is dissolved, and preheat the rapid washing solution 1 at 63°C until the precipitate is dissolved. Equilibrate the streptavidin magnetic beads at room temperature for at least 30 minutes.

[0114] 5.2.2 Magnetic Bead Capture

[0115] a Vortex to mix the streptavidin magnetic beads that have been equilibrated to room temperature;

[0116] b. Take 70 μL of streptavidin magnetic beads and add them into a 1.5 mL centrifuge tube;

[0117] c. Add 20 μL of binding buffer, mix by pipetting, centrifuge briefly, place on a magnetic stand, let stand for 1 min, and discard the supernatant;

[0118] d. Repeat steps b and c twice, performing streptavidin magnetic bead washing three times in total;

[0119] e. Add 20 μL binding buffer to resuspend the streptavidin magnetic beads;

[0120] f Transfer 20 μL of resuspended streptavidin magnetic beads to the hybridization reaction tube, and then transfer all the liquid to a 1.5 mL centrifuge tube.

[0121] g. Mix on a mixer at room temperature for 30 minutes without vortexing.

[0122] After mixing, centrifuge immediately, place on a magnetic rack, let stand for 1 minute, and discard the supernatant.

[0123] 5.2.3 Elution

[0124] a. Add 200 μL of 54°C preheated rapid wash buffer 1, mix well by pipetting, and incubate in a thermostatic metal bath at 54°C for 5 min;

[0125] b After the incubation is completed, centrifuge briefly and transfer all the liquid to a new 1.5 mL centrifuge tube to remove the non-specific capture fragments bound to the surface of the centrifuge tube;

[0126] c Place on a magnetic stand, let stand for 1 minute, and discard the supernatant;

[0127] d. Add 200 μL of washing buffer 1 preheated at 63°C, mix well by pipetting, and incubate in a thermostatic metal bath at 54°C for 5 minutes;

[0128] eAfter incubation, centrifuge immediately, place on a magnetic stand, let stand for 1 min, and discard the supernatant;

[0129] f. Add 200 μL of 54°C preheated washing buffer 2, pipette to mix, and incubate in a thermostatic metal bath at 54°C for 5 minutes;

[0130] After the incubation is completed, centrifuge immediately, place on a magnetic stand, let stand for 1 minute, and discard the supernatant;

[0131] h. Repeat steps a to g twice for a total of three washes;

[0132] i Centrifuge briefly, discard the remaining supernatant with a 10 μL pipette tip, immediately add 45 μL of nuclease-free water, mix by pipetting, and incubate on ice.

[0133] 5.3 PCR enrichment of capture products

[0134] 5.3.1 Take 22.5 μL of the captured product (streptavidin magnetic bead suspension) and add the following reagents to react.

[0135]

[0136]

[0137] Place on PCR instrument and react according to the following conditions

[0138]

[0139] 5.3.2 PCR product purification

[0140] a. Equilibrate the DNA purification magnetic beads at room temperature for 30 minutes and mix thoroughly on a vortex machine;

[0141] b Prepare 80% ethanol in a ratio of 8:2 for use;

[0142] c. Add 90 μL of DNA purification magnetic beads to each ligation product, mix well by pipetting, incubate at room temperature for 5 minutes, place on a magnetic rack, and discard the supernatant after the solution is clarified; wash with freshly prepared 80% ethanol, discard the supernatant, and repeat this step once; dry, elute with 32 μL of elution buffer, aspirate 30 μL of supernatant for quality control, and sequence on the machine.

[0143] 6. Analysis of sequencing data:

[0144] The raw data was first filtered using fastQC to remove low-quality sequences (phred33 score ≤ 20) and adapter sequences and polyA / T sequences in the reads. The filtered high-quality reads were mapped to the hg38 human genome using BSMAP, and reads with high mapping quality were screened out. After removing PCR duplicates using picard, reads mapped to the target genomic region (the region corresponding to the DNA methylation marker) were selected using samtools and the methylation levels of each DNA methylation marker were calculated.

[0145] The detection performance of the determined methylation markers and the combination for distinguishing liver cancer tissues from non-cancer tissues is shown in the following table:

[0146]

[0147] Example 3: Detection performance of the screened markers in liver cancer blood samples

[0148] 414 clinical blood samples were collected, including 218 blood samples from patients with primary liver cancer, 173 blood samples from patients with benign liver diseases, and 23 blood samples from healthy people. The blood samples were subjected to free DNA extraction, methylation conversion, and targeted methylation sequencing according to the method described in Example 2, and the methylation level of each methylation marker was calculated.

[0149] Blood sample statistical results:

[0150] Sample Group Sample Type Detection object Number of samples Detection Methods Hepatocellular carcinoma Blood samples Free DNA 218 Targeted Sequencing-Small Panel Small liver cancer Blood samples Free DNA 5 Targeted Sequencing-Small Panel Benign liver disease Blood samples Free DNA 173 Targeted Sequencing-Small Panel Healthy people Blood samples Free DNA 23 Targeted Sequencing-Small Panel

[0151] Single factor statistical analysis was performed on single methylation markers to calculate the detection performance of ex vivo blood samples for distinguishing liver cancer patients from controls. The sensitivity and specificity of liver cancer detection of the determined methylation markers are shown in the following table:

[0152] Methylation markers Specificity Sensitivity chr6:26250425-26250945 0.903 0.858

[0153] like Figure 2 As shown, the AUC value of the determined methylation marker for methylation sequencing detection of liver cancer ex vivo blood samples was 0.947.

[0154] Example 4: Performance of the identified methylation markers in a liver cancer ex vivo blood sample qPCR detection dataset

[0155] This embodiment provides a primary liver cancer diagnostic reagent, which specifically includes the following nucleic acid combinations for detecting CpG methylation in the chr6:26250425-26250945 gene region: nucleic acid combination 1, nucleic acid combination 2, nucleic acid combination 3, nucleic acid combination 4 and nucleic acid combination 5.

[0156] The nucleic acid combination 1 includes a primer combination 1 and a probe 1. The primer combination 1 includes the nucleotides shown in SEQ ID NO.1-2. The base sequence of the probe 1 is shown in SEQ ID NO.3.

[0157] The upstream primer sequence for region 1 methylation-specific PCR is (5′-3′):

[0158] TTTTTGATAGCGCGGGAT(SEQ ID NO.1);

[0159] The downstream primer sequence for region 1 methylation-specific PCR is (5′-3′):

[0160] AAAACCCCGCGCAAA(SEQ ID NO.2);

[0161] The sequence of probe 1 for region 1 methylation-specific PCR is (5′-3′):

[0162] GGTTGGCGCGTTTTTGC (SEQ ID NO. 3).

[0163] Nucleic acid combination 2 includes primer combination 2 and probe 2. Primer combination 2 includes nucleotides shown in SEQ ID NO.4-5. The base sequence of probe 2 is shown in SEQ ID NO.6.

[0164] The upstream primer sequence for region 2 methylation-specific PCR is (5′-3′):

[0165] AATCCACTAACGACAAAACC(SEQ ID NO.4);

[0166] The downstream primer sequence for region 2 methylation-specific PCR is (5′-3′):

[0167] GTATTAGGTTTGTAGCGGTG(SEQ ID NO.5);

[0168] The sequence of probe 2 for region 2 methylation-specific PCR is (5′-3′):

[0169] CAACTAACCACTAAAACGACTCGC (SEQ ID NO. 6).

[0170] Nucleic acid combination 3 includes primer combination 3 and probe 3. Primer combination 3 includes nucleotides shown in SEQ ID NO.7-8. The base sequence of probe 3 is shown in SEQ ID NO.9.

[0171] The upstream primer sequence for region 3 methylation-specific PCR is (5′-3′):

[0172] TACCGCCAATAAACTTACGA(SEQ ID NO.7);

[0173] The downstream primer sequence for region 3 methylation-specific PCR is (5′-3′):

[0174] CGGATTAATTAGAAGGATTTTGTT(SEQ ID NO.8);

[0175] The sequence of probe 3 for region 3 methylation-specific PCR is (5′-3′):

[0176] TTACTTCGTACGTACCATAAAAAT (SEQ ID NO. 9).

[0177] The nucleic acid combination 4 includes a primer combination 4 and a probe 4. The primer combination 4 includes the nucleotides shown in SEQ ID NO.10-11. The base sequence of the probe 4 is shown in SEQ ID NO.12.

[0178] The upstream primer sequence for region 4 methylation-specific PCR is (5′-3′):

[0179] CCTAATAACTAATCACAAATCCTATC(SEQ ID NO.10);

[0180] The downstream primer sequence for region 4 methylation-specific PCR is (5′-3′):

[0181] CGTGCGTGTTATAGGAATG (SEQ ID NO. 11);

[0182] The sequence of probe 4 for region 4 methylation-specific PCR is (5′-3′):

[0183] CGCGAAACTAAAAAATTCGAACCAA (SEQ ID NO. 12).

[0184] The nucleic acid combination 5 includes a primer combination 5 and a probe 5. The primer combination 5 includes the nucleotides shown in SEQ ID NO.13-14. The base sequence of the probe 5 is shown in SEQ ID NO.15.

[0185] The upstream primer sequence for region 5 methylation-specific PCR is (5′-3′):

[0186] CTTCCAATTTCGCGCC(SEQ ID NO.13);

[0187] The downstream primer sequence for region 5 methylation-specific PCR is (5′-3′):

[0188] ACCGCGGTATTTTTGAATCG(SEQ ID NO.14);

[0189] The sequence of probe 5 for region 5 methylation-specific PCR is (5′-3′):

[0190] CAAACGAAAATAAACGTTCTACAATTCCG (SEQ ID NO. 15).

[0191] A total of 79 clinical blood samples were collected in this experiment, including 32 blood samples from patients with primary liver cancer, 32 blood samples from patients with benign liver diseases, and 15 blood samples from healthy people.

[0192] Sample Group Sample Type Detection object Number of samples Detection Methods Hepatocellular carcinoma Blood samples Free DNA 32 qPCR method Benign liver disease Blood samples Free DNA 32 qPCR method Healthy people Blood samples Free DNA 15 qPCR method

[0193] The 79 blood samples collected above were subjected to quantitative methylation qPCR detection, and the qPCR detection Ct values ​​were recorded. The specific experimental steps are as follows:

[0194] 1. Separation of plasma: First, centrifuge the collected 10 mL clinical blood sample at 1600×g for 10 minutes to separate the plasma. Centrifuge the separated plasma at 16000×g for 10 minutes to separate impurities. The purified plasma sample should be stored in a -80℃ refrigerator for future use.

[0195] 2. Free DNA extraction: Use the "Free DNA Extraction Kit" (Cat. No.: C03-2) of Guangzhou Youze Biotechnology Co., Ltd. to extract plasma free DNA from the separated plasma samples.

[0196] 3. Free DNA conversion: Use ZYMO's "EZ-96 DNA Methvlation-Lightning MagPrep" to perform methylation C->T conversion on the extracted free DNA samples.

[0197] 4. Negative and positive controls for methylation quantitative PCR: The negative control is the genomic DNA of the cell line (cell line: QSG-7701) transformed by the ZYMO kit, with a concentration of 1 ng / μL. After transformation, the C in the negative control is converted to T. The positive control is the genomic DNA of the cell line (cell line: HepG2) converted by the ZYMO kit with bisulfite, with a concentration of 1 ng / μL. After transformation, the C at the methylated CpG position does not change, and the C at other positions is converted to T.

[0198] 5. Reaction system for methylation quantitative PCR:

[0199] Components concentration Volume (μL) Target site-upstream primer F 10μM 1 Target site-fluorescent probe P 10μM 0.5 Target site-downstream primer R 10μM 1 Internal standard site-upstream primer F 10μM 1 Internal standard site-fluorescent probe P 10μM 0.5 Internal standard site-downstream primer R 10μM 1 Reaction buffer 10X 2.5 DNA polymerase 5U / μL 1 dNTPs 2.5mM 2 Free DNA to be tested About 1ng / μL 4 water / 5.5 total / 20

[0200] 6. Reaction procedure of methylation quantitative PCR:

[0201]

[0202] 7. On-machine detection: Mix the sample DNA to be tested, negative reference, and positive reference according to the reaction system of methylation quantitative PCR in step 5. Put the sample into Shanghai Hongshi SLAN-96S quantitative PCR instrument, and set up the quantitative PCR instrument according to the program conditions in step 6 for detection, and collect the fluorescence values ​​of each channel of HEX / ROX / FAM / CY5.

[0203] 8. Result recording: After the methylation quantitative PCR reaction is completed, the threshold is set at the inflection point of the S-type amplification curve to obtain the Ct value of the sample to be tested at the methylation site.

[0204] 9. Quality control: Negative and positive references are tested simultaneously in each test. The negative control is the transformed cell genomic DNA (cell line: QSG-7701) containing the β-actin gene and the low-methylation target gene sequence, and the positive control is the transformed cell cfDNA (cell line: HepG2) containing the β-actin gene and the high-methylation target gene sequence, with a concentration of 1ng / μL. When the negative reference is not amplified, the Ct value of the positive reference is between 28-32, and the Ct value of the internal reference gene is less than 38, the experiment is valid and the next step of sample result determination can be carried out. Otherwise, the result is invalid and the test must be repeated.

[0205] 10. Result determination: If the Ct value of the target marker is less than 35, the test result is positive, otherwise the test result is negative.

[0206] The Ct values ​​of qPCR detection in ex vivo blood samples using the designed primer-probe combination were used to distinguish liver cancer and non-cancer samples. The detection performance is shown in the following table.

[0207] Markers Primer probe combination Specificity Sensitivity chr6:26250425-26250945 Nucleic acid combination 1 0.915 0.813 chr6:26250425-26250945 Nucleic Acid Combination 2 0.915 0.813 chr6:26250425-26250945 Nucleic acid combination 3 0.915 0.813 chr6:26250425-26250945 Nucleic acid combination 4 0.915 0.813 chr6:26250425-26250945 Nucleic acid combination 5 0.894 0.844

[0208] From the blood qPCR test results, it can be seen that the liver cancer detection performance of different primer probe combinations designed for the chr6:26250425-26250945 marker is similar, with a specificity of 89.4-91.5% and a sensitivity of 81.3-84.4%. Compared with traditional liver cancer screening methods, this single methylation marker has ideal detection performance, is easy to use and has low cost, which is of great significance for the popularization and promotion of early screening and treatment of liver cancer.

[0209] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the protection scope of the present invention. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A molecular marker nucleic acid combination for primary liver cancer, characterized in that: The molecular marker nucleic acid combination is a combination of nucleic acid molecules located at CpG sites in the chr6:26250425-26250945 region sequence; The region is from the hg38 human reference genome.

2. The molecular marker nucleic acid combination for primary liver cancer according to claim 1, characterized in that: The molecular marker nucleic acid combination is a nucleic acid molecule located in at least one of the following five regions and containing at least one CpG site: region 1, region 2, region 3, region 4, and region 5; The region 1 is chr6:26250435-26250563; the region 2 is chr6:26250469-26250577; the region 3 is chr6:26250563-26250692; the region 4 is chr6:26250594-26250753; and the region 5 is chr6:26250696-26250942.

3. The molecular marker nucleic acid combination for primary liver cancer according to claim 1, characterized in that: The nucleic acid combination is any one or more of nucleic acid combination 1 for detecting the region 1, nucleic acid combination 2 for detecting the region 2, nucleic acid combination 3 for detecting the region 3, nucleic acid combination 4 for detecting the region 4, and nucleic acid combination 5 for detecting the region 5; The nucleic acid combination 1 includes a primer combination 1, the nucleic acid combination 2 includes a primer combination 2, the nucleic acid combination 3 includes a primer combination 3, the nucleic acid combination 4 includes a primer combination 4, and the nucleic acid combination 5 includes a primer combination 5.

4. The molecular marker nucleic acid combination for primary liver cancer according to claim 3, characterized in that: The base sequence of the primer combination 1 has at least 90% identity with the base sequence shown in SEQ ID NO.1-2; The base sequence of the primer combination 2 has at least 90% identity with the base sequence shown in SEQ ID NO.4-5; The base sequence of the primer combination 3 has at least 90% identity with the base sequence shown in SEQ ID NO.7-8; The base sequence of the primer combination 4 has at least 90% identity with the base sequence shown in SEQ ID NO.10-11; The base sequence of the primer combination 5 has at least 90% identity with the base sequence shown in SEQ ID NO.13-14.

5. The molecular marker nucleic acid combination for primary liver cancer according to claim 4, characterized in that: The nucleic acid combination 1 further includes probe 1, the nucleic acid combination 2 further includes probe 2, the nucleic acid combination 3 further includes probe 3, the nucleic acid combination 4 further includes probe 4, and the nucleic acid combination 5 further includes probe 5; The base sequence of the probe 1 has at least 90% identity with the base sequence shown in SEQ ID NO.3; The base sequence of the probe 2 has at least 90% identity with the base sequence shown in SEQ ID NO.6; The base sequence of the probe 3 has at least 90% identity with the base sequence shown in SEQ ID NO.9; The base sequence of the probe 4 has at least 90% identity with the base sequence shown in SEQ ID NO.12; The base sequence of the probe 5 has at least 90% identity with the base sequence shown in SEQ ID NO.

15.

6. Use of a molecular marker nucleic acid combination for primary liver cancer in the preparation of a detection product, characterized in that: Comprising the nucleic acid combination according to any one of claims 3 to 5.

7. The use of a molecular marker nucleic acid combination for primary liver cancer according to claim 6 in preparing a detection product, characterized in that: The detection product includes any one of a reagent, a kit, a chip and a sequencing library.

8. The use of a molecular marker nucleic acid combination for primary liver cancer according to claim 6 in preparing a detection product, characterized in that: The detection is performed by at least one of the following methods: methylation-specific PCR method, sequencing method, methylation-specific high-performance liquid chromatography method, digital PCR method, methylation-specific high-resolution melting curve method, methylation-specific microarray method, methylation-sensitive restriction endonuclease method and flap endonuclease method.

9. A primary hepatocellular carcinoma detection kit, characterized in that: The method comprises the nucleic acid combination according to any one of claims 3 to 5, a positive control, a negative control, a detection primer of an internal reference gene, a detection probe of an internal reference gene, a DNA polymerase and a buffer.

10. A primary hepatocellular carcinoma detection kit according to claim 9, characterized in that: The detection samples of the kit are ex vivo blood samples or ex vivo tissue samples and ex vivo leukocyte samples.

Images