Multiple digital PCR detection kit and detection method thereof

Abstract

The invention relates to a multiplex digital PCR (polymerase chain reaction) detection kit and a detection method thereof, the detection kit comprises a detection primer corresponding to a target spot, a wild type block probe and a detection probe, the detection primer corresponding to the target spot comprises an upstream primer and a downstream primer, and the target spot is selected from any one or any combination of K-ras, B-raf, EGFR, ESR1, PIK3CA and N-ras. By adopting the detection kit disclosed by the invention, multiple targets can be detected at the same time, the sample dosage, the detection time and the detection cost are greatly reduced, and the block reduces the amplification efficiency of a wild type template and effectively reduces the influence of a wild type background signal on detection, so that the sensitivity and the specificity of a multiple digital PCR detection system are effectively improved.

Description

Technical Field

[0001] The present invention relates to the field of gene detection, and in particular to a kit for detecting gene mutations by multiplex digital PCR and a detection method thereof. Background Art

[0002] Since the publication of a study on the use of EGFR inhibitors to treat lung cancer patients with EGFR mutations in 2004, tumor diagnosis and treatment has entered the era of targeted therapy. With the discovery of targets such as BRAF, K-ras gene mutations, ALK1, ROS1, and RET gene fusions, and the advent of corresponding targeted drugs, the treatment options and survival of lung cancer patients have been greatly improved. At the same time, targeted therapy has been extended from lung cancer to other solid tumors, such as gastric cancer, intestinal cancer, gastrointestinal stromal tumors, breast cancer, melanoma, and glioblastoma. In recent years, due to the popularization of detection technologies such as NGS, digital PCR, and fluorescent PCR, the success of clinical trials of pan-tumor markers and corresponding targeted drugs, and even their approval by the FDA, gene mutation detection and targeted therapy have played an increasingly important role in the treatment of tumor patients.

[0003] Digital PCR is also called Digital PCR (dPCR). Its basic principle is to divide the PCR reactants into tens to hundreds of thousands of copies, and then distribute them to different reaction units, so that each droplet unit contains one or more copies of nucleic acid molecules. Each unit will amplify the template, and the fluorescence signal of each unit will be counted. According to the Poisson distribution principle and the number and proportion of positive droplets, the starting copy number or concentration of the target molecule is obtained. Compared with traditional fluorescent quantitative PCR, digital PCR has high sensitivity (up to 0.001-0.0001%), strong specificity, and high tolerance to PCR reaction inhibitors. At the same time, there is no need to rely on controls or standards, and the target copy number can be directly and accurately quantified to analyze small concentration differences; experimental data analysis is convenient, the detection results of each droplet are judged as negative or positive, and data analysis is automated; the mutation rate of the target can be obtained through statistical analysis.

[0004] Early digital PCR gene mutation detection products were limited by the instrument's fluorescence channels and were usually based on single-point detection. Single-point detection products can only detect one mutation in a single reaction, so the detection cost is relatively high and the sample utilization rate is low. Despite the advantages of high sensitivity and quantification, it is difficult to promote. However, in actual applications, the number of genes that need to be detected is often more than two. For example, in the initial screening of mutated genes in tumor patients, it is necessary to accurately find the specific genes that the patient mutates among many genes in order to give the best treatment plan. Therefore, there is a great demand for multiple digital PCR that detects multiple targets in a single reaction. The development of multi-channel digital PCR platforms has made multiple digital PCR detection possible. The parallel detection of multiple indicators can significantly reduce the detection cost, obtain richer detection information, and thus improve the utilization efficiency of a single sample. It has irreplaceable advantages in the field of tumor liquid biopsy.

[0005] During the development of multiplex digital PCR gene mutation detection products, the inventors found that compared with single-plex PCR products, multiplex PCR products often use universal internal references to replace the wild-type probes in single-plex products to evaluate the copy number of template background in order to improve the utilization efficiency of fluorescence channels. In the absence of competition from wild-type probes, mutant probes often bind to high-concentration wild-type templates to produce non-specific signals that affect interpretation.

[0006] Therefore, there is an urgent need to develop a highly sensitive and specific multiplex digital PCR detection system to effectively eliminate the interference of wild-type template background signals in the sample, which is of great significance for the diagnosis and treatment of cancer. Summary of the invention

[0007] In order to solve the problems existing in the prior art, the purpose of the present disclosure is to provide a multiplex digital PCR detection system that can complete the detection of multiple targets simultaneously on a multi-channel digital platform, greatly reducing the amount of samples, detection time and detection cost. In addition, the blocker in the detection system reduces the amplification efficiency of the wild-type template and competes with the mutant probe for binding, effectively reducing the impact of the wild-type background signal on the detection, thereby effectively improving the sensitivity and specificity of the multiplex digital PCR detection system.

[0008] In order to achieve the above objectives, the present disclosure adopts the following specific scheme:

[0009] On the one hand, the present disclosure proposes a multiplex digital PCR detection reagent or detection kit for detecting gene mutations, which includes detection primers corresponding to targets, wild-type blocking probe blockers and detection probes, wherein the detection primers corresponding to the targets include upstream primers and downstream primers, and the targets are selected from any one of K-ras, B-raf, EGFR, ESR1, PIK3CA and N-ras or any combination thereof.

[0010] On the other hand, the present disclosure provides a method for detecting gene mutations by multiplex digital PCR, which can simultaneously detect at least two mutation sites in one PCR sample, wherein the mutations are located at the same target site or different target sites, and the detection method comprises:

[0011] (1) Obtaining DNA from the sample to be tested;

[0012] (2) mixing the DNA obtained in step (1), detection primers corresponding to the target, detection probes, blockers, and optional internal controls;

[0013] (3) droplet generation, PCR amplification, and chip reading;

[0014] (4) reading the fluorescence signal of the PCR amplification product and determining the mutation status in the test sample based on the fluorescence signal;

[0015] Preferably, the DNA is free DNA.

[0016] In another aspect, the present disclosure provides use of the aforementioned detection reagent or detection kit and / or the aforementioned method in multiple gene mutation detection.

[0017] The beneficial effects achieved by the present disclosure are at least as follows:

[0018] (1) The present disclosure provides a multiplex digital PCR detection reagent or detection kit, which can simultaneously complete the detection of multiple gene targets on a multi-channel digital PCR platform, greatly reducing the sample usage, detection time and detection cost. The detection reagent or detection kit disclosed in the present disclosure can simultaneously complete the gene detection of specific targets of patients with lung cancer, colorectal cancer or breast cancer.

[0019] (2) The detection system disclosed in the present invention reduces the amplification efficiency of the wild-type template by introducing a wild-type blocking probe blocker, and competes with the mutant probe for binding, effectively reducing the interference of the wild-type background signal in the reaction well, thereby improving the sensitivity and specificity of the detection.

[0020] (3) The multiplex digital PCR detection system and method provided by the present disclosure effectively improves sample utilization and has advantages in detecting trace templates; at the same time, the amplification system is simple to operate, the detection time is short, the operation is convenient, the results are intuitive, and the analysis is convenient. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 : K-ras blocker test results.

[0022] Figure 2 : B-raf blocker test results.

[0023] Figure 3 :EGFR T790M blocker test results.

[0024] Figure 4 :Blocker-1106 test results.

[0025] Figure 5 : Amplification curves of FP1 / RP1 primer pair at different temperatures.

[0026] Figure 6 : Amplification curves of FP2 / FP2 primer pair at different temperatures.

[0027] Figure 7 : Amplification curves of FP3 / RP3 primer pair at different temperatures.

[0028] Figure 8 : Amplification efficiency test results of FP2 / RP2 and FP3 / RP3 primer pairs.

[0029] Fig. 9 : Results of multiplex blocker fluorescence PCR detection of DNA extracted from NCI-H1975 cell line.

[0030] Fig.10 :Multiple blocker fluorescence PCR detection results of DNA extracted from HT29 cell line.

[0031] Fig.11 : Results of multiplex blocker fluorescence PCR detection of DNA extracted from Calu-1 cell line.

[0032] Fig.12 : Multiplex blocker fluorescence PCR detection results of DNA extracted from HEK-293 cell line.

[0033] Fig.13 : Multiple blocker fluorescence PCR test results of the blank group with enzyme-free water.

[0034] Fig.14 : Multiplex blocker digital PCR results of DNA extracted from Calu-1 cell line.

[0035] Fig.15 : Multiplex blocker digital PCR detection results of DNA extracted from HT29 cell line.

[0036] Fig.16 : Multiplex blocker digital PCR test results of DNA extracted from NCI-H1975 cell line.

[0037] Fig.17: Multiplex blocker digital PCR detection results of DNA extracted from HEK-293 cell line.

[0038] Fig.18 : Multiplex blocker digital PCR test results of the enzyme-free water blank group.

[0039] Fig.19 : Multiplex blocker digital PCR test results of simulated samples.

[0040] Fig. 20 : Multiplex blocker digital PCR test results of simulated samples.

[0041] Fig.21 : Multiplex blocker digital PCR test results of simulated samples.

[0042] Fig. 22 : Multiplex blocker digital PCR test results of simulated samples. DETAILED DESCRIPTION

[0043] The experimental methods in the following examples of the present disclosure that do not specify specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer. Various commonly used chemical and biological reagents used in the examples are all commercially available products.

[0044] Unless otherwise defined, all technical and scientific terms used in the present disclosure have the same meanings as those commonly understood by those skilled in the art to which the present disclosure belongs. The terms used in the specification of the present disclosure are only for the purpose of describing specific embodiments and are not intended to limit the present disclosure.

[0045] The terms "including" and "having" and any variations thereof in the present disclosure are intended to cover non-exclusive inclusions. For example, a process, method, device, product or equipment comprising a series of steps is not limited to the listed steps or modules, but may optionally include steps not listed, or may optionally include other steps inherent to these processes, methods, products or equipment.

[0046] The "plurality" mentioned in the present disclosure refers to two or more than two. "And / or" describes the association relationship of associated objects, indicating that three relationships may exist. For example, A and / or B can represent: A exists alone, A and B exist at the same time, and B exists alone. The character " / " generally indicates that the associated objects before and after are in an "or" relationship. At the same time, in order to better understand the present disclosure, the definitions and explanations of related terms are provided below.

[0047] The term "locked nucleic acid" used in the present disclosure refers to a synthetic antisense oligonucleotide in which the 2'-oxygen and 4'-carbon of the ribose ring of the nucleotide residue are linked by a methylene group, have strong hybridization ability with the target nucleic acid molecule, and are not easily degraded by enzymes.

[0048] The term "multiplex detection" as used in the present disclosure refers to multiple sets of upstream and downstream primer pairs detecting multiple sets of different mutant genes.

[0049] The term "inverted dT" used in the present disclosure refers to reverse dT (invdT), which can be used as a 3'-end modification of an oligonucleotide to prevent the extension of the oligonucleotide.

[0050] The term "ddC" used in the present disclosure is a base modification, referring to dideoxycytidine (3'ddC Dideoxy-C, 3ddc), in which the hydroxyl groups at the 2' and 3' positions of the ribose are both replaced by H, which can be attached to the end of the nucleotide to prevent DNA polymerase from extending at the end.

[0051] On the one hand, the present disclosure proposes a multiplex digital PCR detection reagent or detection kit for detecting gene mutations, which includes detection primers corresponding to targets, wild-type blocking probe blockers and detection probes, wherein the detection primers corresponding to the targets include upstream primers and downstream primers, and the targets are selected from any one of K-ras, B-raf, EGFR, ESR1, PIK3CA and N-ras or any combination thereof.

[0052] In some embodiments of the present disclosure, the detection primer corresponding to the target, the wild-type blocking probe blocker and the detection probe are selected from any one of the following groups or any combination thereof:

[0053] (1) The upstream primer for detecting K-ras mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 1-3 and 103; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 4-6 and 104; the K-ras blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 7-9 or its 3' end has other modifications that block the extension of the blocker itself or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modification that blocks the extension of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in any one of NO.10-11 and 113 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto590, BODIPY FL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB;

[0054] (2) The upstream primer for detecting B-raf mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs.12-14; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs.15-17; the B-raf blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs.18-20 or its 3' end has other modifications that block the extension of the blocker itself or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modification that blocks the extension of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in any one of NO.21-22 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto 590, BODIPY FL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB;

[0055] (3) The upstream primer for detecting EGFR T790M mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs.23-25; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs.26-28; the EGFR blocker is selected from the nucleotide sequence shown in SEQ ID NOs.29 or 31, or its 3' end has other modifications that block the extension of the blocker itself, or the locked nucleic acid of its nucleotide sequence is modified to be selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modifications that block the extension of the blocker itself are selected from MGB, inverted dT or ddC; the detection probe is selected from the nucleotide sequence shown in SEQ ID NO.32, or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified, or the locked nucleic acid of its nucleotide sequence is modified to be selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto 590, BODIPYFL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; More preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB;

[0056] (4) The upstream primer for detecting ESR1 mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 40-42; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 43-45; the ESR1 Blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 46-48, 108, or its 3' end has other modifications that block the extension of the blocker itself, or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modification that blocks the extension of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in NO.49 or 111 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto 590, BODIPY FL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB;

[0057] (5) The upstream primer for detecting the PIK3CA E542 / E545 mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs.50-52 and 105; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs.53-55 and 106; the PIK3CA E542 / E545 Blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs.56-58 or its 3' end has other modifications that block the extension of the blocker itself or its nucleotide sequence is modified to be selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modification that blocks the extension of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in any one of NO.59-60 and 107 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto 590, BODIPY FL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB;

[0058] (6) The upstream primer for detecting the PIK3CA H1047 site mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 61-63; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 64-66; the PIK3CA H1047Blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 67-69, 110, 114, or its 3' end has other modifications that block the extension of the blocker itself, or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modifications that block the extension of the blocker itself are selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in any one of NO.70-71, 109, and 115 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto 590, BODIPY FL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB;

[0059] (7) The upstream primer for detecting N-ras mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs.72-74; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs.75-77; the N-ras Blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs.78-80 or its 3' end has other modifications that block the extension of the blocker itself or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modification that blocks the extension of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in any one of NO.81-82, 112 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto590, BODIPY FL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB;

[0060] (8) The upstream primer for detecting EGFR L858R mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs.83-85; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs.86-88; the EGFR L858R Blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs.89-91 or its 3' end has other modifications that block the extension of the blocker itself or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modification that blocks the extension of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in NO.92 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto 590, BODIPY FL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB;

[0061] (9) The upstream primer for detecting EGFR 19del mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs.93-95; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs.96-98; the EGFR 19del Blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs.99-101 or its 3' end has other modifications that block the extension of the blocker itself or its nucleotide sequence is modified to be selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modification that blocks the extension of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in any one of NO.102 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto 590, BODIPY FL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB;

[0062] Optionally, the detection probe and / or blocking probe blocker has or does not have a modification.

[0063] In some embodiments of the present disclosure, the detection probe and / or blocking probe blocker has or does not have a modification.

[0064] In some embodiments of the present disclosure, the detection reagent or kit further includes an internal reference, which includes an internal reference detection probe, an internal reference upstream primer, and an internal reference downstream primer.

[0065] In some embodiments of the present disclosure, the internal reference upstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 33-35.

[0066] In some embodiments of the present disclosure, the internal reference downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 36-38.

[0067] In some embodiments of the present disclosure, the internal reference detection probe comprises the nucleotide sequence shown in SEQ ID NO.39.

[0068] In some embodiments of the present disclosure, the detection probe and / or the blocking probe blocker has a modification.

[0069] In some embodiments of the present disclosure, the modification is selected from one or more of locked nucleic acid modification, peptide nucleic acid modification, phosphorothioate modification, ddC, inverted dT, MGB, quencher group modification or fluorescent group modification.

[0070] In some embodiments of the present disclosure, the modification is one or more of locked nucleic acid modification, phosphorothioate modification, ddC, inverted dT or MGB modification.

[0071] In some embodiments of the present disclosure, the 5' end of the probe is modified with a fluorescent group and / or the 3' end is modified with a quenching group.

[0072] In some embodiments of the present disclosure, the fluorescent group is selected from one of the following: FITC, TET, JOE, R110, FAM, CY-5, CY-5.5, HEX, VIC, ROX or CY-3.

[0073] In some embodiments of the present disclosure, the quenching group is selected from one of the following: TAMRA, BHQ-1, BHQ-2, Dabcyl or MGB.

[0074] On the other hand, the present disclosure provides a method for detecting gene mutations by multiplex digital PCR, which can simultaneously detect at least two mutation sites in one PCR sample, wherein the mutations are located at the same target site or different target sites, and the detection method comprises:

[0075] (1) Obtaining DNA from the sample to be tested;

[0076] (2) mixing the DNA obtained in step (1), detection primers corresponding to the target, detection probes, blockers, and optional internal controls;

[0077] (3) droplet generation, PCR amplification, and chip reading;

[0078] (4) reading the fluorescence signal of the PCR amplification product and determining the mutation status in the test sample based on the fluorescence signal;

[0079] In some embodiments of the present disclosure, the DNA is free DNA.

[0080] In some embodiments of the present disclosure, the sample to be tested is selected from one or more of tumor cells, blood, plasma, pleural effusion, peritoneal effusion, saliva, urine, tissue or fetal early detection sample.

[0081] In some embodiments of the present disclosure, the sample to be tested is a blood sample, a plasma sample, a tissue sample or a cell sample.

[0082] In some embodiments of the present disclosure, the blood sample is a peripheral blood sample.

[0083] In some embodiments of the present disclosure, the sample is selected from one or more of lung cancer, colorectal cancer or breast cancer samples.

[0084] In another aspect, the present disclosure provides use of the aforementioned detection reagent or detection kit and / or the aforementioned method in multiple gene mutation detection.

[0085] In some embodiments of the present disclosure, the gene mutation detection is gene detection before targeted therapy.

[0086] Example

[0087] The technical solution of the present disclosure is further described below by way of specific implementation. It should be clear to those skilled in the art that the embodiments are only used to help understand the present disclosure and should not be regarded as specific limitations of the present disclosure.

[0088] Example 1: Establishment of multiplex PCR detection system

[0089] 1. Primer, probe and blocker design

[0090] Multiplex PCR reactions usually include PCR enzymes, PCR reaction buffer, mutation detection amplicon, internal reference amplicon, etc. In this embodiment, a Blocker that completely matches the wild-type template is introduced, and its Tm value is increased by modification such as LNA, MGB and ddC, thereby enhancing the Blocker's ability to recognize base mismatches, making it stably bind to the wild-type template and blocking the amplification of the wild-type template. In addition, the Blocker 5' end is modified by thiophosphorylation to enhance its resistance to Taq enzyme hydrolysis, and the 3' end is modified by MGB, inverted dT or ddC to block the extension of the blocker itself.

[0091] However, due to differences in gene sequences, some blockers have limited blocking effects on wild-type amplification, and some wild-type amplification may occur. In this detection system, the blocker is modified by LNA, MGB, ddC, etc., so that the Tm value of binding to the wild-type template is higher than that of the corresponding mutant Taqman probe. The wild-type template preferentially binds to the blocker, but cannot bind to the mutant Taqman probe to produce a fluorescent signal. At the same time, the LNA modification on the mutation site improves the ability of the wild-type blocker to recognize base mismatches, and the double-stranded Tm formed by binding to the mutant template with a base mismatch is greatly reduced, which is lower than the double-stranded Tm value formed by the fluorescent probe and the mutant template; therefore, the mutant template will preferentially bind to the corresponding mutant probe to produce a fluorescent signal.

[0092] Therefore, in theory, the blocker in this detection system can effectively reduce the amplification of the wild-type template to the detectable range of the instrument without significantly affecting the amplification efficiency of the mutant template.

[0093] Primers used to detect K-ras, B-raf, EGFR, ESR1, PIK3CA E542 / E545, PIK3CA H1047 and N-ras mutations were designed by NCBI Blast; the primer length was between 18-25 nucleotides, the GC content of the primers was between 40%-60%, and the Tm value of the primers was in the range of 55℃~65℃. The Tm values ​​of each primer were roughly close to ensure that the primer pairs could be amplified efficiently at the same annealing temperature. The amplification product size of the primers was in the range of 100-200bp. The blocker sequence used was designed using Snapgene software. The blocker length was between 15 and 40bp, and the Tm value was in the range of 60℃~75℃. The Tm values ​​of each blocker were roughly close to ensure that they maintained a high blocking efficiency under the same reaction conditions. Specific probes for detecting hotspot mutations of K-ras, B-raf, EGFR, ESR1, PIK3CA E542 / E545, PIK3CA H1047 and N-ras were modified with quenching groups such as MGB, BHQ1, and BHQ2 at the 3' end; the 5' end of the probe was modified with FAM, HEX, CY-5, and ROX fluorescent groups to detect the amplification of different amplicons. EIF2C1 was selected as the internal reference and the primer-probe combination that could stably amplify without non-specific products and dimers was screened. After the design was completed, the primers, probes, and blockers were compared using NCBI Blast software to ensure the specificity of each sequence. The specific detection system information is shown in Table 1. The primers, probes, and blockers used for detection were diluted to 10 μM.

[0094] Table 1 Detection system sequence information

[0095]

[0096]

[0097]

[0098] Note: "+" indicates a locked nucleic acid modification on the right side of the base, and "*" indicates a phosphorothioate modification on the right side. Taking SEQ ID NO.108 as an example, A*ACGTGGTGCCC+CT+CT+ATG+A+C+CTGCTGCTGGAGAT-ddC, one of the oxygens in the phosphodiester bond between the 1st and 2nd nucleotides is replaced by sulfur to form a phosphorothioate bond, that is, there is a thioate modification on the right side of the 1st nucleotide C; locked nucleic acid modifications exist on the 13th, 15th, 17th, 20-22nd nucleotides.

[0099] 2. Detection reaction process

[0100] 2.1 Sample pretreatment

[0101] Plasma samples: DNA was extracted using the QIAamp Circulating Nucleic Acid Kit (50) (Qiagen, 55114) and then added to the reaction system at an amount of 5 to 30 ng.

[0102] Tissue samples: DNA was extracted using the DNeasy Blood & Tissue Kit (50) (Qiagen, 69504) and then added to the reaction system at a concentration of 5 to 50 ng.

[0103] Cell samples: Cell samples such as CTC can be lysed or directly added to the reaction system, with 1,000 to 10,000 cells added.

[0104] 2.2 Configuration of reaction system

[0105] The reaction system formula is shown in Table 2. The reaction system is usually configured in 35 μL. Specific primers, probes and blockers are selected according to the mutation gene sites and number to be detected.

[0106] Table 2 Reaction system

[0107] Reagents Volume (μL) concentration 10X buffer 3.5 1X PCR polymerase 1 1X Upstream primer 1.05 300nM Downstream primer 1.05 300nM <![CDATA[blocker / H 2 The]]> 2.1 600nM Probe 0.7 200nM Enzyme-free water Make up / template 1~12 (depending on the template concentration) / total 35 /

[0108] 2.3 Sample loading test

[0109] According to the instructions of the fluorescence or digital PCR operation manual, the test was performed on the machine. The specific reaction conditions are shown in Table 3.

[0110] Table 3 Reaction conditions

[0111]

[0112] Statistical analysis of experimental results.

[0113] Example 2: Blocker blocking efficiency test in fluorescent PCR platform

[0114] 1. Experimental Procedure

[0115] (1) DNA from the Calu-1 cell line was extracted as a K-ras gene positive template; DNA from the HT-29 cell line was extracted as a B-raf gene positive template; DNA from the NCI-H1975 cell line was extracted as an EGFR T790M and EGFR L858R gene positive template; DNA from the HCC827 cell line was extracted as an EGFR 19del positive template; synthetic plasmid 014 (SEQ ID NO.117, synthesized by GenScript Biotech Co., Ltd.) was used as a PIK3CA H1047L mutation positive, synthetic plasmid 017 (SEQ ID NO.118, synthesized by GenScript Biotech Co., Ltd.) was used as a PIK3CA E542K mutation positive, synthetic plasmid 011 (SEQ ID NO.116, synthesized by GenScript Biotech Co., Ltd.) was used as an ESR1 D538G mutation positive plasmid, and synthetic plasmid 028 (SEQ ID NO.119, synthesized by GenScript Biotech Co., Ltd.) was used as an Nras Q61K mutation positive; DNA from the HEK-923 cell line was extracted as a negative template.

[0116] (2) The DNA extracted in step (1) was diluted to 3 ng / μL, and the wild-type template and mutant template of the corresponding detection site were prepared according to Table 4.

[0117] Table 4 Templates for each experimental group

[0118]

[0119]

[0120] (3) PCR reaction

[0121] In experimental group 1, K-ras upstream and downstream primers and K-ras Probe were selected to detect the amplification and CT values ​​of wild-type and mutant templates of K-ras gene under the conditions of Calu-1 blocker and no blocker, respectively.

[0122] In experimental group 2, B-raf upstream and downstream primers and B-raf Probe were selected to detect the amplification and CT values ​​of the wild-type and mutant templates of the B-raf gene under the conditions of B-raf blocker and no blocker, respectively.

[0123] In experimental group 3, EGFR T790M upstream and downstream primers and EGFR Probe were selected to detect the amplification and CT values ​​of EGFR wild-type template and mutant template under different conditions (with EGFR T790M blocker 1, with Blocker 1106, and without Blocker).

[0124] In experimental group 4, EGFR L858R upstream and downstream primers and EGFR L858R Probe were selected to detect the amplification and CT values ​​of the wild-type and mutant templates of EGFR L858R gene under the conditions of EGFR L858R blocker and no blocker, respectively.

[0125] In experimental group 5, EGFR 19del upstream and downstream primers and EGFR 19del Probe were selected to detect the amplification and CT values ​​of EGFR 19del gene wild-type template and mutant template under the conditions of EGFR19del blocker and no blocker, respectively.

[0126] In experimental group 6, PIK3CA H1047L upstream and downstream primers and PIK3CA H1047L Probe were selected to detect the amplification and CT values ​​of the wild-type and mutant templates of the PIK3CA H1047L gene under the conditions of PIK3CA H1047L blocker and no blocker, respectively.

[0127] In experimental group 7, PIK3CA E542 upstream and downstream primers and PIK3CA E542 Probe were selected to detect the amplification and CT values ​​of the wild-type template and mutant template of PIK3CA E542 gene under the conditions of PIK3CAE542 blocker and no blocker, respectively.

[0128] In experimental group 8, ESR1 D538G upstream and downstream primers and ESR1 D538G Probe were selected to detect the amplification and CT values ​​of the wild-type template and mutant template of the ESR1 D538G gene under the conditions of ESR1D538G blocker and no blocker, respectively.

[0129] In experimental group 9, N-ras Q61K upstream and downstream primers and N-ras Q61K Probe were selected to detect the amplification and CT values ​​of the wild-type and mutant templates of the N-ras Q61K gene under the conditions of N-rasQ61K blocker and no blocker, respectively.

[0130] The specific primer, probe and blocker information is shown in Table 5.

[0131] Table 5 Primer probe and blocker information in this example

[0132]

[0133]

[0134] The PCR reaction solution was prepared according to Table 2, wherein the volume of the template was 5 μL.

[0135] The reaction procedure is shown in Table 6.

[0136] Table 6 Reaction procedure

[0137]

[0138] 2. Experimental results

[0139] The amplification curve results of each experimental group are shown in Figure 1-4 and Tables 7-9.

[0140] Table 7 Test results of experimental groups 1-3

[0141] Note: “NoCt” means the sample was not amplified. “ / ” means it was not added.

[0142] Table 8 Test results of experimental groups 4-6

[0143]

[0144] Note: “NoCt” means the sample was not amplified. “ / ” means it was not added.

[0145] Table 9 Test results of experimental groups 7-9 Note: “NoCt” means the sample was not amplified. “ / ” means it was not added.

[0146] The results of K-ras blocker test in experimental group 1 are shown in Figure 1 ,Depend on Figure 1 It can be seen that the addition of blocker to the wild-type template effectively blocks the amplification of the wild-type template, but has no effect on the amplification of the mutant template.

[0147] The results of the experimental group 2B-raf blocker test are shown in Figure 2 ,Depend on Figure 2 It can be seen that the addition of blocker effectively blocks the amplification of wild-type template, but has no effect on the amplification of mutant template. Since the B-raf mutation frequency of the cells used is 20%, the Ct value of mutant samples increases after adding blocker.

[0148] The results of the experimental group 3 EGFR T790M blocker test are shown in Figure 3 ,Depend on Figure 3 It can be seen that in the wild-type template, compared with the blocker-control group, the addition of blocker effectively blocked the wild-type amplification, but had no effect on the amplification of the mutant template.

[0149] The results of experimental group 3 testing the blocking effect of blocker-1106 are shown in Figure 4 ,Depend on Figure 4 It can be seen that blocker-1106 cannot effectively block the amplification of the EGFR T790M wild-type template, the blocking effect is poor, and does not meet the requirements.

[0150] The experimental results of experimental groups 4-9 show that the screened blocker can effectively reduce the blocking efficiency of the wild-type template without affecting the mutant amplification and the detection of the mutant template by the probe, and can be used for subsequent combination research.

[0151] 3. Experimental conclusion

[0152] From the above experimental results, it can be seen that a suitable blocker can effectively reduce the blocking efficiency of the wild-type template without affecting the mutant amplification and the detection of the mutant template by the probe. Although the blocking effect of the EGFR T790M blocker in experimental group 3 is not very ideal, that is, a small amount of wild-type amplification can still be observed after adding the blocker, but the signal is greatly weakened. However, blocker-1106 is unstable in binding to the wild-type template and cannot effectively block the amplification of the EGFR T790M wild-type template. The blocking effect is poor and does not meet the requirements.

[0153] Example 3: Internal reference primer screening

[0154] Primers were designed using NCBI Blast, where the primer sequences are shown in Table 10.

[0155] Table 10 Sequence information

[0156] specific sequence SEQ ID NO. eIF2C1 FP1 TCTTTGGTGATCGCAAGCCT 33 eIF2C1 RP1 GCTTGGTTCTACCCCAGACC 36 eIF2C1 FP2 CTGGGCACATGAGCAACCTA 34 eIF2C1 RP2 CACACGCGGTACTTCCTCTT 37 eIF2C1 FP3 AAATCCCCTTGGGGTATGCTC 35 eIF2C1 RP3 CACGCGGTACTTCCTCTTCAT 38

[0157] 1. Screening of internal reference primers with stable product quantity and no specific amplification and dimer

[0158] 1.1 Experimental procedures

[0159] (1) 15 ng of genomic DNA from HEK-293 cells was extracted as a sample, and enzyme-free water was used as a blank control.

[0160] (2) Three temperature gradients were set at 56°C, 59°C, and 62°C. After amplification, the amount and specificity of the amplified product were determined based on the melting curve, and internal reference primers with stable product amount and no specific amplification and dimer were selected.

[0161] (3) Prepare the reagents shown in Table 11 and the reaction procedure is shown in Table 12.

[0162] Table 11 Reaction reagent ratio

[0163] Reagents Volume (μL) concentration 10X buffer 3.5 1X PCR polymerase 1 1X Upstream primer 1.05 300nM Downstream primer 1.05 300nM Evagreen 3.5 2X Enzyme-free water Make up — template 5 15ng

[0164] Table 12 Reaction conditions

[0165]

[0166] 1.2 Experimental Results

[0167] The amplification curves of three pairs of internal reference primers at different annealing temperatures are shown in Figure 5-7 .Depend on Figure 5-7 It can be seen that the product amount of the FP1 / RP1 primer pair at different temperatures is very small, while the product of the FP2 / RP2 primer pair is stable and has no non-specific peaks, and the product amount of the FP3 / RP3 primer pair decreases at 62°C and has no non-specific peaks.

[0168] 1.3 Experimental Conclusion

[0169] The annealing temperature test showed that the product amount of the FP1 / RP1 primer pair was low; the amplification efficiency of the FP2 / RP2 and FP3 / RP3 primer pairs under the reaction conditions needed to be further determined.

[0170] 2. Internal reference primer amplification efficiency test

[0171] In summary, the amplification efficiency of the FP2 / RP2 and FP3 / RP3 primer pairs was further tested.

[0172] The reaction template was diluted in gradients. Gradient samples 1-4 were 100 ng, 20 ng, 4 ng, and 0.8 ng of HEK-293 cell genomic DNA, respectively. The reagent preparation was shown in Table 11. The reaction conditions were shown in Table 13. After the Ct values ​​of template amplification of different gradients were plotted, the primer amplification efficiency was calculated.

[0173] Table 13 Reaction procedure

[0174]

[0175] The amplification efficiency test results of the FP2 / RP2 and FP3 / RP3 primer pairs are shown in Figure 8 Among them, the amplification efficiency of FP2 / RP2 is 103%, and the amplification efficiency of FP3 / RP3 is 93%.

[0176] In view of the fact that the amplification efficiency of the FP2 / RP2 primer pair is higher than that of the FP3 / RP3 primer pair, the FP2 / RP2 primer pair was subsequently selected as the internal reference primer in this detection system.

[0177] Example 4: Multiple blocker-PCR reaction on a fluorescent PCR platform

[0178] This example uses a fluorescent PCR platform to test the specificity of multiplex PCR reactions with added blockers, and to verify whether the various detection targets interfere with each other in multiplex blocker-PCR reactions.

[0179] 1. Experimental Procedure

[0180] (1) DNA from the cell line NCI-H1975 was extracted as the EGFR gene positive template; DNA from the cell line HT-29 was extracted as the B-raf gene positive template; DNA from the cell line Calu-1 was extracted as the K-ras gene positive template; DNA from the cell line HEK-923 was extracted as the negative template. See Table 14 for specific information.

[0181] Table 14 Template information table

[0182] template Mutation type Mutation frequency NCI-H1975 EGFR T790M 80％ HT-29 B-raf V600E 20％ Calu-1 K-ras G12C 80％ HEK-293 wild type / Enzyme-free water blank /

[0183] (2) The DNA extracted in step (1) was diluted to 3 ng / μL for later use. The primers, probes and blockers used for detection are shown in Table 15. The reaction solutions were prepared according to the formulas in Table 16. A control group without adding blockers was set up in each experimental group. The other components of the control group were the same as those of the experimental group, except that the blocker corresponding to the mutant gene was not added, and the same volume of nuclease-free water was used to make up the volume.

[0184] Table 15 Sequence information

[0185]

[0186] Table 16 Reaction system

[0187]

[0188]

[0189] (3) On-machine testing. The reaction procedure is shown in Table 6.

[0190] 2. Experimental results

[0191] Amplification curves of each experimental group are shown in Figure 9-13 .

[0192] The results of DNA extraction from NCI-H1975 cell line are shown in Fig. 9 In the experimental group without adding blocker, the probe combined with the wild-type template for amplification, resulting in signals in all mutation detection fluorescence channels; while in the experimental group with adding blocker, only the EGFR mutation detection and internal reference fluorescence channels had signals, indicating that the sample was positive for EGFR T790M mutation, which was consistent with the facts.

[0193] The results of DNA extraction from HT29 cell line are shown in Fig.10 In the experimental group without adding blocker, the probe combined with the wild-type template for amplification, resulting in signals in all mutation detection fluorescence channels; while in the experimental group with adding blocker, only the B-raf mutation detection and internal reference fluorescence channels had signals. There was a small amount of amplification signal in the ROX channel (EGFR), but the signal was greatly reduced. Analysis may be due to the competitive effect of the blocker, which greatly reduced the probability of the probe binding to the wild-type template and greatly reduced the signal to below the positive threshold line.

[0194] The results of DNA extraction from Calu-1 cell line are shown in Fig.11 In the experimental group without adding blocker, the probe combined with the wild-type template for amplification, resulting in signals in all mutation detection fluorescence channels; in the experimental group with adding blocker, only the K-ras mutation detection and internal reference fluorescence channels had signals. There was a small amount of amplification signal in the ROX channel, but the signal was greatly reduced.

[0195] The results of DNA extraction from HEK-293 cell lines are shown in Fig.12 In the experimental group without adding blocker, the probe combined with the wild-type template for amplification, resulting in signals in all mutation detection fluorescence channels; in the experimental group with adding blocker, only the internal reference fluorescence channel had signals. There was a small amount of amplification signal in the ROX channel, but the signal was greatly reduced.

[0196] NTC (no enzyme water blank group) test results see Fig.13 In the experimental group without adding blocker, the FAM channel detecting K-ras showed obvious non-specific amplification, but after adding blocker, the non-specific amplification disappeared. This shows that adding blocker can effectively improve the specificity of the reaction system.

[0197] 3. Experimental conclusion

[0198] In summary, when using fluorescence PCR to test multiplex blocker reactions, there is no interference between reactions. The blocker for each detected target can effectively block the amplification of wild-type templates without affecting the amplification of mutant templates, and at the same time can reduce the non-specific signals generated by mutant probes binding to wild-type templates.

[0199] Example 5 Blocker Blocking Efficiency Test on Digital PCR Platform

[0200] In this example, the digital PCR system biodigital·Qing from Shanghai Xiaohai Turtle Technology Co., Ltd. was used. The system has 4 - 5 fluorescence channels, can process 96 samples in parallel, and the effective number of droplets on the chip is 20,000 - 200,000. A control group without adding Blocker was set up. The other components of the control group were the same as those of the experimental group, without adding K-ras blocker, B-raf blocker, and EGFR blocker, and the volume was made up with the same volume of nuclease-free water.

[0201] 1. Experimental Procedures

[0202] (1) Extract the DNA of cell line NCI-H1975 as the positive template for the EGFR gene; extract the DNA of cell line HT-29 as the positive template for the B-raf gene; extract the DNA of cell line Calu-1 as the positive template for the K-ras gene; extract the cell line HEK-923 as the wild-type template. The specific information of the templates is shown in Table 14.

[0203] (2) Dilute the DNA extracted in step (1) to 3 ng / μl for use. The primers, probes, and blockers for detection are shown in Table 15, and the reaction solutions are prepared according to the formula in Table 16. In each experimental group, a control group without adding Blocker was set up. The other components of the control group were the same as those of the experimental group, without adding the blocker for the corresponding mutant gene, and the volume was made up with the same volume of nuclease-free water.

[0204] (3) According to the requirements of the operation manual of the digital PCR injector, turn on the chip injection program to complete chip injection. The reaction program is shown in Table 6.

[0205] 2. Experimental Results

[0206] The digital PCR results of each experimental group are shown in Figure 14-17 and Table 17.

[0207] The digital PCR detection results of the DNA extracted from the Calu-1 cell line sample are shown in Fig.14, the sample was 80% K-ras G12C mutant, Braf, EGFR wild type. In the blocker-control group, in addition to the FAM channel for detecting K-ras mutation and the internal reference CY-5 channel, non-specific signals also appeared in the VIC and ROX channels for detecting B-raf and EGFR. In the blocker+ experimental group, there were only FAM signals for detecting K-ras mutation and internal reference CY-5 signals.

[0208] The results of digital PCR test of DNA extracted from sample HT-29 cell line are shown in Fig.15 , the sample was 20% B-raf V600E mutant, K-ras, EGFR wild type. In the blocker-control group, in addition to the VIC channel for detecting B-raf mutation and the internal reference CY-5 channel, the FAM and ROX channels for detecting K-ras and EGFR also showed non-specific signals. In the blocker+ experimental group, there were only VIC signals for detecting B-raf mutation and internal reference CY-5 signals.

[0209] The results of digital PCR test of DNA extracted from NCI-H1975 cell line are shown in Fig.16 , the sample was 80% EGFRT790M mutant, K-ras, B-raf wild type. In the blocker-control group, in addition to the ROX channel for detecting EGFR mutation and the internal reference CY-5 channel, the FAM and VIC channels for detecting K-ras and B-raf also showed non-specific signals. In the blocker+ experimental group, there were only signals for detecting EGFR mutation and the internal reference CY-5 signal.

[0210] The results of digital PCR test of DNA extracted from HEK-293 cell line samples are shown in Fig.17 , the sample was wild type of K-ras, B-raf, EGFR. In the blocker-control group, in addition to the internal reference CY-5 channel, non-specific signals also appeared in the FAM, VIC, and ROX channels for detecting K-ras, B-raf, and EGFR. In the blocker+ experimental group, only the internal reference CY-5 signal was present.

[0211] NTC (no enzyme water blank group) test results see Fig.18 , there is no signal in all channels.

[0212] Table 17 Blocking rate of each experimental group

[0213]

[0214] Note: CY5 channel is the internal reference channel in this embodiment, so its blocking rate is not calculated. The test results show that the copy concentration of the internal reference primer set under Bl+ / Bl- is equivalent, and the concentration reaches the internal reference standard.

[0215] 3. Experimental conclusion

[0216] This multiple mutation detection reaction system was verified on a digital PCR platform, and the results showed that the addition of blocker can effectively block wild-type amplification and reduce wild-type non-specific signals.

[0217] Example 6 Multiplex PCR detection system for simulating clinical sample detection

[0218] In order to verify the accuracy and sensitivity of the multiplex PCR detection system disclosed in the present invention, this embodiment selected simulated clinical samples for digital PCR detection. The specific experimental steps and results are as follows.

[0219] 1. Experimental Procedure

[0220] (1) Extract DNA from cell line NCI-H1975 as EGFR gene positive template; extract DNA from cell line HT-29 as B-raf gene positive template; extract DNA from cell line Calu-1 as K-ras gene positive template; extract DNA from cell line HEK-923 as negative template. See Table 14 for specific mutation frequencies, and dilute to 3.5 ng / μL for later use.

[0221] (2) The primers, probes and blockers used for detection are shown in Table 15, and the reaction solutions are prepared according to the formulas in Table 16.

[0222] (3) Prepare samples containing 5%, 0.5%, 0.25%, and 0.1% of K-ras G12C, B-raf V600E, and EGFR T790M mutations, and add them to the reaction system of step (2), respectively.

[0223] (4) Start the chip injection program according to the instructions of the digital PCR injector and complete the chip injection. The reaction program is shown in Table 6.

[0224] 2. Experimental results

[0225] The test results are shown in Table 18. As can be seen from Table 18, in the detection of multiple mutation genes, the multiplex PCR detection system disclosed herein only detected the signal of the FAM channel in the sample with 5% K-ras G12C mutation, which is consistent with the actual situation, and its mutation ratio is 6.67%. In addition, the gradient dilution of 5%, 0.5%, 0.25%, 0.1% K-ras G12C mutation samples has a gradient reduction in mutation ratio, indicating that the multiplex PCR detection system disclosed herein has good specificity and high sensitivity while maintaining accuracy. Similarly, the detection results of samples with B-raf V600E and EGFR T790M mutations also have the same characteristics.

[0226] Table 18 Simulated clinical sample test results

[0227]

[0228] Example 7 Multiplex PCR Detection System for cfDNA Sample Detection of Clinical Samples

[0229] In order to further verify the accuracy of the multiplex PCR detection system disclosed in the present invention for the detection of clinical samples, this embodiment selected cfDNA of clinical samples for digital PCR detection. The specific experimental steps and results are as follows.

[0230] 1. Experimental Procedure

[0231] (1) Collect 10 ml of fresh whole blood samples from 10 clinical patients, of which 1 was K-ras G12C positive mutation (No. 5), 1 was EGFR T790M positive mutation (No. 6), and the remaining 8 were K-ras G12C, EGFR T790M, B-raf negative samples; collect the above samples, centrifuge at 700 g for 10 min at 4°C, and carefully transfer the supernatant to a new 15 ml centrifuge tube; centrifuge the supernatant in the centrifuge tube at 15000 g for 10 min at 4°C, and carefully transfer the supernatant to a new 15 ml centrifuge tube to obtain the separated plasma sample;

[0232] (2) Use QIAamp Circulating Nucleic Acid Kit (Qiagen, 55114) according to the operating instructions to extract cfDNA from the plasma sample in step (1), and determine the concentration for later use;

[0233] (3) The cfDNA extracted in step (1) was diluted to 3 ng / μL for standby use. The primers, probes, and blockers used for detection are shown in Table 15. The reaction solutions were prepared according to the formulas in Table 16.

[0234] (4) Start the chip injection program according to the instructions of the digital PCR injector and complete the chip injection. The reaction program is shown in Table 6.

[0235] 2. Experimental results

[0236] The digital PCR results of each experimental group are shown in Table 19. As can be seen from Table 19, in the detection of multiple mutant genes in multiple samples, only the signal of the FAM channel was detected in sample No. 5, of which the mutation ratio of K-ras G12C was 0.38%, and only the signal of the ROX channel was detected in sample No. 6, of which the mutation ratio of EGFR T790M was 1.09%. The above test results are consistent with the actual situation. It shows that the detection system disclosed in the present invention has good specificity and the result conformity rate reaches 100%. In the future, this detection system can be used for the detection of clinically relevant samples.

[0237] Table 19 cfDNA test results of clinical samples

[0238]

[0239]

[0240] Example 8 Multiplex digital PCR detection system for gene detection of lung cancer patients

[0241] During the treatment of non-small cell lung cancer patients, EGFR / K-RAS / B-raf / PIK3CA gene mutation detection is usually required as a reference for drug selection and screening of drug resistance causes. The multiplex digital PCR detection system disclosed in the present invention can also be used to detect the mutant gene combination, screen and determine the mutant gene type and mutation ratio of lung cancer patients. The primer probe combination and blocker selected in this embodiment are shown in Table 20.

[0242] Table 20

[0243]

[0244]

[0245] 1. Experimental Procedure

[0246] (1) DNA from Calu-1 cell line was used as a positive template for K-ras G12C gene mutation; DNA from HT-29 cell line was used as a positive template for B-raf V600E gene mutation; synthetic plasmid 014 (SEQ ID NO.117, synthesized by GenScript Biotech Co., Ltd.) was used as a positive template for PIK3CA H1047L gene mutation; DNA from cell line NCI-H1975 was used as a positive template for EGFR L858R / T790M gene mutation; DNA from cell line HCC827 was used as a positive template for EGFR 19del gene mutation; DNA from cell line HEK-293 was used as a negative template. See Tables 21 and 22 for specific information.

[0247] Table 21 Template information table

[0248] template Mutation type NCI-H1975 EGFR L858R / T790M mutation Calu-1 K-ras G12C mutant HT-29 B-raf V600E mutant Plasmid 014 PIK3CA H1047L mutant HCC827 EGFR 19del mutation HEK-293 Wild type

[0249] (2) Simulation sample preparation: The negative template and positive template extracted in step (1) were mixed according to the mutation frequencies in the table to obtain samples 1-6. Specific information is shown in Table 22.

[0250] Table 22 Simulation samples

[0251] Sample No. Mutation type Mutation frequency 1 Wild type (HEK-293 gDNA) 0 2 K-ras G12C (Calu-1 / HEK-293) 5％ 3 B-raf V600E(HT29 / HEK-293) 5％ 4 PIK3CA H1047L (plasmid 014 / HEK-293) 5％ 5 L858R / T790M(NCI-H1975 / HEK-293) 5％ 6 19del(HCC827 / HEK-293) 5％

[0252] (3) The samples obtained in step (2) were diluted to 3.5 ng / μL for standby use. The primers, probes and blockers used for detection are shown in Tables 23 and 24. The reaction solutions were prepared according to the formulas in Tables 23 and 24, respectively, to verify the detection results of the multiplex digital PCR detection system in samples 1-6.

[0253] Table 23 Tube 1 Reaction System

[0254]

[0255]

[0256] Table 24 Tube 2 Reaction System

[0257] Reagents Volume (μL) concentration 10X buffer 3.5 1X PCR polymerase 1 - EGFR L858R FP 1.05 300nM EGFR L858R RP 1.05 300nM EGFR L858R blocker 2.1 600nM EGFR L858R probe 0.7 200nM EGFR 19del FP 1.05 300nM EGFR 19del RP 1.05 300nM EGFR 19del blocker 2.1 600nM EGFR 19del Probe 0.7 200nM EGFR T790M FP 1.05 300nM EGFR T790M RP 1.05 300nM EGFR T790M blocker 2.1 600nM EGFR T790M Probe 0.7 200nM eIF2C1 FP 1.05 300nM eIF2C1 RP 1.05 300nM EIF2C1 Probe 0.7 200nM Enzyme-free water Make up -- template 5 15ng DNA

[0258] (4) On-machine testing. The reaction procedure is shown in Table 6.

[0259] 2. Experimental results

[0260] The digital PCR results of each experimental group are shown in Tables 25 and Fig.19 and 20 From Table 25 and Fig.19 , 20 It can be seen that under this detection system, the test results of samples 1-6 are consistent with the actual mutation status of the samples. In the future, this detection system can be used for the detection of clinically relevant samples.

[0261] Table 25

[0262]

[0263]

[0264] Example 9 Multiplex digital PCR detection system for gene detection of colorectal cancer patients

[0265] Medical guidelines recommend that metastatic or recurrent colorectal cancer requires detection of RAS (KRAS / NRAS) and B-RAF mutations. The multiplex digital PCR detection system disclosed herein can also be used to detect the mutant gene combination, screen and determine the mutant genes and their mutation ratios in colorectal cancer patients. The primer probe combination and blocker selected in this embodiment are detailed in Table 26.

[0266] Table 26

[0267]

[0268] 1. Experimental Procedure

[0269] (1) DNA from Calu-1 cell line was extracted as a positive template for K-ras G12C gene mutation; DNA from HT-29 cell line was extracted as a positive template for B-raf V600E gene mutation; synthetic plasmid 028 was used as a positive template for N-ras Q61K gene mutation; DNA from cell line NCI-H1975 was extracted as a negative template. See Table 27 for specific information.

[0270] Table 27 Template information table

[0271] Mutation type NCI-H1975 K-ras / B-raf / N-ras wild type Calu-1 K-ras G12C mutant HT-29 B-raf V600E mutant Plasmid 028 N-ras Q61K mutant

[0272] (2) Simulation sample preparation: The negative template and positive template extracted in step (1) were mixed according to the mutation frequencies in the table to obtain samples 1-4; for specific information, see Table 28.

[0273] Table 28 Simulation samples

[0274]

[0275]

[0276] (3) The samples obtained in step (2) were diluted to 3.5 ng / μL for standby use. The primers, probes and blockers used for detection are shown in Table 29. The reaction solutions were prepared according to the formula in Table 29 to verify the expression of the multiplex digital PCR detection system in samples 1-4.

[0277] Table 29 Reaction system

[0278] Reagents Volume (μL) concentration 10X buffer 3.5 1X PCR polymerase 1 - K-ras FP 1.05 300nM K-ras RP 1.05 300nM K-ras blocker 2.1 600nM K-ras Probe 0.7 200nM B-raf FP 1.05 300nM B-raf RP 1.05 300nM B-raf blocker 2.1 600nM B-raf Probe 0.7 200nM N-ras FP 1.05 300nM N-ras RP 1.05 300nM N-ras blocker 2.1 600nM N-ras Probe 0.7 200nM eIF2C1 FP 1.05 300nM eIF2C1 RP 1.05 300nM EIF2C1 Probe 0.7 200nM Enzyme-free water Make up template 5 15ng DNA

[0279] (4) On-machine testing. The reaction procedure is shown in Table 6.

[0280] 2. Experimental results

[0281] The digital PCR results of each experimental group are shown in Table 30 and Fig.21 From Table 30 and Fig.21It can be seen that under this detection system, the test results of samples 1, 2 and 3 are consistent with the actual situation. In the future, this detection system can be used for the detection of clinically relevant samples.

[0282] Table 30

[0283] Detection channel Detection site Sample 1 Sample 2 Sample 3 Sample 4 FAM K-ras 63.232 0 0 0 VIC B-raf 0 91.037 0 0 ROX N-ras 0 0 52.073 0 CY-5 Internal reference 735.727 632.57 641.789 727.054 result -- K-ras mutation positive B-raf mutation positive N-ras mutation positive K-ras / B-raf / N-ras negative

[0284] Example 10 Multiplex digital PCR detection system for genetic detection of breast cancer patients

[0285] Considering that the common mutant genes in breast cancer patients include ESR1 / PIK3CA, the multiplex digital PCR detection system disclosed in the present invention can also be used to detect the mutant gene combination, screen and determine the mutant genes and their mutation ratios of breast cancer patients. The primer probe combination and blocker selected in this embodiment are shown in Table 31.

[0286] Table 31

[0287]

[0288]

[0289] 1. Experimental Procedure

[0290] (1) Synthetic plasmid 011 (SEQ ID NO. 116, synthesized by GenScript Biotech Co., Ltd.) was used as the ESRD538G gene mutation positive template; synthetic plasmid 014 was used as the PIK3CA H1047L gene mutation positive template; DNA extracted from the cell line NCI-H1975 was used as the negative template. Specific information is shown in Table 32.

[0291] Table 32 Template information table

[0292] template Mutation type NCI-H1975 ESR1 / PIK3CA wild-type Plasmid 011 ESR1 D538G mutant Plasmid 014 PIK3CAH1047L mutant

[0293] (2) Simulation sample preparation: The negative template and positive template extracted in step (1) were mixed according to the mutation frequencies in the table to obtain samples 1-3; see Table 33 for specific information.

[0294] Table 33 Simulation samples

[0295] Sample No. Mutation type Mutation frequency 1 ESR1 D538G (plasmid 011 / NCI-H1975) 5％ 2 PIK3CA H1047L (Plasmid-014 / NCI-H1975) 5％ 3 Wild type (NCI-H1975gDNA) 0

[0296] (3) The samples obtained in step (2) were diluted to 3.5 ng / μL for later use. The primers, probes and blockers used for detection are shown in Table 34. The reaction solutions were prepared according to the formula in Table 34 to verify the expression of the multiplex digital PCR detection system in samples 1-3.

[0297] Table 34 Reaction system

[0298]

[0299]

[0300] (4) On-machine testing. The reaction procedure is shown in Table 6.

[0301] 2. Experimental results

[0302] The digital PCR results of each experimental group are shown in Tables 35 and Fig. 22 From Table 35 and Fig. 22 It can be seen that under this detection system, the test results of samples 1, 2 and 3 are consistent with the actual situation. In the future, this detection system can be used for the detection of clinically relevant samples.

[0303] Table 35

[0304] Detection channel Detection site Sample 1 Sample 2 Sample 3 FAM ESR1 44.772 0 0 VIC PIK3CA H1047 / E542 0 60.861 0 CY-5 Internal reference 1532.465 1623.548 1520.079 result -- ESR1 mutant PIK3CA mutant ESR1 / PIK3CA wild-type

[0305] Considering the variability of mutant gene combinations, the multiplex digital PCR detection system disclosed in the present invention is theoretically suitable for detecting any combination of the above mutant genes.

[0306] The above-mentioned embodiments only express several implementation methods of the present disclosure, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present disclosure, and these all belong to the protection scope of the present disclosure. Therefore, the protection scope of the patent of the present disclosure shall be subject to the attached claims.

Claims

1. A multiplex digital PCR detection reagent or detection kit for detecting gene mutations, comprising detection primers corresponding to the target, a wild-type blocking probe blocker and a detection probe, wherein: The detection primers corresponding to the target include an upstream primer and a downstream primer, and the target is selected from any one of K-ras, B-raf, EGFR, ESR1, PIK3CA and N-ras or any combination thereof.

2. The detection reagent or detection kit according to claim 1, wherein The detection primer, wild-type blocking probe blocker and detection probe corresponding to the target are selected from any one of the following groups or any combination thereof: (1) The upstream primer for detecting K-ras mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 1-3 and 103; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 4-6 and 104; the K-ras blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 7-9 or its 3' end has other modifications that block the extension of the blocker itself or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modification that blocks the extension of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in any one of NO.10-11 and 113 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto590, BODIPY FL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB; (2) The upstream primer for detecting B-raf mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 12-14; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 15-17; the B-raf blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 18-20 or its 3' end has other modifications that block the extension of the blocker itself or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modification that blocks the extension of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in any one of NO.21-22 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto 590, BODIPYFL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB; (3) The upstream primer for detecting EGFR T790M mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs.23-25; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs.26-28; the EGFR blocker is selected from the nucleotide sequence shown in SEQ ID NOs.29 or 31, or its 3' end has other modifications that block the extension of the blocker itself, or the locked nucleic acid of its nucleotide sequence is modified to be selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modifications that block the extension of the blocker itself are selected from MGB, inverted dT or ddC; the detection probe is selected from the nucleotide sequence shown in SEQ ID NO.32, or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified, or the locked nucleic acid of its nucleotide sequence is modified to be selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto 590, BODIPYFL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; More preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB; (4) The upstream primer for detecting ESR1 mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 40-42; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 43-45; the ESR1 Blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs. 46-48, 108, or its 3' end has other modifications that block the extension of the blocker itself, or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modification that blocks the extension of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in NO.49 or 111 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto 590, BODIPYFL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB; (5) The upstream primer for detecting the PIK3CA E542 / E545 mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs.50-52 and 105; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs.53-55 and 106; the PIK3CA E542 / E545 Blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs.56-58 or its 3' end has other modifications that block the extension of the blocker itself or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modifications that block the extension of the blocker itself are selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in any one of NO.59-60 and 107 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto 590, BODIPY FL, JOE, R110, NED, Pacific Blue, Quasar570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB; (6) The upstream primer for detecting the PIK3CA H1047 site mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs.61-63; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs.64-66; the PIK3CA H1047 Blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs.67-69, 110, 114, or its 3' end has other modifications that block the extension of the blocker itself, or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modification that blocks the extension of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in any one of NO.70-71, 109, and 115 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto 590, BODIPY FL, JOE, R110, NED, Pacific Blue, Quasar570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB; (7) The upstream primer for detecting N-ras mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs.72-74; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs.75-77; the N-ras Blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs.78-80 or its 3' end has other modifications that block the extension of the blocker itself or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modification that blocks the extension of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in any one of NO.81-82, 112 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto 590, BODIPY FL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB; (8) The upstream primer for detecting EGFR L858R mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs.83-85; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs.86-88; the EGFR L858R Blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs.89-91 or its 3' end has other modifications that block the extension of the blocker itself or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modification that blocks the extension of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in NO.92 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto 590, BODIPY FL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB; (9) The upstream primer for detecting EGFR 19del mutation is selected from the nucleotide sequence shown in any one of SEQ ID NOs.93-95; the downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NOs.96-98; the EGFR 19del Blocker is selected from the nucleotide sequence shown in any one of SEQ ID NOs.99-101 or its 3' end has other modifications that block the extension of the blocker itself or its nucleotide sequence is modified to be selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other modification that blocks the extension of the blocker itself is selected from MGB, inverted dT or ddC; the detection probe is selected from SEQ ID The nucleotide sequence shown in any one of NO.102 or its 5' end and / or 3' end has other fluorescent groups or quenching groups modified or the locked nucleic acid modification of its nucleotide sequence is selected from the following modifications: hexitol nucleic acid, 2'-O-methylated oligonucleotide, peptide nucleic acid modification; preferably, the other fluorescent groups or quenching groups are selected from: FAM, HEX, VIC, ROX, Cy3, cy5, Cy5.5, Cy7, Alexa Fluor 488, AMCA, AquaPhluor 593, Allo 425, Atto590, BODIPY FL, JOE, R110, NED, Pacific Blue, Quasar 570, Quasar 670, TAMRA, FITC, TET, Texas red, Yakima Yellow, BHQ1, BHQ2, BHQ3, MGB, Dabcyl, Eclipse; more preferably, the other fluorescent group or quenching group at the 5' end is selected from: FAM, VIC, HEX, ROX, CY-5, CY5.5; the other fluorescent group or quenching group at the 3' end is selected from: BHQ1, BHQ2, MGB; Optionally, the detection probe and / or blocking probe blocker has or does not have a modification.

3. The detection reagent or detection kit according to claim 1 or 2, wherein: The kit further comprises an internal reference, which comprises an internal reference detection probe, an internal reference upstream primer and an internal reference downstream primer; Preferably, the internal reference upstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NO.33-35; Preferably, the internal reference downstream primer is selected from the nucleotide sequence shown in any one of SEQ ID NO.36-38; Preferably, the internal reference detection probe comprises the nucleotide sequence shown in SEQ ID NO.

39.

4. The detection reagent or detection kit according to any one of claims 1 to 3, wherein The detection probe and / or blocking probe blocker are modified; Preferably, the modification is selected from one or more of locked nucleic acid modification, peptide nucleic acid modification, phosphorothioate modification, ddC, inverted dT, MGB, quencher modification or fluorescent group modification; More preferably, the modification is one or more of locked nucleic acid modification, phosphorothioate modification, ddC, inverted dT or MGB modification.

5. The detection reagent or detection kit according to any one of claims 1 to 4, wherein The 5' end of the probe is modified with a fluorescent group and / or the 3' end is modified with a quenching group; Preferably, the fluorescent group is selected from one of the following: FITC, TET, JOE, R110, FAM, CY5, CY5.5, HEX, VIC, ROX or CY3; Preferably, the quenching group is selected from one of the following: TAMRA, BHQ-1, BHQ-2, Dabcyl or MGB.

6. A method for detecting gene mutations by multiplex digital PCR, which can simultaneously detect at least two mutation sites in one PCR sample, wherein the mutations are located at the same target site or different target sites, and the detection method comprises: (1) Obtaining DNA from the sample to be tested; (2) mixing the DNA obtained in step (1), the detection primers corresponding to the target points according to any one of claims 1 to 5, the detection probe, the blocker, and an optional internal reference; (3) droplet generation, PCR amplification, and chip reading; (4) reading the fluorescence signal of the PCR amplification product and determining the mutation status in the test sample based on the fluorescence signal; Preferably, the DNA is free DNA.

7. The method according to claim 6, wherein: The sample to be tested is selected from one or more of tumor cells, blood, plasma, pleural effusion, peritoneal effusion, saliva, urine, tissue or fetal early detection sample; Preferably, the sample to be tested is a blood sample, a plasma sample, a tissue sample or a cell sample; Preferably, the blood sample is a peripheral blood sample.

8. The method according to claim 5 or 6, wherein: The sample is selected from one or more of lung cancer, colorectal cancer or breast cancer samples.

9. Use of the detection reagent or detection kit according to any one of claims 1 to 5 and / or the method according to any one of claims 6 to 8 in multiple gene mutation detection.

10. The use according to claim 9, wherein the gene mutation detection is a gene detection before targeted therapy.

Images