A CSPG4 gene molecular marker primer related to egg weight trait and its application

Abstract

The present invention relates to a CSPG4 gene molecular marker primer related to egg weight trait and its application, belonging to the field of biotechnology. The present invention uses the genomic DNA of the chicken to be tested as a template, adopts specific primers to perform PCR amplification on it, and then performs Sanger sequencing and SNP molecular marker gene typing on the PCR amplification product, thereby selecting the chicken's initial egg weight trait. The initial egg weight of T / T genotype chickens is higher than that of T / G and G / G genotype individuals, and the initial egg weight of T / G genotype chickens is higher than that of G / G genotype individuals. By eliminating T / G and G / G genotype individuals and retaining T / T genotype individuals, the beneficial effect is that the molecular marker is used as a genetic marker for chicken breeding, and chickens with larger and uniform initial egg weight are selected; the initial egg weight trait of chickens can be identified efficiently and quickly, and the uniformity of egg weight of chicken flocks can be improved, providing a scientific basis for the early selection of chickens, which is of great value for chicken breeding.

Description

Technical Field

[0001] The invention relates to a CSPG4 gene molecular marker primer related to egg weight traits and application thereof, belonging to the field of biotechnology. Background Art

[0002] Egg weight is an important evaluation index of egg quality and plays a key role in egg structure assessment and egg grading. Egg weight not only affects the edible value of eggs, but also affects their breeding value, so egg weight selection is essential. The factors affecting egg weight mainly include body weight and age, among which egg weight is positively correlated with laying age. As the age of the hen increases, egg weight also increases until it slowly levels off in the middle of laying. The initial egg weight also affects the quality of eggs in the early stage of laying and even the entire laying cycle. It is particularly important to improve egg-laying traits by increasing the initial egg weight and select excellent chickens. Using molecular markers to accurately identify genes that affect the initial egg weight of chickens and apply them to early breeding selection to select groups with larger initial egg weights can optimize the quality of eggs throughout the laying period and improve resource utilization efficiency. The physiological factors that affect the weight of eggs at the beginning of laying are mainly the age of the chicken, the weight of the chicken at the beginning of laying and the egg-laying stage. The weight of the eggs at the beginning of laying and the weight of the chicken affect the quality of eggs in the early stage of laying and even in the whole laying cycle, and the egg weight is positively correlated with the age of the chicken. The CSPG4 gene helps cells migrate and differentiate during embryonic development, which may affect the development of the embryo and cause changes in egg weight. The CSPG4 gene may also be closely related to an important pathway in the ovary. It is upregulated in the ovary and may regulate the ovulation process, providing new insights into the association between the CSPG4 gene and reproductive traits. There are no reports on the study of the CSPG4 gene in chicken reproductive traits. Summary of the invention

[0003] The purpose of the present invention is to address the defects of the prior art and to propose a CSPG4 gene molecular marker primer related to the egg weight trait and its application to quickly detect and screen the egg weight of chickens.

[0004] The present invention measured the egg weight of hens, performed SNP genotyping using whole genome resequencing technology, and screened the CSPG4 gene molecular marker significantly correlated with the chicken's initial egg weight trait through whole genome association analysis, providing new gene and molecular marker resources for the breeding of chickens' initial egg weight trait.

[0005] The present invention solves the technical problem through the following technical scheme: firstly, a CSPG4 gene molecular marker primer related to egg weight trait is provided, the nucleotide sequence of the molecular marker primer is shown in SEQ ID NO:1 and SEQ ID NO:2, the molecular marker is located at the 2731932nd base on chromosome 10 of the chicken reference genome GRCg7b version, and the base is mutated to T or G. The sequence is shown in SEQ ID NO:3 or SEQ ID NO:4 at the 199th base.

[0006] The present invention further provides an application of the above molecular marker primers for detecting SNP genotypes related to the egg weight trait of chickens. The detection method comprises the following steps:

[0007] The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification using a molecular marker primer pair to obtain an amplification product, wherein the amplification product is 305 bp in length and contains the 2731932nd base of chicken chromosome 10;

[0008] Step 2: Sanger sequencing of the PCR product;

[0009] The third step is to determine the genotype of the SNP molecular marker at base 2731932 of chicken chromosome 10 based on the sequencing results of the second step.

[0010] Wherein, the deoxyribonucleotide sequence of the molecular marker primer pair described in the first step is:

[0011] Upstream primer: 5'-TTTGACCCCAGATGAGAGGAGT-3' (SEQ ID NO: 1)

[0012] Downstream primer: 5'-GTAGGAGCGCACGGAATAAAGT-3' (SEQ ID NO: 2)

[0013] The final concentration of the reaction system is 25 μl.

[0014] Chicken DNA to be tested 50 ng

[0015] 2 x Accurate Taq Master Mix 12.5 μl

[0016] Upstream primer 1 μl

[0017] Downstream primer 1 μl

[0018] Add sterile water to 25 μl.

[0019] The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 60 seconds, for a total of 30 cycles; extension at 72°C for 2 minutes; storage at 4°C; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4, the amplified product is 305 bp in length, and contains the 2731932nd base of chicken chromosome 10.

[0020] In the third step, the judgment standard is that the starting egg weight of chickens with T / T genotype at the SNP site is higher than that of T / G and G / G genotype individuals, and the starting egg weight of chickens with T / G genotype is higher than that of G / G genotype individuals.

[0021] The present invention detects the genotype of the chicken's first egg weight trait through the CSPG4 gene molecular marker, and it is concluded that the first egg weight of the T / T genotype chicken is higher than that of the T / G and G / G genotype individuals, and the first egg weight of the T / G genotype chicken is higher than that of the G / G genotype individual. By using the genomic DNA of the chicken to be tested as a template, using specific primers to amplify it by PCR, and then performing Sanger sequencing and SNP molecular marker genotyping on the PCR amplification product, the genotype of the SNP molecular marker can be used to select the chicken's first egg weight trait. In breeding, according to the breeding goal, by eliminating T / G and G / G genotype individuals, retaining T / T genotype individuals, the beneficial effect is that the molecular marker can be used as a genetic marker for chicken breeding, and chickens with heavy first egg weight can be selected; the chicken's first egg weight trait can be identified efficiently and quickly, and the uniformity of the egg weight of the chicken flock can be improved, providing a scientific basis for the early selection of chickens, which is of great value for chicken breeding. In addition, the detection method disclosed in the present invention is simple and easy to operate, and can be carried out in the laboratory. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Manhattan plot of the genome-wide association analysis of egg weight.

[0023] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION

[0024] The following embodiments are applicable to chicken breeding, and the breeds of chickens cited are not limited to the following embodiments.

[0025] Example 1

[0026] In this example, the initial egg weight of recessive White Rock hens was measured, and whole-genome SNP genotyping was performed using second-generation sequencing technology. The CSPG4 gene molecular marker significantly associated with initial egg weight was screened through whole-genome association analysis. The results are as follows: Figure 1 shown.

[0027] In this example, the CSPG4 gene molecular marker related to the initial egg weight of chickens was identified and applied through the following experiments.

[0028] 1. Phenotypic and genotypic testing

[0029] (1) Experimental materials and egg-laying weight phenotype determination

[0030] A total of 2284 recessive White Lock hens were selected as experimental animals and raised under the same feeding conditions with free access to food and water throughout the entire process. When the egg laying season started, the egg weight of each hen was recorded as the phenotypic data of the egg laying weight of the hen.

[0031] (2) Extraction of genomic DNA

[0032] Blood was collected from the subwing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0033] (3) PCR amplification

[0034] The fragment containing the 2731932nd base of chromosome 10 was amplified using the genomic DNA extracted as above as a template.

[0035] Upstream primer: 5'-TTTGACCCCAGATGAGAGGAGT-3' (SEQ ID NO: 1)

[0036] Downstream primer: 5'-GTAGGAGCGCACGGAATAAAGT-3' (SEQ ID NO: 2)

[0037] The final concentration of the reaction system (25 μl) is:

[0038] DNA to be tested 50 ng

[0039] 2 x Accurate Taq Master Mix 12.5 μl

[0040] Upstream primer 1 μl

[0041] Downstream primer 1 μl

[0042] Add sterile water to 25 μl.

[0043] The reaction conditions of PCR amplification are: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 60sec, 30 cycles in total; 72℃ extension for 2min; 4℃ storage; 10μl was taken for agarose detection, and a single target band with a length of 305bp was amplified, containing the SNP molecular marker at the 2731932nd base site of chicken chromosome 10. The sequence of the amplified product is as follows:

[0044] SEQ ID NO:3

[0045] TTTGACCCCAGATGAGAGGAGTGCTGGGGGAGCATCTCAGCCCGGCTGCAGCACGCAGAGAGCAGGAGAGCCCTGCAGTGAGGAGCTGCAGCGGCGCAGCGTTGTTGTTGTTGGGTCCCATCCTGAGCGCAGCGCTCAGTTTTTCCTCGG CTCATTTCTATTTAAGAGCTTAGGGGAAAACTTGAGCAAGAGGCCGTGGCTCGGCACGCCGCCTCCAAACACTGCGCTGCAGCTCACGGCTTGGCAGGGCTCAGGCAAACCGGCTGCACCTCGGGAAAGGCACTTTATTCCGTGCGCTCCTAC

[0046] SEQ ID NO:4

[0047] TTTGACCCCAGATGAGAGGAGTGCTGGGGGAGCATCTCAGCCCGGCTGCAGCACGCAGAGAGCAGGAGAGCCCTGCAGTGAGGAGCTGCAGCGGCGCAGCGTTGTTGTTGTTGGGTCCCATCCTGAGCGCAGCGCTCAGTTTTTCCTCGG CTCATTTCTATTTAAGAGCTTAGGGGAAAACTTGAGCAAGAGGCCGGGGCTCGGCACGCCGCCTCCAAACACTGCGCTGCAGCTCACGGCTTGGCAGGGCTCAGGCAAACCGGCTGCACCTCGGGAAAGGCACTTTATTCCGTGCGCTCCTAC

[0048] (4) Sanger sequencing and genotyping

[0049] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peaks of different genotypes were obtained as shown in Figure 2 shown.

[0050] 2. Correlation Analysis

[0051] 2284 recessive White Lock hens with clear records of the egg weight phenotype were selected for correlation analysis. The ANOVA test function of R 4.2 statistical drawing software was used for statistical testing, and the pairwise mean comparison mode was selected to perform statistical tests on the genotype and egg weight traits of the experimental flocks. P<0.05 indicated significant differences. The results are shown in Table 1. The egg weight of the three genotypes was significantly different (P<0.05). The average egg weight of the T / T genotype individuals was 48.61g, which was higher than that of the T / G genotype individuals (47.88g (P<0.05) and the G / G genotype individuals (47.51g (P<0.05)). The egg weight of the T / G genotype individuals was higher than that of the G / G genotype individuals (P<0.05). The results showed that the site at base 2731932 of chicken chromosome 10 was significantly associated with the phenotype of the starting egg weight trait of chickens. According to the actual breeding goals, T / T genotype individuals can be selected to breed chickens with larger starting egg weight, improve the overall starting egg weight and uniformity, and improve the breeding efficiency.

[0052] Table 1 Association analysis between CSPG4 gene molecular marker genotype and initial egg weight

[0053]

[0054] Note: Data in the same column with the same letters on their shoulders indicate no significant difference, while data with different letters on their shoulders indicate significant difference (P<0.05).

[0055] Example 2

[0056] Genotype frequencies of different varieties

[0057] 1. Blood Sample Collection

[0058] Blood samples from 19 breeds, including Luodao Red Laying Hens, Bai Leghorn Laying Hens, Kebao Broilers, Camellia Chickens, Fujian Hetian Chickens, Langshan Chickens, Liyang Chickens, Guangxi Ma Chickens, Xinghua Chickens, Guangxi Black-Bone Chickens, Guangxi Three Yellow Chickens, Beijing Oily Chickens, Big Bone Chickens, Daweishan Miniature Chickens, Wenchang Chickens, Wuding Chickens, Piao Chickens, Bearded Chickens and Tibetan Chickens, were collected by subwing vein blood collection and stored at -20℃ for future use.

[0059] 2. Extraction of Genomic DNA

[0060] Take the tissue sample obtained in step 1 and use Omega's tissue genomic DNA extraction kit to extract genomic DNA. The specific method refers to the standard operating procedure provided by Omega.

[0061] 3. Genotype detection

[0062] Using the genomic DNA obtained in step 2 as a template, PCR amplification and Sanger sequencing were performed using a primer pair consisting of an F nucleotide sequence (SEQ ID NO: 1) and an R nucleotide sequence (SEQ ID NO: 2) to obtain the individual's T / T genotype, T / G genotype, and G / G genotype.

[0063] 4. Results Analysis

[0064] Luodao Red and White Leghorn are common commercial egg-laying chicken breeds with high egg production rates and moderate and uniform egg weights. Cobb broilers are common commercial broiler breeds with large body size and poor egg-laying performance. Camellia chicken, Fujian Hetian chicken, Langshan chicken, Liyang chicken, Guangxi Ma chicken, Xinghua chicken, Guangxi black-bone chicken, Guangxi three-yellow chicken, Beijing oily chicken, big-bone chicken, Daweishan miniature chicken, Wenchang chicken, Wuding chicken, gourd chicken, bearded chicken and Tibetan chicken are well-known local chicken breeds in China. Through long-term selection and breeding, the egg weight of laying hens has become more uniform at the beginning of egg production than that of broilers, and the egg weight increases faster in the early stage. The above results show that this locus can be used as a molecular marker for egg weight selection and breeding. See Table 2.

[0065] Table 2 Distribution of allele frequencies of CSPG4 gene molecular markers in different varieties

[0066] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. An application of a CSPG4 gene SNP primer related to egg weight, characterized in that: The SNP primers are used to detect the trait of the first egg laying weight of chickens. The nucleotide sequences of the SNP primers are shown in SEQ ID NO: 1 and SEQ ID NO:

2. The SNP is located at the 2731932nd base on chromosome 10 of the chicken reference genome GRCg7b version, and the base mutates to T or G. The first egg laying weight of chickens with T / T genotype at the SNP site is higher than that of individuals with T / G and G / G genotypes, and the first egg laying weight of chickens with T / G genotype is higher than that of individuals with G / G genotype.

2. The use of the CSPG4 gene SNP primers related to egg weight trait according to claim 1, characterized in that: The detection method comprises the following steps, The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification using the SNP primers shown in SEQ ID NO: 1-2 to obtain an amplified product, wherein the amplified product is 305 bp in length and contains the 2731932nd base of chromosome 10 of the chicken reference genome GRCg7b version; Step 2: Sanger sequencing of the PCR product; The third step is to determine the SNP genotype of base 2731932 of chromosome 10 of the chicken reference genome GRCg7b version based on the sequencing results of the second step.

3. The use of the CSPG4 gene SNP primers related to the egg weight trait according to claim 2, characterized in that: The final volume of the reaction system was 25 μl. Chicken DNA to be tested 50 ng 2 × Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl; The reaction conditions of the PCR amplification are: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 60 sec, a total of 30 cycles; 72°C extension for 2 min; 4°C storage; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

Images