Application of MYH9 in oral squamous cell carcinoma

Abstract

The invention belongs to the field of biological medicine, and discloses application of MYH9 in oral squamous cell carcinoma. The research of the inventor finds that (1) MYH9 is significantly up-regulated in OSCC, and in a pathway enrichment result, MYH9 is significantly up-regulated in actin cytoskeleton regulation; (2) the expression level of the MYH9 affects the expression of EMT markers MMP9 and CDH3, and the increase of the expression level of the MMP9 and CDH3 is the characteristic that cells obtain mesenchymal phenotypes in the tumor generation process; (3) proliferation and invasion of OSCC may be regulated and controlled by MYH9, and when the MYH9 gene is knocked down to reduce the expression level of the MYH9 gene, it can be observed that proliferation and invasion of OSCC cells are significantly inhibited; and (4) the high expression of the MYH9 is an important marker for OSCC development, and the reduction of the expression of the MYH9 inhibits OSCC growth and invasion and metastasis to a certain extent, which prompts that the MYH9 is expected to become a target spot for diagnosis and treatment of OSCC.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of MYH9 in oral squamous cell carcinoma. Background Art

[0002] Oral cancer is one of the most common cancers of the head and neck, characterized by rapid cell proliferation, strong cell infiltration ability, and a high risk of cervical lymph node metastasis. According to reports, there were 377,713 new cases of oral cancer worldwide in 2020, of which 177,757 died. More than 90% of oral cancers usually occur in the form of oral squamous cell carcinoma (OSCC), which is the most common manifestation of oral cancer and one of the deadliest cancers of the head and neck. The causes of OSCC are related to a variety of risk factors, such as a long history of smoking, excessive drinking, betel nut consumption, and human papillomavirus (HPV) infection. Since the consumption of betel nut is more common in Asia, Asia is a high-incidence area for OSCC.

[0003] Currently, the most commonly used treatment for OSCC is surgical removal of tissue. There are also other treatment options such as radiotherapy, chemotherapy and immunotherapy. Although the diagnosis and treatment of OSCC have improved in recent years, the survival time of OSCC patients has not been significantly improved because oral malignant keratinocytes can quickly invade the cervical lymph nodes and spread rapidly to other distant parts, which is very invasive. The overall 5-year survival rate is still only about 50%, and most patients die from local recurrence and distant metastasis within 5 years. For patients without metastasis, surgical treatment and radiotherapy have improved the survival rate to a certain extent, but the incidence rate in the later stage has not been reduced. Another reason why the survival rate of OSCC has not been improved is that the disease is not diagnosed in the early stage. Generally speaking, the survival rate of OSCC decreases with the development of TNM staging. The stage of the patient is an important prognostic factor for head and neck cancer. From stage I to stage III, the 5-year survival rate of patients drops from 90% to 60%. For patients who smoke and drink alcohol for a long time, the judgment of early lesions is easily affected, because their symptoms such as sore throat, cough and hoarseness are very similar to the symptoms of other benign diseases. These initial symptoms of head and neck cancer are easily ignored, and patients are not easy to detect whether they are related to cancer lesions. Therefore, head and neck cancer is generally not in the early stage of cancer when diagnosed. This common phenomenon is not conducive to the subsequent treatment and prognosis of the disease. After the successful treatment of OSCC patients, it is also necessary to prevent the generation of new cancer cells in the treated tissue site. There are two reasons for the generation of new cancer cells. One is that the malignant keratinocytes left after the operation have the possibility of continuing to develop. The consequence of their development may be the recurrence of OSCC, or it may be the generation of new cancer cells and develop into other cancers. The other reason is that the keratinocytes in the precancerous epithelial area of ​​the primary cancer have the ability to transform into new cancer cells. The specific cause of OSCC development is still unclear. Therefore, it is urgent to explore and reveal the molecular mechanism of OSCC development through various analytical methods.

[0004] Existing studies have shown that the molecular mechanism of OSCC occurrence and development is extremely complex. Gene loss, mutation, and abnormal activation or inactivation may cause carcinogenesis. The study of abnormal genes in tumors may reveal the relevant mechanisms of tumor occurrence and development from the genetic level. However, since proteins are the executors of life activities and can directly reflect the information of genes, the study of abnormally expressed proteins in tumors has an extraordinary role. During the process of tumor formation, the expression levels of some proteins related to cell growth and movement will change significantly. The study of tumor-related proteins using technologies such as proteomics is of great significance in understanding the molecular mechanisms of disease development, as well as treatment and prevention.

[0005] Proteins are the executors of functions and play a certain role in the growth and invasion of tumors. Therefore, it is necessary to conduct more in-depth research based on existing research for the diagnosis and treatment of OSCC. From the current research at home and abroad, there are still many unknowns in OSCC that need to be explored by inventors. Genomic research has explained some molecular changes in OSCC for humans, and proteomics has also determined OSCC-related signaling pathways based on the relative expression of proteins. However, the functional significance of most gene or protein expression changes and their specific effects on OSCC are still unclear. Summary of the invention

[0006] The object of the present invention is to overcome at least one deficiency of the prior art and provide a use of MYH9 in oral squamous cell carcinoma.

[0007] The technical solution adopted by the present invention is: The first aspect of the present invention provides: Application of reagents for quantifying the amount of MYH9 protein in solid tissue samples in the preparation of diagnostic reagents for oral squamous cell carcinoma.

[0008] The second aspect of the present invention provides: A diagnostic system for oral squamous cell carcinoma, comprising: A MYH9 protein quantification device, used to determine the expression level of MYH9 protein in a tissue sample to be tested; An analytical device for determining the risk of oral squamous cell carcinoma based on the expression of MYH9 protein; The result output device outputs the analysis result of the analysis device.

[0009] In some examples of the diagnostic system, the MYH9 protein quantification device is a liquid chromatography-mass spectrometry system.

[0010] In some examples of the diagnostic system, a significantly increased expression of the MYH9 protein indicates a high risk of oral squamous cell carcinoma.

[0011] In some examples of the diagnostic system, the significantly increased expression level of the MYH9 protein means that its expression level is at least 1.2 times the normal expression level.

[0012] The third aspect of the present invention provides: Application of MYH9 protein expression inhibitor or MYH9 protein specific binding antibody in the preparation of drugs for treating oral squamous cell carcinoma.

[0013] In some application examples, the MYH9 protein expression inhibitor is siRNA targeting MYH9.

[0014] In some application examples, the sequence of the siRNA is forward primer: 5'-AGTTTGTCTCGGAGCTGTGG-3', and reverse primer: 5'-GGTTCGTGTTCCTCAGCGTA-3'.

[0015] A fourth aspect of the present invention provides: The invention relates to the use of a MYH9 protein expression inhibitor in the preparation of an experimental MMP9 or CDH3 downregulator, wherein the use is not used for the treatment of a disease.

[0016] In some application examples, the MYH9 protein expression inhibitor is siRNA targeting MYH9.

[0017] In some application examples, the sequence of the siRNA is forward primer: 5'-AGTTTGTCTCGGAGCTGTGG-3', and reverse primer: 5'-GGTTCGTGTTCCTCAGCGTA-3'.

[0018] A fifth aspect of the present invention provides: A method for screening an anti-oral squamous cell carcinoma drug comprises the following steps: The drug to be screened is applied to MYH9 protein or to cells with high expression of MYH9 protein to detect whether the activity of MYH9 protein is inhibited or whether the expression of MYH9 protein is downregulated, so as to preliminarily determine whether the drug has anti-oral squamous cell carcinoma activity.

[0019] The beneficial effects of the present invention are: The inventors found that: (1) MYH9 was significantly upregulated in OSCC and was found to be significantly upregulated in actin cytoskeleton regulation in pathway enrichment results. The invasion process of tumor cells is usually accompanied by changes in actin cytoskeleton regulation.

[0020] (2) In OSCC, the expression level of MYH9 affects the expression of EMT markers MMP9 and CDH3. During tumorigenesis, the increased expression levels of MMP9 and CDH3 are characteristic of cells acquiring a mesenchymal phenotype.

[0021] (3) The proliferation and invasion of OSCC may be regulated by MYH9. When the MYH9 gene was knocked down to reduce its expression level, it was observed that the proliferation and invasion of OSCC cells were significantly inhibited.

[0022] (4) High expression of MYH9 is an important marker for the development of OSCC. Reduced MYH9 expression inhibits the growth, invasion and metastasis of OSCC to a certain extent, suggesting that MYH9 is expected to become a target for the diagnosis and treatment of OSCC. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 : Experimental flow chart.

[0024] Figure 2 : Length distribution diagram of identified peptides, with the horizontal axis representing the peptide length and the vertical axis representing the number of peptides.

[0025] Figure 3 : The molecular weight distribution of the identified proteins, the horizontal axis is the protein molecular weight, and the vertical axis is the protein quantity.

[0026] Figure 4 : The number of peptides corresponding to the identified proteins. The horizontal axis is the number of peptides contained in each protein, and the vertical axis is the number of proteins.

[0027] Figure 5 : Mass spectra, peptides and protein numbers obtained after mass spectrometry search and analysis of tissues.

[0028] Figure 6 :Statistics of protein expression in tissue samples and the up- and down-regulation ratios of DEPs. (A) The number of up-regulated and down-regulated proteins in tissue sample DEPs; (B) Quantitative protein volcano plot, the horizontal axis represents the expression fold change (log2FC) value of the protein between the experimental group and the control group, and the vertical axis represents the statistically significant protein quantity difference p-value, blue in the scatter plot represents down-regulated proteins, red represents up-regulated proteins, and gray represents insignificant proteins.

[0029] Figure 7 :Clustering analysis and subcellular localization of DEPs. (A) Clustering results of DEPs, the horizontal axis represents the cancer tissue experimental group and the adjacent normal control group, the right color bar represents the expression level, the darker the red, the higher the expression level, and the darker the blue, the lower the expression level; (B) Subcellular localization ratio of DEPs.

[0030] Figure 8 :Distribution of DEGs expression levels. (A) Number of up- and down-regulated DEGs; (B) Volcano plot of genes in the HNSCC dataset, the horizontal axis is the log2FC value of genes in the tumor group and the control group, the vertical axis is the p-value of the statistically significant difference in the number of genes, the blue scatter points are significantly down-regulated genes, and the red scatter points are significantly up-regulated genes.

[0031] Fig. 9 : Intersection of DEGs and DEPs and cluster analysis results. (A) The intersection of DEGs and DEPs, named IPDGs; (B) Cluster analysis of IPDGs, the horizontal axis represents the cancer tissue experimental group and the adjacent normal control group, and the color bar on the right represents the expression level. The darker the red, the higher the expression level, and the darker the blue, the lower the expression level.

[0032] Fig.10 : GO BP enrichment analysis results of upregulated IPDGs, the ordinate is the biological process, the abscissa is the gene enrichment score, the size of each circle is the number of genes (see the right for the quantity standard), and the color is the enrichment p-value (see the right for p-value).

[0033] Fig.11 : GO CC enrichment analysis results of upregulated IPDGs, the ordinate is the name of the molecular component, the abscissa is the enrichment score of the gene, the size of each circle is the number of genes (see the right for the quantity standard), and the color is the p-value of the enrichment (see the right for p-value).

[0034] Fig.12 : GO MF enrichment analysis results of upregulated IPDGs, the ordinate is the molecular function name, the abscissa is the gene enrichment score, the size of each circle is the number of genes (see the right for the quantity standard), and the color is the enrichment p-value (see the right for p-value).

[0035] Fig.13 : GO BP enrichment analysis results of down-regulated IPDGs, the ordinate is the molecular function name, the abscissa is the enrichment score of the gene in the pathway, the size of each circle is the number of genes (see the right for the quantity standard), and the color is the p-value enriched in this pathway (see the right for p-value).

[0036] Fig.14 : GO CC enrichment analysis results of down-regulated IPDGs, the vertical axis is the pathway name, the horizontal axis is the enrichment score of the gene in the pathway, the size of each circle is the number of genes (see the right for the quantity standard), and the color is the p-value enriched in this pathway (see the right for p-value).

[0037] Fig.15 : GO MF enrichment analysis results of down-regulated IPDGs, the vertical axis is the pathway name, the horizontal axis is the enrichment score of the gene in the pathway, the size of each circle is the number of genes (see the right for the quantity standard), and the color is the p-value of the enrichment (see the right for p-value).

[0038] Fig.16 : KEGG pathway enrichment analysis results of upregulated IPDGs, the ordinate is the pathway name, the abscissa is the enrichment score of the gene in the pathway, the size of each circle is the number of genes (see the right for the quantity standard), and the color is the p-value enriched in this pathway (see the right for p-value).

[0039] Fig.17: KEGG pathway enrichment analysis results of down-regulated IPDGs, the vertical axis is the pathway name, the horizontal axis is the enrichment score of the gene in the pathway, the size of each circle is the number of genes (see the right for the quantity standard), and the color is the p-value enriched in this pathway (see the right for p-value).

[0040] Fig.18 : Actin cytoskeleton regulatory pathways enriched by IPDGs in GSEA.

[0041] Fig.19 : IPDGs on the actin cytoskeleton regulation pathway in GSEA enrichment analysis results.

[0042] Fig. 20 :The expression information of IPDGs in the actin cytoskeleton regulation pathway and the MCODE analysis results of up-regulated IPDGs. (A) The expression of IPDGs in actin cytoskeleton regulation, the horizontal axis is the protein name, and the vertical axis is the protein expression; (BC) The MCODE enrichment results of up-regulated IPDGs, Score is the Cluster enrichment score.

[0043] Fig.21 :Related information about MYH9 and HNSCC in the HPA and TCGA databases. (AB) Immunohistochemical results of MYH9 in HNSCC and squamous epithelial cells in the HPA database; (C) Statistics of the expression levels of MYH9 in squamous epithelial cells and HNCSS in the HPA database; (D) Kaplan-Meier survival analysis of MYH9 in HNSCC in TCGA, with the horizontal axis being days and the vertical axis being survival rate, p-value=0.019.

[0044] Fig. 22 :The expression of MYH9, MMP9 and CDH3 in the validation tissues. (A) The relative expression level of MYH9 in the experimental group and the control group; (B) The relative expression level of MMP9 in the validation experimental group and the validation control group; (C) The relative expression level of CDH3 in the validation experimental group and the validation control group. * represents p-value < 0.05.

[0045] Fig.23: Changes in MYH9 expression after HEOC and CAL27 transfection. (AC) The relative expression level of MYH9 after HOEC transfection for 24h, 48h and 72h was analyzed using t-test for significance, with the horizontal axis being the siNC group and the siMYH9 group, and the vertical axis being the expression level; (DF) The relative expression level of MYH9 after CAL27 transfection for 24h, 48h and 72h was analyzed using t-test for significance, with the horizontal axis being the siNC group and the siMYH9 group, and the vertical axis being the expression level. * represents p-value < 0.05, and ** represents p-value < 0.01.

[0046] Fig.24 :The expression of MMP9 after HOEC and CAL27 transfection. (AC) The relative expression level of MMP9 after HOEC transfection for 24h, 48h and 72h was analyzed by t-test. The horizontal axis is the siNC group and siMYH9 group, and the vertical axis is the expression level; (DF) The relative expression level of MMP9 after CAL27 transfection for 24h, 48h and 72h, the horizontal axis is the siNC group and siMYH9 group, and the vertical axis is the expression level. * represents p-value < 0.05, ** represents p-value < 0.01.

[0047] Fig.25 :The relative expression levels of CDH3 after HOEC and CAL27 transfection were analyzed using t-test for significance, siNC was the control group, and siMYH9 was the experimental group. (AC) Relative expression levels of MYH9 knockdown in HOEC cells at 24h, 48h, and 72h; (DF) Relative expression levels of MYH9 knockdown in CAL27 cells at 24h, 48h, and 72h. * represents p-value < 0.05, ** represents p-value < 0.01.

[0048] Fig.26 :The proliferation of HOEC and CAL27 after transfection was analyzed using t-test for significance. (AB) HOEC cell proliferation 48h and 72h after transfection; (CD) CAL27 cell proliferation 48h and 72h after transfection. ** represents p-value < 0.01, *** represents p-value < 0.001.

[0049] Fig. 27 :The status of HOEC scratched at 0h and 24h. (AB) Scratches of HOEC siNC and HOEC siMYH9 at 0h; (CD) Cell invasion status after constant temperature culture for 24h.

[0050] Fig.28:Comparison of the blank area and invasion area after HOEC scratching, and the significance was analyzed by t-test. (A) Comparison of the invasion area statistics of HOEC siNC scratching 24 hours after scratching with the blank area at 0 hours; (B) Comparison of the invasion area statistics of HOEC siMYH9 scratching 24 hours after scratching with the blank area at 0 hours. * represents p-value < 0.05, ** represents p-value < 0.01.

[0051] Fig.29 :The status of CAL27 scratch at 0h and 24h. (AB) Scratches of CAL27 siNC and CAL27 siMYH9; (CD) Cell invasion status after 24h of constant temperature culture.

[0052] Fig.30 :Comparison of the blank area and invasion area after CAL27 scratch, and the significance was analyzed by t-test. (A) Comparison of the invasion area statistics after CAL27 siNC scratch 24h and the blank area at 0h; (B) Comparison of the invasion area statistics after CAL27 siMYH9 scratch 24h and the blank area at 0h. ** represents p-value < 0.01, *** represents p-value < 0.001.

[0053] Fig.31 :Comparison of invasion status between HOEC and CAL27 under different conditions was analyzed by t-test for significance. (A) Statistics of invasion area of ​​HOEC siNC and siMYH9 24h after transfection; (B) Comparison of invasion area of ​​CAL27 siNC and siMYH9 24h after transfection; (C) Statistics of invasion area of ​​HOEC siMYH9 and CAL27 siMYH9 24h after scratching. * represents p-value < 0.05, ** represents p-value < 0.01. DETAILED DESCRIPTION

[0054] The technical solution of the present invention is further illustrated below in conjunction with experiments.

[0055] Clinical sample collection and inclusion criteria In this study, cancer tissues collected from 9 OSCC patients were used as the experimental group and matched adjacent tissues as the control group. Inclusion criteria: pathological diagnosis of OSCC, with obvious symptoms of OSCC lesions, including non-healing ulcers, white spots, red patches, lumps / swelling and pain, and limited mouth opening in the patient's mouth. All patients should meet the exclusion criteria: HPV infection. The clinical information of the patients was collected according to the disease characteristics of OSCC, including age, gender, tobacco, alcohol and betel nut use, disease grade, symptoms, tumor site, tumor anatomical site and medical history. The specific information of the 9 included patients is shown in Table 2-1. The age of the patients ranged from 38 to 77 years old, with an average age of 63 years old.

[0056] Table 2-1 Clinical information of OSCC patients Clinical tissue sample collection and inclusion and exclusion criteria of the validation group We collected tissue samples from 6 patients with OSCC (validation experimental group) and adjacent tissue samples (validation control group) to verify the results of the previous proteomic data analysis. Inclusion criteria: pathological diagnosis of OSCC with obvious OSCC symptoms, such as non-healing ulcers, white spots, red patches, lumps / pain. Exclusion criteria: HPV infection, etc. The clinical information of the 6 patients is shown in Table 2-2.

[0057] Table 2-2 Clinical information of OSCC patients in the tissue validation group Experimental cells: In this study, human oral epithelial cell HOEC cell line and CAL27 cell line were selected as cell experimental subjects, of which HOEC cells were the control group and CAL27 cells were the experimental group.

[0058] HNSCC Data Screening Transcriptome data and clinical data of HNSCC were downloaded from the Database Cancer Genome Atlas (TCGA), with a total of 528 samples. To analyze OSCC in this study, 373 samples were screened from the downloaded HNSCC clinical data, including 32 normal samples of solid tissue and 341 primary tumor samples. The DESeq2R package (v 1.18.1) was used to identify differentially expressed RNAs in the 373 relevant samples. This model is based on the negative binomial distribution and is widely used for differential analysis of RNA-seq read count data. The cutoff values ​​for significantly expressed RNAs were: (1) p-value adjusted for false discovery rate (FDR) < 0.001; (2) |log2 fold change (FC)|> 2.

[0059] Experimental methods Tissue sample collection and processing (1) According to the inclusion and exclusion criteria for selecting OSCC patients, eligible patients were selected from patients diagnosed with OSCC, and the cancer tissues and corresponding adjacent tissues of the patients were collected into 15 mL centrifuge tubes.

[0060] (2) Take the sterilized tweezers, scissors and glass dish. Pour phosphate buffer (PBS) into the glass dish, use tweezers to take out the tissue from the 15mL centrifuge tube, place it in the glass dish to wash, pour out the waste liquid, re-add PBS buffer to wash the tissue, repeat 3 times to remove the blood on the surface of the tissue. Use laboratory paper towels to wipe off the PBS buffer remaining on the surface of the tissue, use scissors to cut the cancer tissue and adjacent tissue into soybean size and divide them into 2mL centrifuge tubes, mark the tissue name and date, and store them in a -80℃ refrigerator for processing.

[0061] Cell culture The complete culture medium of HOEC cells is a mixture of modified Eagle's medium (Dulbecco's Modified Eagle's Medium, DMEM) high glucose medium + 10% fetal bovine serum + 1% penicillin-streptomycin, the culture temperature is a constant temperature environment of 37°C, and the carbon dioxide concentration in the incubator should be 5%. CAL27 belongs to a squamous cell carcinoma cell line and is a human tongue cell. Its complete culture medium is DMEM high glucose medium + 10% fetal bovine serum + 1% double antibody, the culture environment is a constant temperature environment of 37°C, and the carbon dioxide concentration is 5%.

[0062] Extraction of tissue proteins Pre-cool the mortar with liquid nitrogen for later use. Take out the tissue from the -80℃ ultra-low temperature freezer, place the tissue in the pre-cooled mortar, add liquid nitrogen and grind it thoroughly until the tissue is powdery. Add 4 times the volume of tissue powder lysis buffer (8M urea, 1% Triton X-100, 1% protease inhibitor, 3uM TSA, 50mM N-acetyl-L-methionine) and ultrasonically lyse. After complete lysis, place the tissue sample in a 4℃ environment and centrifuge at 12000g for 10 minutes to remove cell debris. After complete tissue lysis, transfer the supernatant to a new centrifuge tube and use the BCA kit to determine the protein concentration of the tissue.

[0063] Trypsin digestion of tissue proteins Pre-cool acetone for later use. Add trichloroacetic acid to the sample at a final concentration of 20%, vortex and shake evenly, place the sample in a 4°C environment, and precipitate for 2 hours. The precipitated sample is centrifuged at 4500g for 5 minutes at 4°C. Discard the supernatant and wash the precipitate 2-3 times with pre-cooled acetone. After the precipitate is washed, dry it naturally, add benzyltriethylammonium bromide at a final concentration of 200mM, and ultrasonically break up the precipitate. Add trypsin (Promega) at a ratio of 1:50 (protease: protein, m / m), stir evenly, and enzymolyze overnight. Add dithiothreitol to adjust the final concentration to 5mM, and reduce at 56°C for 30 minutes. Add iodoacetamide to adjust the final concentration to 11mM, and incubate at room temperature in the dark for 15 minutes.

[0064] Liquid chromatography-mass spectrometry analysis The protein was digested by trypsin (Promega) to become a peptide. The peptide was dissolved in liquid chromatography mobile phase A and separated using the NanoElute ultra-high performance liquid phase system. Liquid chromatography mobile phase A was an aqueous solution containing 0.1% formic acid and 2% acetonitrile; liquid chromatography mobile phase B was a solution containing 0.1% formic acid and 100% acetonitrile. The liquid phase gradient was set as follows: 0-72min, 7%-24% mobile phase B; 72-84min, 24%-32% mobile phase B; 84-87min, 32%-80% mobile phase B; 87-90min, 80% mobile phase B, and the flow rate was maintained at 450nL / min. After the peptide was separated by the ultra-high performance liquid phase system, it was injected into the Capillary ion source for ionization and then entered the times-TOP Pro mass spectrometer for analysis. The ion source voltage was set to 2.0kV, and the peptide parent ion and its secondary fragments were detected and analyzed using high-resolution TOP. The secondary mass spectrometry scanning range was set to 100-1700, and the data acquisition mode used the parallel accumulation serial fragmentation PASEF mode. After one primary mass spectrum was acquired, 10 secondary mass spectra with parent ion charge numbers in the range of 0-5 were acquired in PASEF mode. The dynamic exclusion time of the tandem mass spectrometry scan was set to 30 s to avoid repeated scanning of parent ions.

[0065] Database Search Maxquant 1.6.15.0 was used to search the raw data. Search parameter settings: the database was Homo_sapies_9606SP 20191115 (20380 sequences), a reverse library was added to calculate the FDR caused by random matching, and a common contamination library was added to the database to eliminate the impact of contaminating proteins in the identification results; the enzyme cutting method was set to Trypsin / P; the number of missed cutting sites was set to 2; the minimum length of the peptide was set to 7 amino acid residues; the mass error tolerance of the first search and main search and the parent ion was set to 20ppm and 20ppm respectively, and the mass error tolerance of the secondary fragment ion was 20ppm. The quantitative method was LFQ, and the FDR of protein identification and PSM identification was set to 1%.

[0066] Protein quantification and differential analysis The intensity of each protein in different samples in the search results was standardized to obtain Normalizedintensity (I), and the relative quantitative value (R) of different proteins in different samples was calculated. The calculation formula is: R ij =I ij / Mean(I j ) In the formula, i represents sample and j represents protein. The relative quantitative values ​​of each protein in different samples were log2 transformed to make the data conform to normal distribution. The expression level of each protein in paired cancer and adjacent tissues was taken, and the ratio of the mean protein expression levels of the two groups was calculated as the difference fold FC. The T test was used to screen the differential genes between the two groups, and the screening criteria were: difference fold >1.2 or <0.833, p-value <0.05.

[0067] Transfection of HOEC and CAL27 cells (1) Human oral epithelial HOEC cell line was selected as the control group, and human squamous cell carcinoma CAL27 cell line was selected as the experimental group.

[0068] (2) Preparation of cell culture medium. The basic culture medium used for HOEC and CAL27 is DMEM high-glucose culture medium, and its complete culture medium needs to be added with 10% fetal bovine serum and 1% penicillin-streptomycin mixture. The preparation method of antibiotic-free culture medium: only 10% fetal bovine serum needs to be added to DMEM, and no penicillin-streptomycin mixture is required.

[0069] (3) Cell recovery. Place DMEM complete medium in a constant temperature incubator, and when the temperature of DMEM complete medium reaches about 37°C, take it out and place it in a biosafety cabinet for later use. Take the cells out of the -80°C refrigerator and place them in liquid nitrogen for later use. Prepare the necessary items such as pipettes, pipette tips, Pasteur pipettes, DMEM complete medium, PBS, etc. in the biosafety cabinet (all items need to be sprayed with alcohol for disinfection and wiped dry before being placed in the biosafety cabinet). Take the cells out of liquid nitrogen, add 1mL DMEM complete medium, gently blow repeatedly to melt the cells, then transfer the cells to a 15mL centrifuge tube and centrifuge at 500g for 6 minutes. While waiting for centrifugation, add 8mL DMEM complete medium to a 10cm culture dish and set aside. After cell centrifugation, discard the supernatant, add 1 mL of DMEM complete medium to resuspend, take 1 mL of cell suspension in a culture dish, mark the cell name, corresponding generation and date, and finally culture in a constant temperature incubator at 37°C, 5% CO2, and 70%-80% humidity until the cell density reaches more than 70%-80%.

[0070] (4) Cell passaging. Observe the cell density under a microscope. When the cell density reaches 70%-80% or more, pass the cells. Discard the old culture medium on the cell culture dish. Add 2 mL of PBS to each dish, shake the dish slightly, wash away the floating dead cells and cell debris, discard the PBS, add 1 mL of 0.25% and 2.5% trypsin (Coolaber) to the HOEC cell and CAL27 cell culture dishes respectively, shake the dish slightly so that the cells on the dish are infiltrated with trypsin. Place the dish back in a 37°C constant temperature incubator to maximize the activity of trypsin (Coolaber). After 1 minute, remove the dish from the incubator and observe it under a microscope. When the cells are in a suspended and moving state, digestion is complete. If digestion is not complete, place the dish back in the incubator briefly to continue digestion, and quickly take it out and observe it under a microscope to avoid over-digestion and damage to the cells. Add 2 mL of DMEM complete medium to the digested cells to stop digestion, pipette evenly, transfer to a 15 mL centrifuge tube, and centrifuge at 500 g for 6 min at room temperature. Discard the supernatant, add 1 mL of DMEM complete medium, resuspend the cells, and inoculate the cells into a culture dish filled with new complete medium.

[0071] (5) When the cells are in good condition and stable, you can prepare for transfection. Before transfection, the cells need to be subcultured into a 6-well plate, and cell transfection can be performed when the cell density reaches about 70%. Discard the culture medium and replace it with DMEM basic culture medium (without fetal bovine serum and penicillin-streptomycin mixture) and mark them with siNC and siMYH9 respectively. Prepare 4 1.5mL Eppendorf microcentrifuge tubes and mark them (1-1; 1-2; 2-1; 2-2). Among them, 125μL Opti-MEMTM reduced serum culture medium and 5μL Lipofectamine3000 reagent are added to tube 1-1 and tube 1-2; 5μL p3000 and 5μL siNC are added to tube 2-1, and 5μL p3000 and 5μL siMYH9 are added to tube 2-2. Tube 1-1 and tube 1-2 are added very gently to tube 2-1 and tube 2-2 respectively, and incubate at room temperature for 12 minutes. Add the incubated transfection reagent to the corresponding wells, i.e., add tube 2-1 to the siNC well in the six-well plate, and add tube 2-2 to the siMYH9 well in the six-well plate. Gently shake the six-well plate and place it in the incubator for 24 hours.

[0072] (6) After the transfected cells are cultured in the incubator for 24 hours, the six-well plate is placed under a microscope for observation and photographed. The culture medium is discarded, and the cells are washed with 2 mL of PBS in each well, and the PBS is discarded. Trypsin (Coolaber) is added and placed in the incubator to digest the cells (HOEC uses 0.5 mL of 0.25% Coolaber trypsin; CAL27 uses 0.5 mL of 2.5% Coolaber trypsin). After 30s-40s, the cells are taken out of the incubator and placed under a microscope to observe the cell state. When all the cells are floating, the digestion is complete. Add 2 mL of dual-antibody-free culture medium to the completely digested cells to terminate the digestion, transfer the cell mixture to a 15 mL centrifuge tube, and centrifuge at 500g for 6 minutes. After centrifugation, add 1.8 mL of dual-antibody-free culture medium to the centrifuge tube to resuspend the cells to make a cell suspension. Take three 6-well plates and mark them for 24h, 48h and 72h respectively. Add 1 mL of culture medium without dual antibody to each well of the 24h plate, 1.5 mL of culture medium without dual antibody to each well of the 48h plate, and 1.75 mL of culture medium without dual antibody to each well of the 72h plate. Add 1 mL of cell suspension to each well of the 24h plate, 0.5 mL of cell suspension to each well of the 48h plate, and 0.25 mL of cell suspension to each well of the 72h plate. Gently shake the six-well plate and place it in the incubator for culture.

[0073] (7) After 24 hours, take out the six-well plate marked with 24 hours, observe and take photos under a microscope, discard the culture medium, wash twice with 1 mL PBS, add 1 mL TransZol Up, wash the cells off the plate, transfer to a 1.5 mL RNA-free EP tube, and store at -80°C. The cells at 48 hours and 72 hours were collected using the same method. Collect cells for RNA extraction, reverse transcription of cDNA, and targeted reverse transcription PCR.

[0074] MTT colorimetric assay for cell proliferation After HOEC and CAL27 cells were transfected, they were placed in an incubator for 24 hours. The cell plate was taken out and the cell status was observed under a microscope. The culture medium was discarded, 2 mL of PBS was added to each well plate, and the cell plate was gently shaken to wash the floating dead cells and cell debris. The PBS was discarded, 1 mL of trypsin (Coolaber) was added for digestion, and the cells were placed in a constant temperature incubator to maximize the activity of trypsin (Coolaber) (HOEC was digested with 0.25% concentration of Coolaber trypsin, and CAL27 was digested with 2.5% concentration of Coolaber trypsin). After about 1 minute, the cell plate was taken out and the cell digestion status was observed under a microscope. If more than 90% of the cells were floating, the digestion was completed. After the digestion was completed, 2 mL of DMEM complete culture medium was added to terminate the cell digestion, and the cells were blown evenly and transferred to a 15 mL centrifuge tube, and centrifuged at 500g for 6 minutes at room temperature. The liquid was discarded, and 1 mL of DMEM complete culture medium was added to resuspend the cells. Note that the cells must be blown evenly. Take a new 1.5mL EP tube, add 90μL DMEM complete medium and 10μL cell suspension to make a 10-fold diluted cell suspension, and count it with a cell counting plate. Plan to plant 8,000 cells in each well of the cell plate. Use a pipette tip to draw 10μL of the 10-fold diluted cell suspension, stick the cells to the cell coverslip and put them into the cell counter, then place the cell counter under a microscope to read the number of cells on each grid. When reading the number of cells, follow the principle of "reading the top but not the bottom, reading the left but not the right", and read the number of cells in the 8 large grids of the cell counting plate. The inventors planted cells on a 96-well plate, HOEC siNC / siMYH9 and CAL27 siNC / siMYH9 in 3 wells each, and 8000 cells in each well. Therefore, the cell suspension to be added was calculated according to the formula: 8000*3 / 8*8 / 104 / 10, and DMEM complete medium was used to fill up to 90 μL, 90 μL of PBS was added to the wells around the cells, the edges were sealed, and blank wells were set at the same time, that is, 90 μL of DMEM complete medium was added to each well. Place in a constant temperature incubator for culture. Set two time nodes, 48h and 72h respectively. Dissolve thiazolyl blue (3-(4,5-dimethylthiazol-2)-2,5-diphenyltetrazolium bromide, MTT) with PBS and prepare a 10% MTT solution. After the cells are cultured in a constant temperature incubator for 48h or 72h, take out the cell plate, add 10μL of 10% MTT solution to each well with cells (including blank control wells), shake evenly, and place the cell plate back in the constant temperature incubator to continue culturing for 4h. After 4h, discard the culture medium containing MTT with a pipette, add 150μL DMSO solution at room temperature, and shake at room temperature for 20min.Turn on the microplate reader, open the lid of the 96-well plate, place the cell plate inside the microplate reader, start the program, measure the absorbance value of each well at 490 nm and record it.

[0075] Cell scratch assay Take a 12-well plate and draw a nine-square grid on the back of each well with a pen for later use. Prepare a DMEM medium without fetal bovine serum (add 1% penicillin-streptomycin mixture to the DMEM basal medium) for later use. After HOEC and CAL27 transfection is completed, culture them in a constant temperature incubator for 24 hours, take out the 6-well plate and observe the state of the cells under a microscope. Discard the culture medium, add 2mL PBS to each well, shake the cell plate slightly to allow PBS to flow evenly in the cell plate to wash dead cells and cell debris, discard PBS, evenly add 1mL of 0.25% trypsin (Coolaber) to the wells with HOEC cells, and add 1mL of 2.5% trypsin (Coolaber) to the wells with CAL27 cells. Place the cell plate in a constant temperature incubator to maximize the activity of trypsin (Coolaber). After about 1 minute, take out the cell plate and observe the degree of digestion of the cells in each well under a microscope. When most of the cells in each well are in a floating state, the digestion is complete. If the cells are not digested, continue to place them in a constant temperature incubator for digestion, and the time depends on the degree of digestion of the cells. Add 1mL of DMEM medium without fetal bovine serum to the wells where digestion has been completed to stop digestion, centrifuge at room temperature, 500g, 6min. Discard the culture medium, add 1mL of DMEM medium without fetal bovine serum to resuspend the cells. Add DMEM medium without fetal bovine serum to the 12-well plate with lines drawn on it (add 0.6mL to the corresponding wells of HOEC and 0.4mL to the corresponding wells of CAL27), take 0.4mL of the resuspended HOEC cells to the 12-well plate, take 0.6mL of CAL27 to the corresponding wells, shake the cell plate to evenly spread the cells on the well plate, and culture in a constant temperature incubator. After culturing in a constant temperature incubator for 24 hours, observe the state of the cells under a microscope and discard the medium. Add 1mL of DMEM medium without fetal bovine serum to the 12-well plate again, and scratch the selected area according to the line drawn on the back. Install the tip of a 1000μL pipette, scratch vertically from top to bottom in the selected area with the tip of the pipette, and record the position of the scratch. After the scratch, place the 12-well plate under a microscope to observe the scratch. If floating cells are found in the culture medium or in the scratched area after the scratch, the culture medium needs to be discarded and 1mL of DMEM medium without fetal bovine serum needs to be added again. The scratched 12-well plate was placed in a constant temperature incubator and the cell invasion results were observed under a microscope after 24 hours.

[0076] Results and Analysis This study mainly obtained quantitative proteins from OSCC tissues and corresponding paracancerous tissues through protein extraction, trypsin hydrolysis, mass spectrometry analysis, database search and analysis. In order to analyze the proteins with significantly different expression levels in OSCC tissues and paracancerous tissues, the inventors first screened out proteins with a difference multiple greater than 1.2 from the detected quantitative proteins as significantly differentially expressed proteins, named DEPs. In order to make the inventors' data more complete and credible, the inventors downloaded information on related diseases from the TCGA database, and used the same screening conditions to screen out significantly differentially expressed genes, named DEGs. The intersection part was obtained from the screened DEPs and DEGs, and the intersection part was subjected to bioinformatics analysis. The pathways and proteins of interest were obtained from the bioinformatics analysis. OSCC tissues and paracancerous tissues were recollected, and the proteins were verified at the tissue level, and then the proteins were verified at the cellular level (including cell transfection, cell proliferation experiments, and cell scratch experiments) and the effects of the proteins on OSCC were explored. The process of this study is as follows: Figure 1 shown.

[0077] Mass spectrometry results Most of the peptides in this study were distributed between 7 and 20 amino acids ( Figure 2 ), which meets the quality control conditions. If it is less than 7 amino acids, it means that too few fragments are formed. Peptides with more than 20 amino acids do not meet the HCD fragmentation method because of their high charge number.

[0078] The protein molecular weight distribution is also relatively uniform ( Figure 3 ), indicating that the sample preparation process did not produce a significant bias in molecular weight for proteins above 10 kDa, and large proteins above 100 kDa were not lost during the preparation process due to poor solubility. Proteins below 10 kDa (more like polypeptides) were easily affected by multiple acetone precipitation and rinsing and disappeared.

[0079] In addition, in the data of this study, most proteins correspond to more than two peptides ( Figure 4 ), when quantifying, one protein corresponding to multiple peptides is helpful to increase the accuracy and credibility of the quantitative results.

[0080] like Figure 5 As shown in the figure, in this data, a total of 1,090,706 secondary mass spectra were obtained through mass spectrometry analysis. After searching the protein theoretical data library, 274,458 valid spectra were obtained. 60,429 peptides were identified through the spectrum analysis function, of which 58,181 were specific peptides. A total of 6,658 proteins were identified from the tissues in this experiment, of which 5,149 were quantitative proteins.

[0081] Proteomic data results Differential protein expression in tissue samples After protein extraction, trypsin hydrolysis and mass spectrometry analysis of tissue samples, a total of 6658 proteins were identified. The protein quantification method is: the corresponding signal abundance of the protein in each sample is detected by mass spectrometry analysis technology, and the relative abundance of the protein in each sample is obtained by non-standard quantitative calculation method. The ratio of the relative abundance of proteins between two different samples is taken as the differential expression (Ratio) of the comparison group. A total of 5149 quantitative proteins were identified in the tissue samples. The inventors used the screening conditions for significantly differentially expressed proteins to screen out a total of 1414 differentially expressed proteins in this data and named them DEPs: when the screening conditions were p-value <0.05, FC>1.2, 1047 up-regulated proteins were screened out; when the screening conditions were p-value <0.05, FC <0.83, 367 down-regulated proteins were screened out ( Figure 6 A). The volcano plot was used to express the differential expression fold distribution and significance of DEPs in the quantitative proteins. It was found that the differential expression fold distribution of up-regulated DEPs was concentrated between 1.2 and 1.5 times ( Figure 6 B).

[0082] The clustering results of DEPs showed that the differences within the groups were small, but there were certain differences between the groups ( Figure 7 A). The specific location of a protein in a cell can reflect its functional role to a certain extent. To this end, the inventors performed subcellular localization of DEPs in tissue samples, such as Figure 7 As shown in Figure B, about 34.6% of DEPs (489) were localized in the cytoplasm, about 23.3% of DEPs (328) were present in the nucleus, about 11.9% of DEPs (168) were present outside the cell, about 11.8% of DEPs (167) were present in the mitochondria, and about 9.0% of DEPs (129) were present on the plasma membrane. The results showed that most DEPs existed in cells.

[0083] Differential expression in TCGA database The HNSCC dataset was downloaded from TCGA, and a total of 17,145 genes were obtained. These 17,145 genes were screened for significantly differentially expressed genes, and a total of 9,183 significantly differentially expressed genes were screened: when the screening conditions were p-value < 0.01, FC > 1.2, 4,395 up-regulated genes were screened; when the screening conditions were p-value < 0.01, FC < 0.83, 4,788 down-regulated genes were screened ( Figure 8 A), using volcano plot to express the differential expression fold distribution and difference significance of DEGs in quantitative genes, it was found that the differential expression fold distribution of up-regulated and down-regulated DEGs was concentrated between 1.2 and 2 times ( Figure 8 B).

[0084] Screening of IPDGs Intersection Proteins TCGA is a database with genome sequencing information of more than 30 human tumors, providing more comprehensive genome information for tumor research. This study will analyze 9183 differentially expressed genes downloaded and screened from TCGA together with 1414 differentially expressed proteins screened from tissue samples. This study will overlap the DEGs screened according to the screening conditions in the TCGA database and the DEPs screened from the proteome of tissue samples, and 785 common proteins were found from DEGs and DEPs, which the inventors named IPDGs ( Fig. 9 A). Then, the inter-group and intra-group differences of IPDGs were analyzed. According to the cluster analysis of IPDGs, there was little difference in IPDGs within the experimental group and the control group, but there were certain differences between the groups, and the quality met the requirements for further analysis ( Fig. 9 B).

[0085] Gene function analysis of IPDGs In order to explore the potential biological functions of IPDGs in OSCC, this paper analyzed the gene functions of IPDGs. GO stores a large amount of structured knowledge about genes and gene products. GO mainly includes three aspects: biological process (BP); cellular component (CC); molecular function (MF). The GO BP enrichment results of the upregulated IPDGs in this study are shown in Figure 2. Fig.10 As shown in the figure, upregulated IPDGs are enriched in biological processes such as viral defense (GO: 0051607), viral response (GO: 009615), negative regulation of viral genome replication (GO: 0045071), innate immune response (GO: 0045087), proteolysis during cellular protein catabolism (GO: 0051603), RNA shearing (GO: 008380), actin filament assembly (GO: 0051017), mRNA splicing by spliceosome (GO: 0000398), viral mRNA export from host cell nucleus (GO: 0046784) and integrin-mediated cell adhesion (GO: 0033627). The enrichment of upregulated IPDGs on GO CC is shown in the figure. Fig.11As shown, the upregulated IPDGs were mainly enriched in cellular components such as cytoplasm (GO: 0005829), membrane (GO: 0016020), cytoplasm (GO: 0005737), extracellular exosomes (GO: 0070062), focal adhesions (GO: 005925), phagocytic vesicle membrane (GO: 0030670), nucleoplasm (GO: 0005654), actin skeleton (GO: 0015629), secretory granule cavity (GO: 0034774) and granule cavity enriched with fibrillarin-1 (GO: 1904813). The enrichment of upregulated IPDGs in GO MF is shown in Figure 3 . Fig.12 As shown, the main enrichments were in the molecular functions such as RNA binding (GO:0003723), protein binding (GO:0005515), cadherin binding (GO:0045296), actin filament binding (GO:0051015), actin binding (GO:0003779), integrin binding (GO:0005178), endopeptidase activity (GO:0004175), same protein binding (GO:0042802), protein homodimer activity (GO:0042803) and peptide antigen binding (GO:0042605).

[0086] According to the results, the inventors found that the enrichment results of upregulated IPDGs were mostly related to actin, such as actin filament bundle assembly (GO: 0051017) appeared in the enrichment results of GO BP, actin skeleton (GO: 0015629) appeared in the enrichment results of GO CC, and actin filament binding (GO: 0051015) and actin binding (GO: 0003779) appeared in the enrichment results of GO MF.

[0087] The enrichment of down-regulated IPDGs in GO BP is as follows Fig.13 As shown, it is mainly enriched in biological processes such as sarcomere organization (GO: 0045214), muscle contraction (GO: 0006936), myocardial contraction (GO: 0060048), aerobic respiration (GO: 0009060), mitochondrial electron transport, NADH conversion to ubiquinone (GO: 0006120), mitochondrial ATP synthesis coupled proton transport (GO: 0042776), tricarboxylic acid cycle (GO: 0006099), mitochondrial respiratory chain complex I assembly (GO: 0032981), muscle contraction regulation (GO: 0006937) and branched-chain amino acid catabolism process (GO: 0009083). The enrichment of down-regulated IPDGs in GO CC is shown as follows. Fig.14As shown in the figure, it is mainly enriched in mitochondria (GO: 0005739), mitochondrial matrix (GO: 0005759), Z disc (GO: 0031674), extracellular exosomes (GO: 0070062), mitochondrial inner membrane (GO: 0005743), mitochondrial respiratory chain complex I (GO: 0005747), I band (GO: 0031674), M band (GO: 0031430), cytoplasm (GO: 0005829) and sarcolemma (GO: 0042383). The enrichment of down-regulated IPDGs in GO MF is shown in the figure. Fig.15 As shown, the main enrichments were in the molecular functions such as muscle structure composition (GO: 0008307), actin binding (GO: 0003779), NADH dehydrogenase activity (GO: 0008137), actin filament binding (GO: 0051015), oxidoreductase activity (GO: 0016491), titin binding (GO: 0031432), NAD binding (GO: 0051287) and catalytic activity (GO: 0003824).

[0088] The inventors found that similar to the GO enrichment results of up-regulated IPDGs, actin filament binding (GO: 0051015) and actin binding (GO: 0003779) also appeared in the GO enrichment analysis results of down-regulated IPDGs.

[0089] In the gene function analysis results of up-regulated IPDGs and down-regulated IPDGs, the inventors noticed that IPDGs were more enriched in terms related to actin, such as actin filament bundle assembly (GO: 0051017), actin skeleton (GO: 0015629) and actin filament binding (GO: 0051015), which were significantly enriched in BP, CC and MF of GO, indicating that the proteins with significantly differential expression levels in OSCC may have a certain connection with the actin cytoskeleton.

[0090] Pathway enrichment of IPDGs KEGG is a comprehensive data resource library that integrates biological genome sequences and other high-throughput data, which can help establish the high-level functions of collective genes in the genome to the nucleus of the organism. In order to explore the high-level functions of IPDGs, the inventors conducted KEGG pathway enrichment analysis on IPDGs, and the results are as follows Fig.16As shown in the figure, the upregulated IPDGs were mainly enriched in influenza A (hsa: 05164), Epstein-Barr virus infection (has: 05169), phagosome (hsa: 05145), nucleocytoplasmic transport (hsa: 03013), endocytosis (hsa: 04144), spliceosome (hsa: 03040), NOD-like receptor signaling pathway (hsa: 04621), actin cytoskeleton regulation (hsa: 04810) and shigellosis (hsa: 05131). The KEGG pathway enrichment of downregulated IPDGs is shown in the figure. Fig.17 As shown, it was mainly enriched in metabolic pathways (hsa:01100), valine, leucine and isoleucine degradation (hsa:00280), myocardial contraction (hsa:04260), oxidative phosphorylation (hsa:00190), carbon metabolism (hsa:01200), fatty acid metabolism (hsa:01212), pyruvate metabolism (hsa:00620) and tricarboxylic acid cycle (hsa:00020).

[0091] In the enrichment results of GSEA, the inventors found 6 significantly upregulated pathways. Chemokine signaling pathway, Enrichment Score is 0.44, Normalized Enrichment Score is 1.73, the upregulated genes enriched in this pathway are NCF1, ATAT2, RAC2, PTK2B, STAT1, ARRB2, GNAI1, GSK3B, PAK1, IKBKG, AKT1, PIK3R1, GNAI2, SHC1; the significantly enriched downregulated genes are PRKACA, GNG7. Leukocyte transendothelial cell migration pathway, Enrichment Score is 0.440.39, Normalized Enrichment Score is 1.73, the upregulated genes enriched in this pathway are NCF1, ATAT2, RAC2, PTK2B, STAT1, ARRB2, GNAI1, GSK3B, PAK1, IKBKG, AKT1, PIK3R1, GNAI2, SHC1; the significantly enriched downregulated genes are PRKACA, GNG7. The Score is 1.67. The up-regulated genes enriched in this pathway are NCF2, NCF1, RAC2, CYBB, PTK2B, ITGAM, ICAM1, PLCG1, GNAI1, ITGA4, EZR, MMP9, MSN, VASP, PIK3R1, GNAI2, and ACTN1; the significantly enriched down-regulated genes are MYLPF, MYL2, and ACTN2. The spliceosome pathway has an Enrichment Score of 0.37 and a Normalized Enrichment Score of 0.5. The score is 1.58. The up-regulated genes enriched in this pathway include THOC1, CTNNBL1, PRPF4, SART1, SNRNP40, ALYREF, SF3B4, EFTUD2, DDX39B, U2AF2, THOC2, LSM2, SNRPD3, SNRPB2, LSM6, SNRPA, PUF60, SNRPE, and SNRPD1. Cancer pathway, Enrichment Score is 0.27, Normalized Enrichment The score is 1.31. The genes enriched in this pathway include LAMC2, LAMB3, RAC2, PML, PML, STAT1, DAPK3, PLCG1, STK4, NFKB2, GSK3B, BAX, CASP8, IKBKG, MMP9, ITGAV, CBL, AKT1, CDK4, HSP90AA1, PIK3R1, and ELOC. The significantly downregulated genes include ITGA6, FH, LAMA5, COL4A2, ITGA2B, COL4A1, and LAMB2. For endocytosis, the Enrichment Score is 0.32, and the Normalized Enrichment Score is 1.29. The genes enriched in this pathway include HLA-C, HLA-B, HLA-A, ARRB2, RAB31, VPS37B, HLA-F, ASAP1, CBL, AP2M1, AP2A1, ARAP1, SRC, RAB11FIP1, VPS4B, PDCD6IP, CHMP6. In addition, the actin cytoskeleton regulation pathway also appeared in the GSEA enrichment analysis results, such as. Fig.18 In the enrichment analysis results of GSEA, the enrichment score of the actin cytoskeleton regulation pathway was significantly upregulated, with an enrichment score of 0.23 and a normalized enrichment score of 1.15. In the GSEA enrichment results, the significantly upregulated genes in the actin cytoskeleton regulation pathway were RAC2, TTGAX, ARPC1B, MYH10, MYH9, TTGAM, TTGB6, ARHGEF1, ARPC5, TTGA4, TTGB5, PIP4K2C, PAK1, EZR, TTGAV, TTGA5, PFN1, MSN, PIK3R1, CFL1, PPP1CA, ACTN1, and the significantly downregulated genes were TTGA6, MYLK, MYLPF, TQGAP2, MYL2, CATN2, TTGA2B, CFL2( Fig.19 ).

[0092] Among these pathway enrichment results, the inventors once again found results related to the actin skeleton: the actin cytoskeleton regulation pathway. Combined with the GO enrichment results of IPDGs, the inventors will focus on the actin cytoskeleton regulation pathway. There are 23 upregulated IPDGs (ITGAM, ITGB5, ITGA4, SRC, ARPC1B, ACTN1, MSN, ARPC5, PIK3R1, PPP1CA, PAK1, CFL1, ITGAX, RAC2, MYH9, ITGAV, ARHGEF1, ITGB6, PIP4K2C, ITGA5, PFN1, EZR, MYH10) in this pathway, and their significant differences are as follows: Fig. 20 As shown in A. Combined with the GO enrichment results, the inventors predicted that in OSCC, the actin cytoskeleton regulation pathway was changed and affected the occurrence and development of OSCC. Similarly, the up-regulated IPDGs were clustered using the MCODE plug-in in Cytoscape_3.5.1, among which Cluster 10 ( Fig. 20 B) has a score of 4, including PLS3, CFL1, MYH9, CORO1C, CAP1, INF2, and FSCN1; Cluster 11( Fig. 20C) has a score of 3.5, and the clustering results include PLCG1, NCF2, PTK2B, PLAUR, MMP9, ELANE, NCF1, FCER1G, and INPP5D.

[0093] The proteomic data of this study found that MYH9 was significantly upregulated in OSCC. The analysis results of the TCGA database also supported that MYH9 was significantly upregulated in HNSCC. The inventors further explored the relationship between MYH9 protein expression and head and neck squamous cell carcinoma tumors with the help of the Human Protein Atlas (HPA). The results showed that MYH9 protein was highly expressed in HNSCC ( Fig.21 AB), and is mainly located in the cytoplasm and cell membrane. The results of immunohistochemical statistical analysis showed that compared with squamous epithelial cells, 75% of HNSCCs showed medium-high expression of MYH9 protein ( Fig.21 C). In addition, in the TCGA database, Kaplan-Meier survival analysis showed that HNSCC patients with high MYH9 expression had a poor overall survival rate ( Fig.21 D, p-value = 0.019). It has been reported that the EMT pathway is regulated by the expression level of MYH9 in the oncogene analysis of melanoma, and when MYH9 is knocked down, the expression level of MMP9, one of the key markers of the EMT pathway, decreases. The occurrence of EMT in tumors makes cells more inclined to develop in the mesenchymal direction and promotes tumor invasion. MMP9, as an EMT-related marker, was also enriched in the inventor's proteome MCODE analysis. On the other hand, the high expression level of MYH9 in esophageal squamous cell carcinoma can cause changes in the level of cadherin and promote the occurrence of EMT. CDH3, one of the cadherins, and MMP9 are both significantly upregulated in OSCC and may be involved in the invasion and metastasis of OSCC, but the specific mechanism is still unclear. This study found that the significantly differentially expressed protein MYH9 in OSCC was enriched in the actin cytoskeleton pathway, and the regulated MMP9 and CDH3 were significantly upregulated. Therefore, this study proposed that MYH9 may promote OSCC invasion by regulating the EMT markers MMP9 and CDH3.

[0094] In summary, the inventors first obtained 1414 DEPs with significant differential expression from the proteomic data of OSCC tissue samples, and then screened out 9183 significantly differentially expressed gene DEGs in 373 oral cancer samples from the HNSCC transcriptome data in TCGA. Bioinformatics analysis was performed on the 785 IPDGs shared by DEPs and DEGs, and the key upstream protein MYH9 was screened out. In the MCODE analysis of IPDGs, MMP9, which promotes tumor invasion by degrading ECM, was significantly upregulated. EMT is a biological process that plays a key role in tumor invasion, and the protein and gene expression of its marker CDH3 are significantly increased. Therefore, based on previous studies, combined with OSCC proteomic data, TCGA database, and HPA database, the inventors will further explore the effect of MYH9 on OSCC invasion function through MMP9 and CDH3 in OSCC cell models.

[0095] Analysis of target gene expression levels in the validation group In order to verify the relevant protein information in the previous tissue samples, six groups of OSCC patients' cancer tissues (verification experimental group) and corresponding adjacent cancer tissues (verification control group) were collected according to the inclusion and exclusion criteria. After RNA was extracted from the verification experimental group and the verification control group and reversely transcribed into cDNA, the corresponding qPCR reaction system was configured for qPCR experiments. The results are shown in the figure. Fig. 22 As shown, the expression level of MYH9 in the validation experimental group was significantly increased compared with that in the validation control group (p-value=0.04), MMP9 was also detected to be highly expressed in the validation experimental group (p-value=0.04), and CDH3 also showed the same situation, that is, the expression level in the validation experimental group was higher than that in the validation control group (p-value=0.04). Therefore, the inventors can conclude that MYH9, MMP9 and CDH3 are highly expressed in OSCC tissues.

[0096] Effects of target genes on OSCC tumor function siRNA reduces MYH9 expression in cells RNA was extracted from OSCC validation tissues and the relative expression levels of MYH9, MMP9 and CDH3 were detected by qPCR technology. The results showed that in the validation experimental group, the expression levels of MYH9, MMP9 and CDH3 were significantly higher than those in the validation control group. On this basis, the inventors conducted a cell transfection experiment to further explore whether MYH9 has a regulatory effect on MMP9 and CDH3 at the cellular level. The experimental subjects selected in this experiment were HOEC cell lines and CAL27 cell lines (HOEC is a normal epithelial cell group, and CAL27 is an OSCC group). First, after the cells were revived, they were cultured for 2-3 generations. After the cells remained in a relatively stable state, siNC and siMYH9 were transfected into HOEC and CAL27 (siNC was the control group, siMYH9 was the experimental group, forward primer: 5'-AGTTTGTCTCGGAGCTGTGG-3', SEQ ID NO.1, reverse primer: 5'-GGTTCGTGTTCCTCAGCGTA-3', SEQID NO.2), and cultured in a constant temperature incubator with DMEM basic culture medium for 24 hours. The culture medium was discarded, the cells were collected and the cells were seeded in 6-well plates and cultured for 24 hours, 48 ​​hours and 72 hours. The cells were collected at these three time points, RNA was extracted and qPCR experiments were performed to determine the relative expression levels of MYH9, MMP9 and CDH3 after HOEC and CAL27 cell transfection.

[0097] The relative expression levels of MYH9 after HOEC and CAL27 transfection are shown in Fig.23 Compared with the HOEC siNC group, HOEC cells were transfected 24 hours later ( Fig.23 A), the relative expression level of MYH9 decreased. At 48h and 72h ( Fig.23 BC). Similar changes were observed in CAL27. The relative expression level of MYH9 in CAL27 decreased 24h after transfection ( Fig.23 D) and gradually decreased after 48h and 72h ( Fig.23 EF). The results show that the expression levels of MYH9 decreased after HOEC and CAL27 were transfected.

[0098] After MYH9 was knocked down, the expression level of MYH9 in HOEC and CAL27 decreased, indicating that siMYH9 was successfully transfected into HOEC and CAL27 and reduced the expression of MYH9. Next, the inventors further tested whether the expression level of MMP9 would be affected after the expression of MYH9 was reduced. Fig.24As shown in AC, the expression level of MMP9 in the HOECsiMYH9 group decreased compared with the HOEC siNC group 24h, 48h and 72h after HOEC transfection. The expression level of MMP9 after CAL27 transfection was also affected by MYH9 knockdown, and it decreased at 24h and 48h ( Fig.24 DE). like Fig.24 As shown in F, the relative expression level of MMP9 decreased significantly when MYH9 was knocked down in CAL27 and cultured for 72 h (p-value=0.01), indicating that MMP9 is regulated by MYH9 and its expression level decreases with the decrease of MYH9 expression level.

[0099] The qPCR results of MMP9 showed that MYH9 knockdown had a certain inhibitory effect on the expression level of MMP9. Again, the inventors used qPCR to clarify the effect of reduced MYH9 expression on the expression level of CDH3. Fig.25 As shown in AC, the relative expression level of CDH3 decreased significantly after 24h (p-value = 0.0049), 48h (p-value = 0.017) and 72h (p-value = 0.04) of cell transfection. After CAL27 was transfected, the expression level of CDH3 showed a downward trend at 24h ( Fig.25 D), and decreased significantly at 48h (p-value=0.04) and 72h (p-value=0.014) ( Fig.25 EF). This suggests that knockdown of MYH9 affects the expression of CDH3.

[0100] Based on the above results, the inventors found that when the expression level of MYH9 was inhibited, the expression levels of MMP9 and CDH3 would also be inhibited. This experimental result was consistent with the inventors' hypothesis, so the inventors concluded that the expression level of MYH9 had a certain influence on the expression levels of MMP9 and CDH3.

[0101] Cell MTT results In the results of the transfection experiments of HOEC and CAL27, the inventors observed that when MYH9 was inhibited, the expression levels of MMP9 and CDH3 also decreased accordingly, indicating that MYH9 has a regulatory effect on the expression levels of MMP9 and CDH3. On this basis, the inventors will explore whether the inhibition of the expression levels of MYH9, MMP9 and CDH3 has an effect on the proliferation of OSCC cells. The main principle of the MTT colorimetric experiment is that MTT can be reduced by succinate dehydrogenase in the mitochondria of living cells to a water-insoluble blue-purple crystalline zirconium and then form a precipitate in the cell. After a certain reaction time, DMSO is added to dissolve the crystalline zirconium, and then the absorbance of the cells at 490nm is measured. Since dead cells do not have this function, MTT can be used to detect the number of living cells.

[0102] After transfecting siNC and siMYH9 into HOEC and CAL27, the cells were cultured at a constant temperature for 24 hours, the liquid was discarded and the cells were collected, and the cells were resuspended with 1mL DMEM complete medium. Take another 1.5mL EP tube, dilute the cell suspension 10 times with DMEM complete medium in the EP tube, and count the number of cells with a cell counting plate. After the cell counting is completed, take an appropriate amount of cell suspension and DMEM complete medium and blow it evenly (the total volume of cell suspension and DMEM complete medium in each well is 90μL) and plant it in a 96-well plate, culture for 48h or 72h, add MTT and culture at a constant temperature for 4h, then add DMSO on a shaker for 20min, detect the absorbance of the cells at 490nm in a cell imaging microplate detector, and calculate the cell proliferation. Fig.26 As shown in A, the inventors can observe that HOEC 48h after the end of transfection, the number of viable cells in the experimental group siMYH9 significantly decreased compared with the control group siNC (p-value = 0.0004), and when the time after transfection reached 72h, the decrease in the number of viable cells in the experimental group was more obvious ( Fig.26 B, p-value = 0.0001). A similar situation occurred in CAL27. After siMYH9 was transfected into CAL27 and cultured at constant temperature for 48 hours, the proliferation of cells was significantly inhibited ( Fig.26 C, p-value = 0.0049), and the inhibition was more obvious after 72 hours ( Fig.26 D, p-value=0.0005). Based on the above experimental results, the inventors preliminarily concluded that when MYH9 was knocked down, the expression levels of MMP9 and CDH3 were affected, and the proliferation ability of cells was inhibited.

[0103] Cell scratch assay results Actin cytoskeleton regulation plays a key role in tumor invasion and metastasis, and MYH9 is an important member of this pathway. It is necessary to explore the role of disordered expression levels in tumor development. The inventors have confirmed that MYH9 can regulate the expression levels of MMP9 and CDH3, and when the expression levels of MYH9, MMP9 and CDH3 are inhibited, the proliferation of cells is also affected accordingly. Based on the previous experimental results and existing studies, this study further explored the effects of MYH9, MMP9 and CDH3 on OSCC invasion and metastasis. To this end, the inventors used transfected cells for cell scratch experiments. After transfecting siNC and siMYH9 into HOEC and CAL27, the cells were washed with PBS and digested with trypsin, and the digestion was terminated with DMEM medium without fetal bovine serum, centrifuged, and the liquid was discarded. Resuspend the cells with fetal bovine serum DMEM, take appropriate amount of HOEC siNC / siMYH9 cells and CAL27 siNC / siMYH9 cells, fill up to 2mL with fetal bovine serum-free DMEM medium, and plant them in the 12-well plate with the marked area and culture at constant temperature for 24 hours. After 24 hours, observe the cell density, change the medium and scratch, and culture at constant temperature for 24 hours.

[0104] like Fig. 27 As shown in A, a clear blank area can be observed in the HOEC siNC at 0 h after scratching. After 24 h of constant temperature culture, cells appeared in the blank area of ​​the scratch in the HOEC siNC group ( Fig. 27 C). There was a statistically significant difference between the invasion area of ​​HOEC siNC 24h later and the blank scratch area of ​​HOEC siNC 0h later ( Fig.28 A, p-value = 0.02).

[0105] Under the microscope, the blank area after 0h of HOEC siMYH9 scratching can be clearly observed ( Fig. 27 B), HOEC siMYH9 decreased in the scratch blank area 24h after scratching ( Fig. 27 D), the statistical results show that the invasion area of ​​HOEC siMYH9 is significantly different from the blank area at 0h ( Fig.28 B, p-value = 0.002).

[0106] A similar situation was observed in CAL27. The blank area after 0h of CAL27 siNC scratching ( Fig.29 A) and blank area after scratching for 24 hours ( Fig.29 C) under the microscope, the invasion area of ​​CAL27 siNC at 24h after scratching was statistically different from the blank scratch area at 0h ( Fig.30A, p-value = 0.01).

[0107] Under the microscope, it can be observed that CAL27 siMYH9 scratches 0h ( Fig.29 B) and 24h( Fig.29 D) There are differences in the scratch area. The statistical results show that the invasion area of ​​CAL27 siMYH9 24h after scratching is significantly different from the blank area after scratching 0h ( Fig.30 B, p-value = 0.003).

[0108] After counting the invasion areas of cells siNC and siMYH9 24 hours after scratching, the inventors further compared the invasion areas of siNC and siMYH9 in HOEC and CAL27 24 hours after scratching. Fig.31 As shown in A, the invasion area of ​​HOEC siMYH9 was significantly reduced compared with that of siNC (p-value = 0.01). Compared with CAL27 siNC, the invasion area of ​​CAL27 was also significantly reduced after MYH9 was knocked down ( Fig.31 B, p-value = 0.01). This indicates that the reduction of MYH9 expression level will significantly affect the invasion and metastasis ability of cells. In order to compare the effects of MYH9 knockdown on different cells, the inventors compared the invasion areas of HOECsiMYH9 and CAL27 siMYH9 scratches 24 hours later. Fig.31 As shown in C, the invasion area of ​​CAL27 was significantly smaller than that of HOEC (p-value=0.04), indicating that knockdown of MYH9 had a greater effect on CAL27.

[0109] The strong invasiveness of OSCC is one of the main causes of recurrence and poor prognosis. In this study, the inventors paid attention to the actin cytoskeleton regulation pathway related to cell movement and MYH9 on this pathway in the results of bioinformatics analysis of proteins significantly upregulated in OSCC. Through information search in the HPA database, it was found that MYH9 was highly expressed in HNSCC. In addition, it was found in the TCGA database that patients with high expression of MYH9 had a lower survival rate compared with low expression of MYH9. On this basis, EMT-related markers MMP9 and CDH3 were also paid attention to as significantly upregulated proteins in this study. Combining this proteomics data, TCGA database, HPA database and existing studies, the inventors proposed the hypothesis that MYH9 on the actin cytoskeleton regulation pathway can regulate EMT-related markers MMP9 and CDH3 and promote OSCC invasion and metastasis. First, the inventors detected the expression levels of MYH9, MMP9 and CDH3 from the verification tissue and found that MYH9, MMP9 and CDH3 were indeed highly expressed in OSCC, and then carried out subsequent cell experiments. The siMYH9 was introduced into the OSCC-related cell lines HOEC and CAL27 by transfection technology. The expression level of MYH9 in the two cells after transfection was first detected. The results showed that the expression of MYH9 decreased, indicating that the transfection was successful. Then the expression levels of MMP9 and CDH3 in the cells were detected. The results showed that the expression levels of MMP9 and CDH3 decreased significantly, indicating that the expression levels of MMP9 and CDH3 were regulated by MYH9. After determining that MYH9 has a regulatory effect on MMP9 and CDH3, the inventors then explored the effect of reduced expression levels of MYH9, MMP9 and CDH3 on OSCC cell proliferation. The MTT experiment was used to detect the cell proliferation after HOEC and CAL27 were transfected. It was found that the proliferation of HOEC and CAL27 was significantly inhibited after the expression levels of MYH9, MMP9 and CDH3 were reduced, indicating that when MYH9 was knocked down, the expression levels of MYH9, MMP9 and CDH3 were significantly reduced, and cell proliferation was inhibited. On this basis, the inventors further used the cell scratch experiment to explore the changes in cell invasion function. The statistical results of the invasion area showed that 24 hours after HOEC transfection, the invasion area of ​​the siMYH9 group was significantly reduced compared with the siNC group. 24 hours after CAL27 transfection, the invasion area of ​​the siMYH9 group was also significantly reduced compared with the siNC group. In addition, the invasion of the siMYH9 group 24 hours after HOEC and CAL27 transfection was statistically analyzed, and the results showed that the siMYH9 group of CAL27 had a smaller invasion area. In summary, the inventors concluded that MYH9 has a regulatory effect on MMP9 and CDH3 and can promote OSCC invasion.

[0110] The above is a further detailed description of the present invention, which should not be regarded as a limitation on the specific implementation of the present invention. For ordinary technicians in the technical field to which the present invention belongs, simple deduction or replacement without departing from the concept of the present invention is within the protection scope of the present invention.

Claims

1. Application of reagents for quantifying the amount of MYH9 protein in solid tissue samples in the preparation of diagnostic reagents for oral squamous cell carcinoma.

2. A diagnostic system for oral squamous cell carcinoma, comprising: A MYH9 protein quantification device, used to determine the expression level of MYH9 protein in a tissue sample to be tested; An analytical device for determining the risk of oral squamous cell carcinoma based on the expression of MYH9 protein; The result output device outputs the analysis result of the analysis device.

3. The diagnostic system according to claim 2, characterized in that: The MYH9 protein quantitative device is a liquid chromatography-mass spectrometry device.

4. The diagnostic system according to claim 2, characterized in that A significant increase in the MYH9 protein expression indicates a high risk of oral squamous cell carcinoma.

5. Use of MYH9 protein expression inhibitors or MYH9 protein-specific binding antibodies in the preparation of drugs for the treatment of oral squamous cell carcinoma.

6. The use according to claim 5, characterized in that: The MYH9 protein expression inhibitor is siRNA targeting MYH9.

7. The use according to claim 6, characterized in that: The sequence of the siRNA is the forward primer: 5'- AGTTTGTCTCGGAGCTGTGG -3', Reverse primer: 5'- GGTTCGTGTTCCTCAGCGTA -3'.

8. Use of a MYH9 protein expression inhibitor in the preparation of an experimental MMP9 or CDH3 downregulator, wherein the use is not for the treatment of a disease.

9. The use according to claim 8, characterized in that: The MYH9 protein expression inhibitor is siRNA targeting MYH9.

10. A method for screening an anti-oral squamous cell carcinoma drug, comprising the following steps: The drug to be screened is applied to MYH9 protein or to cells with high expression of MYH9 protein to detect whether the activity of MYH9 protein is inhibited or whether the expression of MYH9 protein is downregulated, so as to preliminarily determine whether the drug has anti-oral squamous cell carcinoma activity.

Images