Disease-resistant gene of corn ear grain rot, molecular marker and application

Abstract

The invention belongs to the technical field of molecular markers, and particularly relates to an anti-disease gene of corn grain rot, a molecular marker and application. The nucleotide sequence of the gene ZmRLK2 is as shown in SEQ ID NO. 1. According to the invention, the corn grain rot resistance candidate gene ZmRLK2 is obtained by carrying out correlation analysis on a whole genome of the corn grain rot and screening SNP marker sites. Sequence comparison of the gene finds that two allele types exist in a natural material, and molecular markers are developed for variation of the allele. The method is not influenced by tissue types, development stages, environmental factors and the like, the molecular marker technology is simple, rapid and easy to automation, the inoculation and identification cost is greatly saved, and the method can be used for corn molecular breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and specifically relates to a disease-resistant gene and molecular marker for corn ear rot and applications thereof. Background Art

[0002] Corn ear rot is a disease of corn caused by infection of more than 20 kinds of fungi such as Fusarium graminearum and Fusarium syngenes. Both corn ears and kernels can be harmed by this disease. Corn ear rot occurs in all corn producing areas in China. Some pathogens of ear rot can produce toxic metabolites such as DON and FB1, which are seriously harmful to the health of humans, livestock and poultry.

[0003] There are great difficulties in the conventional chemical control of corn ear rot, and cultivating and promoting disease-resistant varieties is the most effective way to prevent and control the disease. In the process of cultivating disease-resistant varieties, the identification of corn ear rot resistance is often affected by the environment, and the artificial inoculation identification method is inefficient and costly. Molecular markers can identify and screen corn resistance at the molecular level, greatly reducing the limitations brought by environmental factors. At the same time, the cost of inoculation identification is greatly reduced. In addition, the mining of disease-resistant genes and the application of related molecular markers can eliminate the influence of the environment and the growth and development period of corn, and improve the efficiency of disease-resistant breeding. Therefore, realizing the mining of disease-resistant genes for corn ear rot and the application of related molecular markers is a technical problem that technicians in this field urgently need to solve. At present, scholars at home and abroad have cloned some genes related to ear rot resistance, but there are very few genes that can be truly applied to corn ear rot resistance breeding. That is, the existing disease-resistant genes related to ear rot resistance are difficult to apply to corn ear rot resistance breeding. Summary of the invention

[0004] In order to solve the problem in the prior art that the existing disease resistance genes related to ear rot resistance are difficult to be applied to corn ear rot resistance breeding work, the present invention provides a disease resistance gene and molecular marker for corn ear rot and application. To achieve the above purpose, the present invention adopts the following technical solution.

[0005] The present invention provides a disease resistance gene ZmRLK2 for corn ear rot, and the nucleotide sequence of the gene ZmRLK2 is shown in SEQ ID NO. 1. The gene ZmRLK2 provided by the present invention is a candidate gene for corn ear rot resistance, and the superior allele of this gene can significantly improve the resistance of corn to ear rot, and can solve the problem in the prior art that the existing disease resistance genes related to ear rot resistance are difficult to apply to corn ear rot resistance breeding.

[0006] Preferably, the amino acid sequence of the protein expressed by the gene ZmRLK2 is shown as SEQ ID NO.2.

[0007] The present invention screens SNP marker sites through genome-wide association analysis of corn ear rot, and obtains a candidate gene ZmRLK2 for corn ear rot resistance. Subsequently, the function of the candidate gene ZmRLK2 is verified in transgenic materials. At the same time, the sequence of the gene is compared in natural materials, and it is found that there are two allele types in natural materials. Molecular markers are developed for the variation of the nucleotide sequence of the allele, and the developed molecular markers are verified in the association analysis population. Based on this, the present invention provides a molecular marker of the disease resistance gene ZmRLK2 for corn ear rot, and the molecular marker site is located at the 2594 bp of the nucleotide sequence shown in SEQ ID NO.1, and the base at this location has a mutation from GCCGGCTCCGGCTCGGCTG to GCTG. When the haplotype of corn germplasm is GCCGGCTCCGGCTCGGCTG, the resistance of corn to ear rot is weak; when the haplotype of corn germplasm is GCTG, the resistance of corn to ear rot is generally strong. By detecting the haplotype of this locus, the resistance of corn germplasm to ear rot can be predicted, which can assist breeding.

[0008] Among them, the candidate gene ZmRLK2 for resistance to corn ear rot is the corn ear rot resistance gene ZmRLK2. The candidate gene ZmRLK2 is the gene ZmRLK2.

[0009] The present invention also provides primers for amplifying the molecular marker, including RLK2-FZBJ-F and RLK2-FZBJ-R.

[0010] The nucleotide sequence of the RLK2-FZBJ-F is shown in SEQ ID NO.3.

[0011] The nucleotide sequence of the RLK2-FZBJ-R is shown in SEQ ID NO.4.

[0012] The present invention also provides primers for high-throughput detection of the molecular markers, including RLK2-k1-FAM:, RLK2-k1-HEX: and RLK2-k1-R.

[0013] The nucleotide sequence of the RLK2-k1-FAM is shown in SEQ ID NO.5.

[0014] The nucleotide sequence of the RLK2-k1-HEX is shown in SEQ ID NO.6.

[0015] The nucleotide sequence of the RLK2-k1-R is shown in SEQ ID NO.7.

[0016] The invention also provides application of the molecular marker in identifying disease resistance traits and disease susceptibility traits of corn ear rot.

[0017] Preferably, the molecular marker site on the coding region of the gene ZmRLK2 of corn is detected, and the material with the mutation from GCCGGCTCCGGCTCGGCTG to GCTG is resistant to corn ear rot.

[0018] The invention also provides application of the molecular marker in corn breeding.

[0019] Preferably, the material in which the molecular marker site undergoes a mutation from GCCGGCTCCGGCTCGGCTG to GCTG is resistant to corn ear rot.

[0020] Preferably, the method for corn breeding using the molecular markers is as follows:

[0021] The genotype of the molecular marker site in the corn genome is detected, corn with the genotype of GCTG is selected as the parent for breeding, and offspring resistant to corn ear rot are harvested. The screening of the haplotype can greatly save the cost of ear rot inoculation and identification, and at the same time, it provides a method for the existing disease-resistant genes related to ear rot resistance to be difficult to apply to corn ear rot resistance breeding.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] At present, people often identify corn ear rot resistance by artificially inoculating corn germplasm with pathogens in the field, and then investigating the resistance of corn to ear rot after the corn matures. The results obtained in this way are greatly affected by the environment and the identification process is time-consuming and labor-intensive. A disease-resistant gene and molecular marker for corn ear rot provided by the present invention and its application are not affected by tissue type, developmental stage, environmental factors, etc. The molecular marker technology used is simple, fast, and easy to automate, which greatly saves the cost of inoculation and identification and can be used for corn molecular breeding. The gene ZmRLK2 provided by the present invention is a candidate gene for corn ear rot resistance. The superior allele of this gene can significantly improve the resistance of corn to ear rot, and can solve the problem that the existing disease-resistant genes related to ear rot resistance in the prior art are difficult to apply to corn ear rot resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the four-environment combined whole-genome association analysis of corn ear rot in the present invention.

[0025] Figure 2 This is the association analysis of the candidate gene ZmRLK2 in the present invention; wherein, Figure 2 Figure A shows the significance of SNPs and Indels sites in the gene ZmRLK2 and its upstream 2Kb and downstream 1Kb intervals; Figure 2 Figure B shows the linkage analysis of three significant loci: 9_12098983, 9_12099285 and 9_12099344.

[0026] Figure 3 This is the haplotype analysis of the candidate gene ZmRLK2 in the present invention; wherein, Figure 3 Figure A shows the proportion of two haplotype materials of candidate gene ZmRLK2 resistance and sensitivity in the associated inbred lines; Figure 3 Figure B shows the significance analysis of the resistance of two haplotypes of the candidate gene ZmRLK2 to corn ear rot in the associated inbred lines.

[0027] Figure 4 The ear rot phenotype of the ZmRLK2 gene knockout transgenic line in the present invention; wherein, Figure 4 Figure A shows the disease incidence of wild type KN5585 and two knockout lines KO1 and KO2 inoculated with Fusarium graminearum and Fusarium graminearum 15 days after natural pollination; Figure 4 Figure B shows the statistical results of the diseased area of ​​the wild type KN5585 and two knockout lines KO1 and KO2 inoculated with Fusarium graminearum and Fusarium graminearum 15 days after natural pollination.

[0028] Figure 5 These are the sequencing results of the two knockout materials KO1 and KO2 in the present invention.

[0029] Figure 6 This is a sequence comparison of the resistant and susceptible genotype materials in the present invention.

[0030] Figure 7 It is the result of molecular marker amplification in the present invention.

[0031] Figure 8 is the verification result of the molecular marker in the associated inbred line of the present invention; wherein, Figure 8 Figure A in the figure is the analysis result of the associated inbred line material Kaspa; Figure 8 Figure B shows the statistical analysis of two types of variation in corn ear rot resistance in associated inbred line materials. DETAILED DESCRIPTION

[0032] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0033] The 411 related population materials in the following implementation examples are derived from a wide range of inbred line populations organized in the project, including the SS group, NSS group, Huanggai group, P group and some inbred lines from the International Maize and Wheat Improvement Center.

[0034] Example 1: Obtaining molecular markers for the disease resistance gene ZmRLK2 for corn ear rot

[0035] 1. Using the whole genome association analysis of corn ear rot, it was found that two significant SNP sites, S12099344 and S12101351, were effective in two environments (19J and 18J) and in the joint analysis.

[0036] In the joint analysis of the four environments, the P-Values ​​of S12099344 and S12101351 were 6.62×10 -5 , 2.57×10 -5 , reaching an extremely significant level, as shown in Table 1. The two significant SNPs were located in the interval of 10Kb upstream and downstream and co-localized to a leucine-rich repeat sequence protein kinase RLK2, which was named ZmRLK2.

[0037] Table 1 Results of four-year identification of significant SNP sites

[0038]

[0039] The association analysis used 411 inbred line materials of the associated population, and the whole genome contained 1,500,000 SNP markers. Then, these 1,500,000 SNP markers were screened, and markers with missing values ​​greater than 0.25 and allele frequency (MAF) less than 0.05 were filtered out. The corn ear rot resistance data of 411 inbred line materials in four environments of Jiaozuo in 2018, Junxian in 2019, Jiaozuo in 2019, and Jiaozuo in 2020 were combined to obtain the corn ear rot resistance candidate gene ZmRLK2. The corn ear rot resistance candidate gene ZmRLK2 is also called gene ZmRLK2.

[0040] The CDS sequence of gene ZmRLK2 is shown in SEQ ID NO.1:

[0041]

[0042] The amino acid sequence of the protein expressed by the above gene ZmRLK2 is shown in SEQ ID NO.2:

[0043] MELAPMSATIFFAFLLLFLPYGPMNPGVVSAAAGGGLDDDRYALLSFRSGVSSDPNGALAGWGAPDVCNWTGVACDTATRRVVNLTLSKQKLSGEVSPALANLSHLCVLNLSGNLLTGRVPPELGRLSRLTVLAMSMNSFTGRLPPELGNLSSLNSLDFSGNNLEGPVPVELTRIREMVYFNLGENNFSGRIPEAIFCNFSTALQYLDLSSNSLDGEIPIRGGCSLPDLTFLVLWSNYLSGGIPPAISNSTKLRWLLLENNFLAGELPSDMFGGMPHLELVYFTYNSLESPQNNTNLEPFFASLTNCTGLKELGVAWNEIAGTIPPVVGRLSPGLQQLHLEYNNIFGPIPANLSDLANLTTLNLSHNLLNGSIPRGIAAMQRLERLYLSNNLLSGEIPPSLGTVPRLGLVDLSRNRLTGAVPDTLSNLTQLRELVLSHNRLSGAIPPSLARCVDLQNFDLSHNALQGEIPADLSALSGLLYMNLSGNQLEGTIPAAISKMVMLQVLNLSSNRLSGAIPPQLGSCVALEYLNVSGNTLEGGLPDTIGALPFLEVLDVSYNRLTGALPLTLEKAASLRHVNFSFNGFSGEVPGTGAFESFPANAFLGDAGLCGSVVGLARCGGGGGAKHRPALRDRRVVLPVVITVIAFTAAIVGVVACRLAARAGVRRDSRRSMLLTDADEPAEGDHPRVSHRELSEATRGFEQASLIGAGRFGRVYEGTLRDGTRVAVKVLDPKSGGEVSRSFKRECQVLRRTRHRNLVRVVTACSQPDFHALVLPLMPNGSLESRLYPPDGAPGRGLDLAQLVSIASDVAEGIAYLHHYAPVRVVHCDLKPSNVLLDDDMTAVVADFGIARLVKDVGDSDLADSAGSGSADPCNSITGLLQGSVGYIAPEYGMGGHPSTQGDVYSFGVMLLELITGKRPTDVIFQEGLTLHDWVKRHYPHDVGRVVAESWLTDAASAVADERIWNDVMAELIDLGVVCTQHAPSGRPTMAEVCHEIALLKEDLARHLGAPAATTMTASERSYSTTDSSF。

[0044] 2. Perform candidate gene association analysis on ZmRLK2, and the results are shown in Figure 2 .

[0045] From Figure 2It can be seen that three significant loci 9_12098983, 9_12099285 and 9_12099344 were found on the candidate gene. The three loci were close to complete linkage and divided the associated inbred lines into two haplotypes, Hap1 and Hap2. The Hap2 haplotype can significantly improve the resistance of corn to ear rot compared with the Hap1 haplotype. The results are shown in Figure 3 .

[0046] 3. Plant wild type KN5585 and two knockout lines KO1 and KO2 in the field in two rows, with a row length of 4m, a row spacing of 0.67m, and a plant spacing of 0.21m. After the corn was naturally pollinated for 15 days, the corn was planted at a rate of 5×10 6 / mL and 1×10 5 The wild type and two ZmRLK2 gene knockout lines were inoculated with Fusarium spores and Fusarium graminearum at a concentration of spores / mL. Each ear was inoculated with 1 mL of each pathogen. The incidence of corn ear rot in each ear was counted and recorded about 30 days after inoculation. In the two knockout lines, the incidence area of ​​ear rot increased by 23.73% and 27.94%, respectively. The results are shown in Figure 4 Among them, the two ZmRLK2 gene knockout line materials refer to the knockout line KO1 with two amino acid deletions and the knockout line KO2 with a frameshift mutation in the coding region, such as Figure 5 As shown, the knockout lines were derived from the mutant library of Weimi Biotechnology Co., Ltd.

[0047] 3. According to the haplotype analysis results, the extremely resistant material CML533 in the disease-resistant haplotype and the extremely susceptible material PHW79 in the disease-susceptible haplotype were selected to amplify the DNA sequence and CDS region sequence of the candidate gene ZmRLK2, and the sequencing results were compared on the BioXM software. The results are shown in Figure 6 Comparison of resistant and susceptible genotype materials revealed that the resistant material lacked 15 bases in the first exon compared with the susceptible material.

[0048] 4. Using maize whole genome DNA as template and RLK2-FZBJ-F and RLK2-FZBJ-R as primers, polymerase chain reaction was performed. The primer sequences are shown in Table 2, and the reaction system and reaction procedures are shown in Tables 3 and 4.

[0049] Table 2 Developed molecular marker primer sequences

[0050] Primer name Base sequence (5' end - 3' end) RLK2-FZBJ-F GTGGTAGCGGACTTCGGCAT, as shown in SEQ ID NO.3 RLK2-FZBJ-R GCAAGAACAGAGCACAACGAA, as shown in SEQ ID NO.4

[0051] Table 3 Common PCR amplification system

[0052]

[0053] Table 4 General PCR reaction procedure

[0054]

[0055]

[0056] 5. Detect the polymerase chain reaction products by agarose gel electrophoresis.

[0057] (1) Preparation of TAE buffer: Add 242 g Trisbase, 57.1 mL glacial acetic acid, 100 mL 0.5 mol / L ETA (pH 8.0) to a volumetric flask, and distilled water to make up to 1 L.

[0058] (2) Weigh 0.75 g of agarose using a balance, and then use a measuring cylinder to measure 25 mL of electrophoresis buffer. Heat the agarose in a microwave oven until it is completely dissolved. Add 2.5 μl of nucleic acid dye and shake well.

[0059] (3) Gently pour the shaken agarose solution onto the horizontal plate of the electrophoresis tank and insert a comb. Remove the comb after the gel solidifies.

[0060] (4) Take 6 μl of the polymerase chain reaction product and spot it.

[0061] (5) Install the electrode wires in the correct position, connect the sample wells to the positive and negative poles of the power supply respectively, turn on the power supply, adjust the voltage to 120V, and perform electrophoresis for 25 minutes.

[0062] 6. Primers were designed at the upstream and downstream of the molecular markers to amplify the differential fragments. The resistance of corn was determined according to the size of the agarose gel electrophoresis band. When the band size was 232 bp, the resistance of corn to ear rot was strong; when the band size was 254 bp, the resistance of corn to ear rot was weak. The results are shown in the attached figure. Figure 7 shown.

[0063] 7. In order to verify the effect of the disease resistance gene ZmRLK2 and its molecular marker on corn ear rot, the present invention designs primers based on the principle of fluorescence competitive PCR, and the sequence information is as follows:

[0064] The nucleotide sequence of RLK2-k1-FAM: is shown in SEQ ID NO.5;

[0065] 5'-GAAGGTGACCAAGTTCATGCTGAGTTGCACGGGTCAGCG-3'.

[0066] The nucleotide sequence of RLK2-k1-HEX is shown in SEQ ID NO.6;

[0067] 5'-GAAGGTCGGAGTCAACGGATTGAGTTGCACGGGTCAGCC-3'.

[0068] The nucleotide sequence of RLK2-k1-R is shown in SEQ ID NO.7;

[0069] 5′-CCTGGTCAAGGACGTCGG-3′.

[0070] The markers of 220 inbred lines of different breeding origins were tested by polymerase chain reaction. Among them, the 220 inbred lines of different breeding origins were derived from the association analysis population established by the project. The detection steps are as follows:

[0071] (1) Prepare the reaction premix according to the system shown in Table 5 in a 96-well PCR plate.

[0072] Table 5 Competitive PCR reaction system

[0073]

[0074] (2) Perform polymerase chain reaction according to the reaction procedure shown in Table 6.

[0075] Table 6 Competitive PCR reaction program

[0076]

[0077] (3) Read the fluorescence data on a fluorescence quantitative PCR instrument at 30°C. Figure 8 As shown, 32 inbred lines belonged to the disease-resistant haplotype, and 188 inbred lines belonged to the disease-susceptible haplotype. The resistance of the disease-resistant haplotype inbred lines to ear and grain rot was significantly stronger than that of the inbred lines with the disease-susceptible genotype, and the P value between the two was 0.0115.

[0078] In summary, this embodiment screened SNP marker sites through genome-wide association analysis of corn ear rot, and obtained the corn ear rot resistance candidate gene ZmRLK2. This embodiment provides a disease resistance gene and molecular marker for corn ear rot, and its application is not affected by tissue type, developmental stage, environmental factors, etc. The molecular marker technology is simple, fast, and easy to automate, which greatly saves the cost of inoculation and identification, and can be used for corn molecular breeding. Among them, the corn ear rot resistance candidate gene ZmRLK2 is the corn ear rot resistance gene ZmRLK2.

[0079] The above experimental results show that the resistance of corn to ear rot is significantly improved after the gene ZmRLK2 is deleted, and the insertion / deletion of 15 bases in the coding region of the gene ZmRLK2 has a significant effect on the resistance to corn ear rot. Based on the insertion / deletion of 15 bases, the agarose gel electrophoresis technology can distinguish the resistance of corn to ear rot to a certain extent.

[0080] It should be noted that when the present invention involves a numerical range, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0081] Although preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they understand the basic inventive concepts, and all such changes and modifications fall within the scope of the present invention.

Claims

1. A maize ear rot resistance gene ZmRLK2, characterized in that: The nucleotide sequence of the gene ZmRLK2 is shown in SEQ ID NO.

1.

2. The corn ear rot resistance gene ZmRLK2 according to claim 1, characterized in that: The amino acid sequence of the protein expressed by the gene ZmRLK2 is shown in SEQ ID NO.

2.

3. The molecular marker of the maize ear rot resistance gene ZmRLK2 according to claim 1, characterized in that: Primers used to amplify molecular markers included RLK2-FZBJ-F and RLK2-FZBJ-R; The nucleotide sequence of the RLK2-FZBJ-F is shown in SEQ ID NO.3; The nucleotide sequence of the RLK2-FZBJ-R is shown in SEQ ID NO.

4.

4. The molecular marker according to claim 3, characterized in that The primers used for high-throughput detection of the molecular marker include RLK2-k1-FAM:, RLK2-k1-HEX and RLK2-k1-R; The nucleotide sequence of the RLK2-k1-FAM is shown in SEQ ID NO.5; The nucleotide sequence of the RLK2-k1-HEX is shown in SEQ ID NO.6; The nucleotide sequence of the RLK2-k1-R is shown in SEQ ID NO.

7.

5. Use of the molecular marker described in claim 3 in corn breeding.

6. The use according to claim 5, characterized in that: The molecular marker is used to identify the disease resistance and susceptibility traits of corn ear rot.

7. The use according to claim 6, characterized in that: The material in which the nucleotide sequence of the molecular marker is detected is a disease-resistant material for corn ear rot.

8. The use according to claim 7, characterized in that: The method for corn breeding using the molecular markers is as follows: The genotype of the molecular marker site in the corn genome is detected, corns with genotypes of GCTG are selected as parents for breeding, and disease-resistant offspring of corn ear rot are harvested.

Images