Brucella immunosuppressive gene BtpB deletion vaccine as well as preparation method and application thereof

Abstract

The invention provides a Brucella immunosuppressive gene BtpB deletion vaccine as well as a preparation method and application thereof, and belongs to the technical field of vaccine strains. The invention provides a suicide plasmid for knocking out a BtpB gene in a bovine brucella A19 vaccine strain and a gene deletion strain prepared on the basis of the suicide plasmid, and the BtpB gene deletion is performed on the brucella A19 strain so as to achieve the purpose of modifying the A19 vaccine. The A19 delta BtpB deletion strain constructed by the invention can reduce damage to host visceral organs, can induce a mouse to generate a high-titer Brucella specific antibody IgG, can better induce the mouse to generate Th1 type cytokines, and can provide better protective efficacy for the mouse than an A19 vaccine strain, so that the A19 delta BtpB deletion strain can be used as a vaccine for the mouse. The A19 delta BtpB deletion strain is expected to become a novel Brucella gene deletion vaccine candidate, and a theoretical basis and a data support are provided for developing a novel Brucella gene deletion vaccine.

Description

Technical Field

[0001] The present invention belongs to the technical field of vaccine strains, and in particular relates to a Brucella immunosuppressive gene BtpB deletion vaccine and a preparation method and application thereof. Background Art

[0002] Brucellosis (Brucellosis) is a global zoonosis that seriously endangers the health of humans and mammals, and also seriously affects the development of animal husbandry. In my country's cattle industry, Brucella is very harmful to cattle. After being infected with Brucella, bulls will experience symptoms such as orchitis and epididymitis, and the quality of sperm will also be significantly reduced; cows may suffer from symptoms such as miscarriage.

[0003] At present, vaccination is one of the important means of preventing and controlling brucellosis. The vaccines used for Brucella in my country mainly include attenuated vaccines of bovine Brucella A19 strain, attenuated vaccines of meow Brucella M5 strain, attenuated vaccines of meow Brucella Rev.1 and attenuated vaccines of swine Brucella S2 strain. The vaccines under development mainly include genetically engineered attenuated live vaccines and genetically engineered live vector vaccines. Among them, genetically engineered attenuated live vaccines are obtained by removing the virulence genes of Brucella through molecular biological methods and retaining protective antigens to obtain Brucella vaccine strains. Genetically engineered attenuated live vaccines are relatively safe, and serology or etiology can be used to distinguish between vaccine strains and wild strains. Current studies have shown that the protective power of vaccine strains is related to the virulence of vaccines. The stronger the virulence, the better the protection, so safety and protection should be considered comprehensively.

[0004] After the virulence genes of Brucella were studied, new genetically engineered vaccines were developed by optimizing the virulence genes of strong strains and wild strains separated by genetic engineering deletion. Studies have been conducted to knock out genes related to lipopolysaccharide (LPS) synthesis through molecular biological methods to obtain rough gene-deficient strains. B. melitensis 16M and B. suis 2579 were obtained by mutation of the wbo A gene to obtain rough strains VTRM1 and VTRS1, respectively. These two strains were inserted with Tn5 and had kanamycin resistance. Mouse experiments showed that these two strains were protective, but less than S19. The disadvantage of genetically engineered vaccines is that the strains are overly weakened, resulting in insufficient protection of the vaccine; there are also targeted mutants that lack the outer membrane fusion protein OMP19 gene, but the protection period is short in the mouse model, and vaccine evaluation shows that the protection level is equivalent to that of S19 and RB51. The formyltransferase (wbk C) gene (a key gene involved in lipopolysaccharide biosynthesis) was deleted to form a rough mutant, which was more attenuated than the smooth S19 strain and had lower protective immunity to mice. The construction of Brucella genetically engineered attenuated live vaccines requires careful consideration of the virulence genes to be removed, while retaining the original protective antigens of Brucella, reducing the virulence of Brucella and improving the immune effect of the vaccine. Summary of the invention

[0005] The present invention provides a Brucella immunosuppressive gene BtpB deletion vaccine and a preparation method and application thereof. The A19ΔBtpB deletion strain has better protective efficacy than the A19 vaccine strain.

[0006] The invention provides a method for constructing a suicide plasmid for knocking out the BtpB gene in a bovine Brucella A19 vaccine strain, comprising the following steps: cloning an upstream homology arm gene, a downstream homology arm gene and a kanamycin resistance gene of the BtpB gene of the bovine Brucella A19 vaccine strain respectively, performing a first amplification using a mixed fragment of the cloned upstream homology arm gene, the downstream homology arm gene and the kanamycin resistance gene as a template, and performing a second amplification using a product of the first amplification as a template to obtain a fusion fragment containing the upstream homology arm gene, the downstream homology arm gene and the kanamycin resistance gene of the BtpB gene;

[0007] The fusion fragment is connected to the PUC57 vector to obtain the suicide plasmid.

[0008] In one embodiment of the present invention, the primer pair for cloning the upstream homology arm gene of the BtpB gene of the bovine Brucella A19 vaccine strain includes a nucleotide sequence such as Bup-F shown in SEQ ID No.1 and a nucleotide sequence such as Bup-R shown in SEQ ID No.2;

[0009] The primer pair for cloning the downstream homology arm gene of the BtpB gene of the bovine Brucella A19 vaccine strain includes a nucleotide sequence of B down-F as shown in SEQ ID No.3 and a nucleotide sequence of B down-R as shown in SEQ ID No.4;

[0010] The primer pair for cloning the kanamycin resistance gene of the BtpB gene of the Brucella bovis A19 vaccine strain includes kana-F with a nucleotide sequence as shown in SEQ ID No.5 and kana-R with a nucleotide sequence as shown in SEQ ID No.6.

[0011] In one embodiment of the present invention, the template for the first amplification is an equal volume mixture of the amplified upstream homology arm gene, downstream homology arm gene and kanamycin resistance gene.

[0012] In one embodiment of the present invention, the second amplification primer pair includes Bup-F and Bdown-R.

[0013] The present invention also provides a suicide plasmid constructed by the above construction method.

[0014] The present invention also provides a method for constructing a Brucella A19ΔBtpB deletion strain, comprising the following steps: transferring the suicide plasmid into Brucella A19 competent cells, culturing for a period of time, coating the cells on a Brucella solid culture plate with kanamycin resistance, and the positive colonies are the Brucella A19ΔBtpB deletion strain.

[0015] In one embodiment of the present invention, the culture temperature is 35-38° C., the culture is accompanied by shaking, the shaking frequency is 150-180 r / min, and the culture time is 18-28 h;

[0016] After plating on a solid culture plate of Brucella with kanamycin resistance, the culture is further cultured at 37°C for 36 to 72 hours.

[0017] The present invention also provides a Brucella A19ΔBtpB deletion strain constructed by the above construction method.

[0018] The present invention also provides the use of the Brucella A19ΔBtpB deletion strain in preparing a gene deletion strain vaccine.

[0019] The present invention also provides a gene-deficient vaccine, which uses the Brucella A19ΔBtpB deletion strain as an active ingredient.

[0020] Beneficial effects: The present invention provides a suicide plasmid for knocking out the BtpB gene in the bovine Brucella A19 vaccine strain and a gene-deficient strain prepared based on the suicide plasmid, and the BtpB gene is deleted on the Brucella A19 strain to achieve the purpose of transforming the A19 vaccine. The A19ΔBtpB deletion strain constructed by the present invention can reduce the damage to the host organs compared with the A19 vaccine strain. The A19ΔBtpB deletion strain can induce mice to produce high-titer Brucella-specific antibodies IgG, and can better induce mice to produce Th1-type cytokines. The A19ΔBtpB deletion strain can provide mice with better protective efficacy than the A19 vaccine strain. Therefore, the A19ΔBtpB deletion strain is expected to become a candidate for a new Brucella gene-deficient vaccine, providing a theoretical basis and data support for the development of a new Brucella gene-deficient vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The result diagram of the target gene fragment amplification product, in which A represents the amplification of the BtpB-N gene fragment; B represents the amplification of the BtpB-C gene fragment; C represents the amplification of the Kana gene fragment; and D represents the amplification of the fusion gene fragment of the BtpB-N, Kana and BtpB-C fragments;

[0022] Figure 2 This is the PCR verification result of Brucella A19ΔBtpB deletion strain;

[0023] Figure 3 This is the result graph of BtpB mRNA transcription level in A19ΔBtpB deletion strain;

[0024] Figure 4 are the growth curves of strain A19 and A19ΔBtpB deletion strain;

[0025] Figure 5 This is a graph showing the survival results of the A19 strain and the A19ΔBtpB deletion strain under different stress conditions;

[0026] Figure 6 This is a graph showing the intracellular survival results of the A19 strain and the A19ΔBtpB deletion strain;

[0027] Figure 7 Figure 2 shows the adhesion and invasion results of the A19 strain and the A19ΔBtpB deletion strain;

[0028] Figure 8 The figure shows the weight change (g) of mice in each group 0-20 days after immunization with A19 strain and A19ΔBtpB deletion strain;

[0029] Fig. 9 Serum biochemical indexes of mice in each group 21 days after immunization, A represents ALT, B represents BUN, and C represents LDH;

[0030] Fig.10 This is the result of indirect ELISA detection of mouse specific antibody IgG;

[0031] Fig.11 The results of the transcription levels of the main TLRs receptors in spleen lymphocytes of mice in each group are shown in the figure;

[0032] Fig.12 The results of the transcription levels of major cytokines in spleen lymphocytes of mice in each group are shown in the figure;

[0033] Fig.13 This is the result of ELISpot detection of IFN-γ expression level in mouse lymphocytes;

[0034] Fig.14 This is the result diagram of mouse T lymphocyte subset classification;

[0035] Fig.15 This is the result diagram of mouse IFN-γ positive CD4+ and CD8+ T lymphocytes;

[0036] Fig.16 This is a comparison of mouse IFN-γ positive CD4+ and CD8+ T lymphocytes. DETAILED DESCRIPTION

[0037] The invention provides a method for constructing a suicide plasmid for knocking out the BtpB gene in a bovine Brucella A19 vaccine strain, comprising the following steps: cloning an upstream homology arm gene, a downstream homology arm gene and a kanamycin resistance gene of the BtpB gene of the bovine Brucella A19 vaccine strain respectively, performing a first amplification using a mixed fragment of the cloned upstream homology arm gene, the downstream homology arm gene and the kanamycin resistance gene as a template, and performing a second amplification using a product of the first amplification as a template to obtain a fusion fragment containing the upstream homology arm gene, the downstream homology arm gene and the kanamycin resistance gene of the BtpB gene;

[0038] The fusion fragment is connected to the PUC57 vector to obtain the suicide plasmid.

[0039] In the present invention, the Type Four Secretion System (T4SS) is one of the important virulence factors of Brucella. Brucella depends on the T4SS system encoded by the VirB operon to survive and replicate in host cells, causing the body to become ill. BtpB is one of the important effector molecules of T4SS. Studies have shown that BtpB is present in all Brucella species. It consists of 292 amino acids. BtpB is related to immunosuppressive function. BtpB can effectively inhibit TLR2, TLR4 and TLR9 signal transduction. In addition to controlling inflammatory responses, BtpB has also been shown to interact with phosphoinositides on the cell membrane and regulate microtubule dynamics. In addition, the total level of NAD in the host cell can be downregulated by direct enzymatic hydrolysis of metabolic cofactors, thereby directly controlling the host energy metabolism. Therefore, the present invention explores the function of BtpB by constructing an A19ΔBtpB deletion strain, including the effects on Brucella intracellular survival, adhesion and invasion, and in vitro stress. In addition, mice were immunized with the A19 strain and the A19ΔBtpB deletion strain to study the effect of BtpB deletion on the immunogenicity of the Brucella A19 strain.

[0040] When constructing the suicide plasmid, the present invention first searches for the upstream and downstream homologous arm genes and the kanamycin resistance gene of the BtpB gene of bovine Brucella A19 in NCBI, designs the upstream and downstream homologous arms of the BtpB gene, the Kan gene and the BtpB primers by PrimerPremier 6.0, and synthesizes them by Qingdao Ruiboxingke Biotechnology Co., Ltd. The primer sequences are shown in Table 1, and the upstream homologous arm gene (BtpB-N) of the BtpB gene of the bovine Brucella A19 vaccine strain is cloned by Bup-F / R, the downstream homologous arm gene (BtpB-C) of the BtpB gene of the bovine Brucella A19 vaccine strain is cloned by Bdown-F / R, and the kanamycin resistance gene (K) of the BtpB gene of the bovine Brucella A19 vaccine strain is cloned by kana-F / R.

[0041] When performing the amplification, in a specific embodiment of the present invention, PCR amplification is performed using heat-killed bovine Brucella A19 as a template, and the PCR amplification program can be 95°C 3min; 94°C 45s, 53°C 30s, 72°C 90s, for a total of 35 cycles. The present invention performs gel recovery on each PCR reaction product, and adopts a nested PCR method to mix BtpA-N, Kana and BtpA-C genes in a ratio of 1:1:1 as templates for two-stage amplification. In the embodiment of the present invention, the first PCR amplification is performed using the template, 95°C 3min; 94°C 45s, 53°C 60s, 72°C 90s, for a total of 15 cycles; the present invention uses the product of the first PCR amplification as a template, and uses primers B upper-F and B lower-R to amplify the full length, and the amplification program includes 95°C 3min; 94°C 45s, 53°C 30s, 72°C 90s, for a total of 35 cycles. The product obtained by the second amplification of the present invention is a full-length fragment. After the PCR amplification product is recovered, it is connected to the PUC57 vector to construct the PUC57-BtpB-Kan suicide plasmid.

[0042] Table 1 Target gene amplification primers

[0043] Primers Primer sequence 5'-3' SEQ ID No. B up - F AAACCTTGTTGACTGACGCATAC 1 B-R TGCATATTCCTCGCTAAGTTCGA 2 B-F TTACCGCCAGTCTAATCGGTAG 3 B-R GTGTCGAATGACACGATAAATTGC 4 Kana-F GCCACCTGGGATGAATGTC 5 Kana-R CGGTCATTTCGAACCCCAGA 6 BtpB-F CTTCCTGACGGTAGCAGACTT 7 BtpB-R ACGACGGCAGAGTTATTCCTT 8

[0044] The present invention also provides a suicide plasmid constructed by the above construction method.

[0045] The present invention also provides a method for constructing a Brucella A19ΔBtpB deletion strain, comprising the following steps: transferring the suicide plasmid into Brucella A19 competent cells, culturing for a period of time, coating the cells on a Brucella solid culture plate with kanamycin resistance, and the positive colonies are the Brucella A19ΔBtpB deletion strain.

[0046] In a specific embodiment of the present invention, firstly, Brucella A19 strain is used to prepare Brucella competent cells; after the PUC57-BtpB-Kan suicide plasmid constructed above is eluted with deionized water, 3 to 8 μL of the plasmid is added to the Brucella competent cells, mixed and ice-bathed for 10 minutes, added to the pre-cooled electric shock cup, and then 1 mL of 37°C preheated Brucella liquid culture medium is added after 1800V voltage electric shock, and cultured in a shaker at any temperature of 35 to 38°C, such as 37°C, and any speed of 150 to 180r / min, such as 170r / min, for 18 to 28h, such as 24h, and then coated on a Brucella solid culture plate with kana resistance, 37°C, cultured for 36 to 72h, such as 48h, and then the positive colonies are picked. The positive colonies are continuously identified by PCR, and the correct identification is the Brucella A19ΔBtpB deletion strain.

[0047] The present invention also provides a Brucella A19ΔBtpB deletion strain constructed by the above construction method.

[0048] Compared with the parent strain A19, the Brucella A19ΔBtpB deletion strain of the present invention has a significantly reduced expression level of the BtpA gene, and successfully deleted the BtpB gene; and the A19ΔBtpB deletion strain does not affect the growth and viability of the strain after the BtpA gene is deleted, and the A19ΔBtpB deletion strain reduces the damage to the host organs compared to the A19 vaccine strain. The A19ΔBtpB deletion strain can induce mice to produce high titers of Brucella-specific antibodies IgG, and can better induce mice to produce Th1-type cytokines. The A19ΔBtpB deletion strain can provide mice with better protective efficacy than the A19 vaccine strain. Therefore, the A19ΔBtpB deletion strain is expected to become a candidate for a new Brucella gene deletion vaccine.

[0049] The present invention also provides the use of the Brucella A19ΔBtpB deletion strain in preparing a gene deletion strain vaccine.

[0050] The present invention also provides a gene-deficient vaccine, which uses the Brucella A19ΔBtpB deletion strain as an active ingredient.

[0051] To further illustrate the present invention, a Brucella immunosuppressive gene BtpB deletion vaccine provided by the present invention and its preparation method and application are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0052] In the embodiments of the present invention, the experimental animals used are female 6-8 week old ICR mice purchased from the Animal Experiment Center of Xinjiang Medical University; and when conducting the experiment, the main materials used are also commercially available products: the bovine Brucella A19 vaccine strain was purchased from Tiankang Biological Co., Ltd.; Escherichia coli DH5α competent cells, PUC57 vectors and RAW264.7 cells were all preserved by the Collaborative Innovation Center for Sheep Health Breeding and Zoonotic Disease Prevention and Control; T4 DNA ligase, agarose gel recovery kit, and DNAMarker were all purchased from TaKaRa; the plasmid DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; the electric shock cup was purchased from Bio-Rad; the Brucella indirect enzyme-linked immunosorbent antibody detection kit was purchased from Harbin Pinghe Biotechnology Co., Ltd.; the mouse IFN-γ enzyme-linked immunosorbent assay (ELISpot) detection kit was purchased from Beijing Xinbosheng Biotechnology Co., Ltd.

[0053] Example 1

[0054] 1. Construction of BtpB suicide plasmid

[0055] 1.1 Primer design and synthesis

[0056] Qingdao Ruiboxingke Biotechnology Co., Ltd. was commissioned to synthesize the sequences shown in Table 1.

[0057] 1.2 Construction and identification of suicide plasmid

[0058] Using heat-killed bovine Brucella A19 as a template, primers Bup-F, Bup-R and Bdown-F, Bdown-R were used to amplify the upstream homology arm (BtpB-N) and downstream homology arm (BtpB-C) of BtpB, respectively, and KF and KR were used to amplify the kanamycin resistance gene (K). After the PCR reaction was completed, it was verified by 1.0% agarose gel electrophoresis, and gel recovery was performed after verification. Using the nested PCR method, the BtpA-N, Kana and BtpA-C genes were mixed in a ratio of 1:1:1. In the first stage, the BtpB-N, Kana and BtpB-C gene fragments recovered from the gel were used as templates for PCR amplification; in the second stage, the PCR product of the first stage was used as a template, and the full length was amplified using primers Bup-F and Bdown-R, and then the full-length fragment was recovered. The PCR amplification product was verified by 1.0% agarose gel electrophoresis, and gel recovery was performed after verification. The obtained fusion fragment was connected to the PUC57 vector plasmid at a ratio of 3:1 to construct the PUC57-BtpB-Kan suicide plasmid. After the suicide plasmid was transformed into E. coli DH5α competent cells, it was spread on LB solid medium with ampicillin and kanamycin resistance to screen positive colonies.

[0059] The positive colonies were identified by PCR using primers Bup-F and Bdown-R. After successful identification, they were sent to Qingdao Ruibo Xingke Biotechnology Co., Ltd. for gene sequencing identification. Figure 1 As shown, the specific bands of BtpB-N size is 375 bp, BtpB-C size is 334 bp, Kana size is 1093 bp and the fusion fragment size is 1817 bp ( Figure 1 The fragment sizes in (A, B, C, and D) were consistent with the expected sizes, indicating successful amplification.

[0060] 2. Construction and screening of Brucella A19ΔBtpB deletion strain

[0061] Brucella A19 strain was cultured to the logarithmic growth phase (OD 600≈0.6), incubate on ice for 10-15min, collect the bacteria by centrifugation, wash twice with sterile deionized water, wash once with 15% glycerol water, and finally resuspend the bacteria with an appropriate amount of 15% glycerol water to prepare Brucella competent cells. After eluting the constructed PUC57-BtpB-Kan suicide plasmid with deionized water, take 3-8μL of the plasmid (the plasmid concentration is controlled at 500-1500ng / μL) and add it to the Brucella competent cells, mix well in an ice bath for 10min, add it to the pre-cooled electric shock cup, add 1mL of 37℃ preheated Brucella liquid culture medium after 1800V voltage electric shock, culture in a shaker at 37℃, 170r / min for 24h, and then spread it on a Brucella solid culture plate with kana resistance, and pick positive colonies after culturing at 37℃ for 48h. The positive colonies were continuously identified by PCR, and the correct one was the Brucella A19ΔBtpB deletion strain. Agarose gel electrophoresis showed that the 1817bp suicide plasmid gene was successfully amplified ( Figure 2 ), successfully amplified the 1605bp parent strain gene ( Figure 2 ), the amplified fragment of strain A19 was slightly smaller than the constructed BtpB gene deletion strain. The internal gene (143 bp in size) was amplified from the parent strain using primers BtpB-F and BtpB-R. Figure 3 ), while the BtpB gene deletion strain could not amplify the internal gene. This indicated that the Brucella BtpB gene deletion strain A19ΔBtpB was successfully constructed.

[0062] 3. qRT-PCR detection of BtpB mRNA transcription level in A19ΔBtpB deletion strain

[0063] Brucella A19 strain and the successfully identified A19ΔBtpB deletion strain were cultured to the logarithmic growth phase (OD 600 ≈0.6), heat inactivated, RNA extracted with RNA extraction kit, and reverse transcribed into cDNA with reverse transcription kit. Fluorescence real-time quantitative PCR was used to detect the transcription level of BtpB mRNA using the extracted bacterial cDNA of A19 strain and A19ΔBtpB deletion strain as templates and 16S as internal reference gene. The primer sequences are shown in Table 2. The reaction conditions were: 95℃30s, 95℃5s, 60℃10s, 72℃15s, 40 cycles. -ΔΔCt The relative quantitative analysis was performed by the same method. The experiment was repeated three times under the same conditions. Figure 3 As shown, compared with the parental strain A19, the expression level of BtpB gene in the A19ΔBtpB deletion strain was significantly reduced (P<0.001), indicating that the BtpB gene was successfully deleted.

[0064] Table 2 qRT-PCR primer sequences

[0065] Primers Primer sequence 5'-3' SEQ ID No. BtpB-F CCTTCCTGACGGTAGCAGACTT 9 BtpB-R TCCACGACGGCAGAGTTATTCC 10 16S-F ACTAAGGGCGAGGGTTGC 11 16S-R CACTGGACCATTACTGACGC 12

[0066] 4. Growth curve determination of Brucella A19 and A19ΔBtpB strains

[0067] The monoclonal colonies of strain A19 and strain A19ΔBtpB were selected from the Brucella solid culture plate and inoculated into 20 mL Brucella liquid culture medium and cultured in a shaking incubator at 37°C and 180 rpm until OD 600 ≈0.5, and then diluted to OD 600 ≈0.2, cultured in a shaking incubator at 37°C and 180 r / min. Samples were taken every 2 hours to test the concentration until the growth of each bacterium entered the stationary phase. Figure 4 It can be seen that the overall trends of the growth curves of the A19 strain and the A19ΔBtpB deletion strain are consistent, reaching the logarithmic growth phase at around 10 hours and the plateau phase at around 20 hours.

[0068] 5. In vitro stress test of Brucella A19 and A19ΔBtpB strains

[0069] The A19 strain and A19ΔBtpB strain were cultured to the logarithmic growth phase and centrifuged to collect the bacteria. 1×10 8 The number of bacteria was inoculated into Brucella liquid medium at 58℃, Brucella liquid medium at pH 4.5, Brucella liquid medium at pH 11.5, Brucella liquid medium containing 1.5mol / LNaCl and normal Brucella liquid medium, and cultured in a shaker at 37℃ and 180r / min for 30min. After centrifugation, the bacteria were resuspended in PBS, diluted 1000 times, and spread on Brucella solid medium. CFU was counted after inverted culture at 37℃ for 48h.

[0070] The results are as follows Figure 5 As shown, there was no significant difference in the survival rate of A19 and A19ΔBtpB deletion strains under high temperature, acidic, alkaline and hyperosmotic stress conditions.

[0071] 6. Intracellular survival test of Brucella A19 and A19ΔBtpB strains

[0072] Cultured mouse macrophages RAW264.7 were cultured at 1×10 6 / well inoculated in a 6-well plate, cultured until adhered to the wall to form a monolayer of cells. Brucella A19 and A19ΔBtpB in the logarithmic growth phase were infected with an MOI of 100:1 and incubated in a 37°C, 5% CO2 incubator for 1 hour. Add 2.5% gentamicin and continue incubation for 45 minutes. Wash with PBS three times, add DMEM containing 10% FBS, and discard the culture medium after 0, 4, 12, 24, and 48 hours, wash with PBS three times, lyse the cells with 0.01% TritionX-100, release the intracellular bacteria, dilute 100 times, and spread on the Brucella solid culture medium, and count the CFU.

[0073] The results are as follows Figure 8 As shown, by analyzing the number of Brucella A19 and A19ΔBtpB strains surviving in macrophages at different time periods, it was found that there was no significant difference in the overall trend between the parent strain A19 and the deletion strain A19ΔBtpB.

[0074] 7. Adhesion and invasion test of Brucella A19 and A19ΔBtpB strains

[0075] RAW264.7 counted at 1×10 6 Cells were plated in 6-well plates until they adhered to the wall to form a monolayer of cells. The activated Brucella parent strain A19 and the deletion strain A19ΔVirB were infected with an MOI of 100:1, and extracellular bacteria were killed with gentamicin 15, 30, and 45 minutes after infection. The cells were washed with PBS three times, lysed with 0.01% Triton X-100, diluted 100 times, and then spread on Brucella solid culture medium, and CFU was counted.

[0076] The results are as follows Figure 7 As shown, there was no significant difference in the number of adhesion and invasion of Brucella A19 and A19ΔBtpB deletion strains on macrophages at different time periods.

[0077] 8. Animal testing

[0078] ICR female mice aged 4 to 6 weeks were divided into A19, A19ΔBtpA and PBS groups, and 8 mice were immunized in each group. A19 and A19ΔBtpB were immunized at 1×10 5 The mice were inoculated with CFU / mouse by intraperitoneal injection. The tails of the mice were cut off and blood was collected on days 7, 14, 21, 28 and 35 after immunization. The serum was separated by centrifugation and stored at -20°C for future use.

[0079] 8.1 Safety evaluation of A19 vaccine and A19ΔBtpB deletion strain

[0080] After the A19 vaccine and the A19ΔBtpB deletion strain were immunized according to the vaccination program, the safety of the A19 vaccine and the A19ΔBtpB deletion strain was comprehensively evaluated by observing the clinical manifestations of the mice and serum biochemical analysis. The mice in each group (PBS group, A19 group, A19ΔBtpB) were observed continuously for 21 days, and the mental state and weight changes of the mice were observed every 2 days. In addition, the serum of mice in each group was collected for biochemical analysis 21 days after immunization, and the lactate dehydrogenase (LDH), alanine aminotransferase (ALT) and urea nitrogen (BUN) of the mice were detected to reflect the effects of the vaccine on the heart, liver and kidney functions of the mice. The health of the mice was observed for 3 consecutive weeks. Compared with the PBS group, the mice vaccinated with the A19 vaccine and the A19ΔBtpB deletion strain did not have messy and dull hair, ate normally, and had no significant changes in body weight, which was no different from the PBS group ( Figure 8 ). The results of biochemical analysis showed that compared with the A19 group, the A19ΔBtpB group had significantly decreased serum ALT and LDH indexes, while there was no significant difference in BUN index ( Fig. 9 ), it is speculated that the A19ΔBtpB deletion strain can cause less damage to liver and myocardial function than the A19 vaccine.

[0081] 8.2 Indirect ELISA to detect Brucella-specific antibodies in mice

[0082] The mice were tail-cut and blood was collected. The mouse serum was collected at 7, 14, 21, 28, and 35 days. The Brucella antibody content in the immunized mice was detected using a mouse Brucella antibody detection kit to monitor the humoral immunity level of the immunized mice.

[0083] The results are as follows Fig.10 As shown, at different time points, the levels of Brucella-specific antibodies in the A19 and A19ΔBtpB groups were significantly higher than those in the PBS control group, while the trends of induced antibody levels between the A19 and A19ΔBtpB groups were the same, indicating that the A19ΔBtpB deletion strain can also induce mice to produce Brucella-specific antibody IgG equivalent to that of the A19 strain.

[0084] 8.3 qRT-PCR detection of cytokine and TLRs mRNA transcription levels

[0085] The mice were killed at 7, 14, and 21 days after immunization, and the spleens were isolated. Mouse lymphocytes were obtained and counted according to the instructions of the mouse lymphocyte isolation kit. RNA was extracted from the lymphocytes of each group of mice and reverse transcribed into cDNA using a reverse transcription kit. Fluorescence real-time quantitative PCR instrument, using the cDNA of lymphocytes of each group of mice in the reversed trip as template and GAPDH as internal reference gene, detected the transcription levels of IL-4, IL-6, IL-10, IL-12, TNF-α mRNA and TLR2, TLR4, TLR9 mRNA in lymphocytes of each group of mice at 7, 14, and 21 days. The primer sequences are shown in Table 3. The reaction conditions were: 95℃30s, 95℃5s, 58℃10s, 72℃15s, 35 cycles. 2 -ΔΔCt The relative quantitative analysis was performed by the same method. Three experiments were repeated under the same conditions.

[0086] The results showed that the expression levels of TLR2 and TLR4 induced by A19ΔBtpB group were significantly higher than those of A19 group at 14 and 21 days after immunization (P<0.05; P<0.001; Fig.11 ). In inducing host cell factor expression ( Fig.12 ), the expression level of IL-10 in the A19ΔBtpB group was significantly lower than that in the A19 group at 7d and 21d after immunization (P<0.001), the expression of IL-4 in the A19ΔBtpB group was significantly lower than that in the A19 group at 7d after immunization (P<0.01), and the expression of IL-6 was significantly higher than that in the A19 group (P<0.01), and the expression of IL-12 in the A19ΔBtpB group was significantly higher than that in the A19 group at 14d after immunization (P<0.01), The expression of TNF-α in the A19 group was significantly higher than that in the A19 group at 14 and 21 days after immunization (P<0.05). This part of the results shows that immunization with the A19ΔBtpB deletion strain can activate downstream immune responses through different TLRs receptors, and at different time periods, immunization with the A19ΔBtpB deletion strain can induce increased expression of Th1 cytokines IL-6, IL-12 and TNF-α, and decreased expression of Th2 cytokines IL-4 and IL-10.

[0087] Table 3 qRT-PCR primer sequences

[0088]

[0089]

[0090] 8.4ELISpot detection of IFN-γ expression level in mouse spleen lymphocytes

[0091] The mice were killed 21 days after immunization, and the spleen was isolated. Mouse lymphocytes were obtained and counted according to the instructions of the mouse lymphocyte isolation kit. The isolated mouse spleen lymphocytes were diluted to 2×10 6 / mL, added to the ELISpot plate, and then added 10μL of concanavalin A (ConA) (100μg / mL), 10μL A19 and A19ΔBtpB (1×105 CFU / well), and 10μL PBS, as ConA-stimulated A19, A19ΔBtpB and PBS groups (A19+ConA, A19ΔBtpB+ConA and PBS+ConA), A19 group, A19ΔBtpB group and PBS control group, each group repeated 3 wells. After culturing at 37°C for 24h, 100μL of IFN-γ antibody (R4-6A2-biotin) diluted to 1μg / mL in PBS containing 0.5% fetal bovine serum was added and incubated for 2h; then 100μL of streptavidin-horseradish peroxidase (1:1000) was added, and after incubation at room temperature for 1h, 100μL of substrate solution (BCIP / NBT-plus) was added for color development until obvious spots appeared, and the reaction was terminated by rinsing with tap water. The spots were counted using AELVIS ELISpot Reader. The ELISpot detection results showed that ( Fig.13 ), compared with the PBS group, the expression level of IFN-γ in lymphocytes in the A19 and A19ΔBtpB groups was extremely significantly increased (P<0.01; P<0.001). Compared with the A19 group, the expression level of IFN-γ in lymphocytes in the A19ΔBtpB group was significantly increased (P<0.05).

[0092] 8.5 Flow cytometry detection of CD4+ and CD8+ T cell expression levels in mouse spleen lymphocytes

[0093] Mouse lymphocytes were separated and incubated with FITC anti-mouse CD4+ and PE anti-mouse CD8+ antibodies, and T lymphocyte subsets were determined and analyzed by flow cytometry to obtain the number of CD4+ and CD8+ T lymphocytes in spleen cells.

[0094] The results are as follows Fig.14 As shown in the figure, the positive rates of CD4+ and CD8+ T cells in the A19 group and the A19ΔBtpB group were significantly higher than those in the PBS group (P<0.001). The positive rate of CD4+ T cells in the A19ΔBtpB group was significantly lower than that in the A19 group (P<0.001), and the positive rate of CD8+ T cells was similar to that in the A19 group.

[0095] 8.6 Detection of IFN-γ-positive CD4+ and CD8+ T lymphocytes in mouse spleen by flow cytometry

[0096] Randomly kill mice in each group 21 days after immunization, and obtain mouse lymphocytes according to the method in 8.4. Add 2μL FITC anti-mouse CD4+, PE anti-mouse CD8+ and PerCP / Cyanien5.5anti-mouse IFN-γ antibodies respectively, incubate at room temperature in the dark for 15-30min; add 2mL 1× red blood cell lysis buffer to 100μL whole blood, and lyse in the dark for 8-12min. Add 1mL PBS, centrifuge at 1000r / min for 5min, wash cells, and discard supernatant after centrifugation; use flow cytometry to determine and analyze T lymphocyte subsets, and obtain the number of CD4+ and CD8+ T lymphocytes in spleen cells.

[0097] The results are as follows Fig.15 As shown, the IFN-γ positive CD4+ and CD8+ T lymphocytes in the A19 group and the A19ΔBtpB group were significantly higher than those in the PBS group (P<0.001); the IFN-γ positive CD4+ and CD8+ T lymphocytes in the A19ΔBtpB group were significantly higher than those in the A19 group (P<0.05). This indicates that the A19ΔBtpB deletion strain can better induce CD4+ and CD8+ T lymphocytes to express IFN-γ than the A19 vaccine strain. The ability of the A19ΔBtpB deletion strain to induce CD4+ T cells is lower than that of the other two groups, but the A19ΔBtpB deletion strain can better induce T cells to express IFN-γ, which is crucial for the elimination of Brucella.

[0098] 8.7 Challenge protection test

[0099] The challenge test was carried out according to the OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. 42 days after immunization, mice were infected with B. melitensis M28 at 2×10 5 The CFU / mouse was measured by intraperitoneal injection into mice. The body weight and spleen were weighed 14 days after the challenge, and the skin index was calculated. In addition, the corresponding samples were collected, the spleen was placed in a sterile centrifuge tube, 500 μL PBS was added, and it was placed in a frozen tissue grinder for homogenization. The tissue homogenate was divided into the original solution, 10 -1 , 10 -2 , 10 -3 Dilution was performed, and 100 μL of each dilution was spread on the solid identification medium of Brucella, and cultured in an incubator at 37°C for 3-4 days, and the number of single colonies on each plate was recorded. The experimental observation found that the spleen of the mouse control group was severely infiltrated and swollen. Fig.16As shown in Table 4, the spleen index of mice in the control group was significantly higher than that in other groups (P<0.01); compared with the A19 group, the spleen index of the A19ΔBtpB group was significantly lower (P<0.01). The results of the bacterial content in the mouse spleen are shown in Table 4. After the M28 virulent strain was used to challenge the virus, only one mouse had no bacteria isolated from the spleen of the mice immunized with the A19 vaccine, and three mice had no bacteria isolated from the A19ΔBtpB deletion strain, while all mice in the non-immunized group were infected with bacteria. This indicates that the protective efficacy of the A19ΔBtpB deletion strain may be better than that of the A19 vaccine strain.

[0100] Table 4 Bacterial content in the spleen of mice after challenge

[0101]

[0102] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for constructing a suicide plasmid for knocking out the BtpB gene in the Brucella bovis A19 vaccine strain, characterized in that: The following steps are involved: The upstream homology arm gene, the downstream homology arm gene and the kanamycin resistance gene of the BtpB gene of the bovine Brucella A19 vaccine strain are cloned respectively, and a mixed fragment of the cloned upstream homology arm gene, the downstream homology arm gene and the kanamycin resistance gene is used as a template for first amplification, and a product of the first amplification is used as a template for second amplification to obtain a fusion fragment containing the upstream homology arm gene, the downstream homology arm gene and the kanamycin resistance gene of the BtpB gene; The fusion fragment is connected to the PUC57 vector to obtain the suicide plasmid.

2. The construction method according to claim 1, characterized in that: The primer pair for cloning the upstream homology arm gene of the BtpB gene of the Brucella bovis A19 vaccine strain includes Bup-F as shown in the nucleotide sequence of SEQ ID No.1 and Bup-R as shown in the nucleotide sequence of SEQ ID No.2; The primer pair for cloning the downstream homology arm gene of the BtpB gene of the Brucella bovis A19 vaccine strain includes Bf-F as shown in SEQ ID No.3 and Bf-R as shown in SEQ ID No.4; The primer pair for cloning the kanamycin resistance gene of the BtpB gene of the Brucella bovis A19 vaccine strain includes kana-F with a nucleotide sequence as shown in SEQ ID No.5 and kana-R with a nucleotide sequence as shown in SEQ ID No.

6.

3. The construction method according to claim 1, characterized in that: The template for the first amplification is a mixed solution of equal volumes of the amplified upstream homology arm gene, downstream homology arm gene and kanamycin resistance gene.

4. The construction method according to claim 2, characterized in that: The second amplification primer pair includes Bupper-F and Blower-R.

5. A suicide plasmid constructed by the construction method according to any one of claims 1 to 4.

6. A method for constructing a Brucella A19ΔBtpB deletion strain, characterized in that: The method comprises the following steps: transferring the suicide plasmid described in claim 5 into Brucella A19 competent cells, culturing for a period of time and coating on a Brucella solid culture plate with kanamycin resistance, wherein the positive colonies are the Brucella A19ΔBtpB deletion strain.

7. The construction method according to claim 6, characterized in that: The culture temperature is 35-38° C., the culture is accompanied by shaking, the shaking frequency is 150-180 r / min, and the culture time is 18-28 h; After plating on a solid culture plate of Brucella with kanamycin resistance, the culture is further cultured at 37°C for 36 to 72 hours.

8. The Brucella A19ΔBtpB deletion strain constructed using the construction method of claim 6 or 7.

9. Use of the Brucella A19ΔBtpB deletion strain according to claim 8 in the preparation of a gene deletion strain vaccine.

10. A gene-deficient vaccine, characterized in that: The Brucella A19ΔBtpB deletion strain described in claim 8 is used as the active ingredient.

Images