Method and reagent for obtaining monoclonal target polynucleotide cluster through isothermal amplification on surface of biochip and application

Abstract

The invention discloses a method for obtaining a target polynucleotide cluster through solid phase surface isothermal amplification, a reagent and application. By improving an RPA isothermal amplification technology, library amplification is realized on a non-array chip by isothermal amplification, and a target polynucleotide cluster is formed, so that DNA sequencing is supported.

Description

Technical Field

[0001] The present invention belongs to the field of nucleic acid amplification, and specifically relates to a method and reagent for isothermal amplification on a biochip solid surface to obtain a target polynucleotide cluster, which is used in applications requiring high throughput, especially nucleic acid sequence determination. Background Art

[0002] Nucleic acid sequencing analysis has become the basis of many activities in biology, biotechnology and medicine. The genetic information it provides has a wide range of applications, such as drug target discovery and confirmation, disease diagnosis, risk assessment, and organism identification and characterization. The basic component of nucleic acid sequencing is the preparation of the genetic material to be tested. The original sample containing the nucleic acid to be sequenced usually does not provide enough material for sequencing analysis. Biochips are made by fixing polynucleotide molecules on microcarriers in a microarray manner. The invention of biochips can achieve the amplification of the original sample to a sufficient amount to support the needs of high-throughput sequencing.

[0003] In existing sequencing technologies, it is generally necessary to perform pre-sequencing treatment on the original sample in order to achieve amplification of the original sample on a biochip. A complete pre-sequencing treatment process includes genomic DNA fragmentation, end repair, A base modification, adding adapters, magnetic bead purification, PCR enrichment and other processes to prepare a DNA library that meets sequencing requirements. In this library, the adapters connected to the two ends of the fragmented DNA can be complementary paired with the forward or reverse primers fixed on the biochip. After the library is denatured and hybridized with the primers on the biochip, cyclic amplification of the DNA can exponentially amplify the target polynucleotide single-stranded molecule from a single copy to a point that can be detected by the detector. This method of amplification on a biochip is called amplification of polynucleotide clusters.

[0004] When Illumina makes biochips for high-throughput sequencing, the primers are fixed on the surface of the solid support in a random manner to form a biochip in which two primers are evenly distributed on the solid support, also known as a random-arranged biochip. In order to achieve the amplification of polynucleotide clusters on this type of biochip, the patent US8652810B2 (ILLUMINA, INC.) describes an amplification method and names the technology bridge amplification (bridge amplification) technology. Illumina designs a pair of primers (primer 1 and primer 2) connected to the solid surface and connects them to the target polynucleotide. When the target polynucleotide contacts the solid surface, one end of it hybridizes with primer 1 and is extended by the sequence of primer 1 and the action of DNA polymerase. After denaturation, the other end of the amplified product is complementary to primer 2, and is extended again by polymerase to form a nucleic acid sequence and primer 1 that are complementary to the first amplified product. In this way, the target polynucleotide can form multiple copies on the solid surface, and the number can be controlled by PCR cycles. Products such as the same target polynucleotide molecule amplified into multiple copies on the solid support surface are also called target polynucleotide clusters. The amplification reagents used in the bridge amplification are consistent with the reagents used in the PCR cycle in the solution, including thermostable DNA polymerase, metal ions, buffers, dNTPs and other necessary components for the polymerase to act. In the example provided, the amplification reagents on the solid surface include: dNTP (0.2mM); 0.1% BSA (bovine serum albumin); 0.1% Tween 20; 8% DMSO; 1×PCR buffer; 0.025U / μl; AmpliTaq DNA polymerase. After the reagent is immersed in the solid material, amplification is performed using a thermal cycle, which includes denaturation at 94°C for 30s, annealing at 65°C for 2min, and extension at 72°C for 2min. And the process is cycled 50 times, but because thermal cycling is required, higher requirements are also placed on the temperature control of the equipment.

[0005] WO2007107710A1 (SOLEXA, INC.) provides a method for amplification without using thermal cycles based on PCR reagents. The invention involves pumping an amplification reaction solution containing Bst enzyme into a biochip at 37°C for 180 seconds for amplification. After the amplification, a 0.1M NaOH solution (formamide, guanidine hydrochloride, etc. can also be used) is used for denaturation to replace thermal cycles for cluster amplification. The process still needs to be repeated 30 times. Using reagents for denaturation requires the introduction of new reagents during each round of denaturation. The amount of reagent used will be 30 times that of one cycle, so the number of cycles directly determines the amount of reagent used. In addition, since multiple rounds of cyclic amplification are required, the total time required is lengthy.

[0006] Illumina provides a solution for amplification on the surface of a patterned chip in the patent US8895249B2 (ILLUMINA, INC.). One of the amplification reagents in the solution uses TwistAmp recombinase polymerase amplification reagent (RPA) from Twist, which can achieve rapid amplification of the target polynucleotide to be tested at 37-42°C. It has the advantages of high reaction sensitivity, strong specificity, and low dependence on instruments. It does not require a cyclic amplification technology similar to the bridge amplification used when amplifying on a random chip. The arrayed nanopores designed on the patterned chip can confine the target polynucleotide clusters amplified by the RPA reagent within the pores, which can effectively force the formation of circular and spaced monoclonal target polynucleotide clusters. However, when the RPA reagent is amplified directly on the random biochip, it will produce heteromorphic polynucleotide clusters, and multiple monoclonal target polynucleotide clusters will be superimposed to form irregular polynucleotide clusters, which cannot be recognized as sequencing signals by the algorithm, resulting in low-quality data. Therefore, RPA amplification technology has always been used only on Patterned chips and cannot be used on Random chips. Summary of the invention

[0007] The purpose of the present invention is to provide a reagent and an amplification method for isothermal amplification on a non-array solid support in view of the current status and shortcomings of the prior art, which does not require multiple temperature rise and fall cycles, can save reagent costs, shorten sequencing time, and at the same time, can also avoid the generation of heteromorphic polynucleotide clusters.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] In a first aspect, a reagent for isothermal amplification of a target polynucleotide cluster on a non-array solid support is provided, the reagent comprising a reagent R1 and a reagent R2;

[0010] The reagent R1 includes: DNA polymerase, surfactant, dNTPs and magnesium ions;

[0011] The reagent R2 shown includes: DNA polymerase, recombinase, single-strand binding protein, auxiliary protein, PEG, dNTPs, ATP, creatine phosphate, creatine kinase, magnesium acetate and potassium acetate.

[0012] Furthermore, the reagent R1 also includes a buffer, including but not limited to Tris, Glycine-HCl buffer, acetate buffer or citrate buffer, preferably Tris; preferably, the concentration of the buffer is 20-500 mM.

[0013] Furthermore, the reagent R1 also includes an ammonium salt, including but not limited to ammonium sulfate, ammonium acetate or ammonium chloride, and the concentration of the ammonium salt is 20-200 mM.

[0014] Furthermore, the magnesium ion in the reagent R1 is selected from: magnesium sulfate, magnesium acetate or magnesium chloride; preferably, the magnesium salt in R1 is selected from magnesium sulfate; and the concentration of the magnesium ion is 4-100 mM.

[0015] Furthermore, the surfactant is selected from: anionic surfactants, cationic surfactants, nonionic surfactants or zwitterionic surfactants; preferably nonionic surfactants, more preferably Tween (such as Tween 10, 20, 60) or TX-100, and the concentration of the surfactant is 0.01%-1%.

[0016] Furthermore, the concentration of dNTPs in R1 is 0.02-2 mM, and the concentration of dNTPs in R2 is 0.2-20 mM.

[0017] Furthermore, the reagent R2 also includes a buffer, including but not limited to acetate buffer, Tris, Glycine-HCl buffer or citric acid buffer, preferably acetate buffer, and the concentration of the buffer is 20-200 mM.

[0018] Further, the reagent R2 further comprises trehalose and / or a reducing agent; the reducing agent is selected from DTT, DTE, TCEP-HCl, preferably DTT. The concentration of the reducing agent is 1.0-5.0 mM, the concentration of the trehalose is 1-10% (w / v), and the concentration of the dNTPs is 0.1-20 mM.

[0019] Further, the DNA polymerase is selected from: bacteriophage polymerase, Bst polymerase, Sau polymerase, Phi29 polymerase, Gst polymerase, Vent polymerase, PyroPhage polymerase, Bsu polymerase, Deep-Vent polymerase, Klenow polymerase or DispIaceAce polymerase, preferably Bst polymerase or Bsu polymerase. The concentration of the DNA polymerase is 0.01-5U / μL.

[0020] Furthermore, the recombinase is selected from UvsX, RecA, RecT or RecO, more preferably UvsX; the concentration of the recombinase is 10-600 ng / μL.

[0021] Furthermore, the single-stranded binding protein SSB is selected from T4 GP32 or ET SSB, preferably GP32; the concentration of the single-stranded binding protein is 300-1500 ng / μL.

[0022] Furthermore, the auxiliary protein is selected from T4 UvsY, and the concentration of the auxiliary protein is 5-200 ng / μl.

[0023] Furthermore, the PEG is selected from PEG1000-35000, such as PEG1000, PEG2000, PEG3000, PEG4000, PEG6000, PEG8000, PEG10000, PEG20000, PEG35000, PEG40000; the concentration of the PEG is 1%-10% (w / v).

[0024] Furthermore, the concentration of ATP is 1-10 mM, the concentration of creatine phosphate is 2-60 mM, the concentration of creatine kinase is 0.01-10 U / μl; the concentration of magnesium acetate is 5.0-15 mM; and the concentration of potassium acetate is 25-100 mM.

[0025] Furthermore, R2 may also include BSA; or a surfactant, such as Tween 20, Tween 40, Tween 65, Tween 80 or Tween 85; or a defoaming agent, such as a nonionic defoaming agent; or a single-side adapter primer, such as P5 (AATGATACGGCGACCACCGAGATCTACAC) or P7 (CAAGCAGAAGACGGCATACGAGAT). The above components are used to remove bubbles in the reagent and increase the density of cluster formation, thereby reducing the phenomenon of vacuoles in the amplified clusters.

[0026] In a second aspect, a method for obtaining a target polynucleotide cluster by isothermal amplification on a non-array solid support (hereinafter referred to as fixed-strand amplification) is provided, comprising the following steps:

[0027] 1) Template hybridization: The template target polynucleotide single strand is hybridized with the adapter primer pair of the non-array solid support;

[0028] 2) First chain synthesis: introducing reagent R1 among the reagents described in the first aspect to synthesize the first chain;

[0029] 3) Synthesis of target polynucleotide clusters: removing the single-stranded template target polynucleotide, and introducing the reagent R2 in the reagents described in the first aspect to synthesize a monoclonal target polynucleotide cluster.

[0030] Furthermore, the method may also include step 0) preparation and denaturation of the target polynucleotide library before step 1): randomly interrupting the genomic DNA, connecting forward or reverse primers at both ends to obtain a target polynucleotide library, which is in a double-stranded state; this step is not a necessary step. In addition to preparing the target polynucleotide library in step 1) by itself through step 0), a commercial finished product library or a standard library can also be directly purchased. Regardless of whether it is prepared by itself or purchased, it is well known in the art that the primers at both ends of the library need to be paired with non-array solid support primers. For example, the primers at both ends and the non-array solid support primers are selected from P5 (AATGATACGGCGACCACCGAGATCTACAC) and P7 (CAAGCAGAAGACGGCATACGAGAT). The obtained target polynucleotide library is then treated with a denaturing agent to become a single-stranded molecule of the target polynucleotide.

[0031] In the implementation process of the method of the present invention, in order to eliminate the interference of excess reagents in the previous step, a corresponding buffer is used for washing. The first suitable buffer is a buffer that promotes hybridization reaction, such as SSC or Tris-HCl commonly used in the art. The second suitable buffer of the present invention promotes nucleic acid denaturation, such as sodium hydroxide or formamide known in the art.

[0032] In a third aspect, an application of the reagent described in the first aspect is provided, wherein the application is used to provide nucleic acid molecules used for nucleic acid sequencing and resequencing in the following fields: genomics, pharmacogenomics, drug development, food property analysis, genotyping, diagnosis, monitoring of gene expression, genetic diversity distribution map, whole genome sequencing and discovery of polymorphisms or any other application involving nucleic acid amplification.

[0033] The principle of the present invention to obtain target polynucleotide clusters by isothermal amplification on a non-array solid support is as follows:

[0034] 1) The non-array solid support is distributed with adapter primer sequences that can complementally pair with the two ends of the library prepared from the target polynucleotide. The 5' end of these primer sequences is fixed to the solid surface by covalent bonding, and the 3' end of the primer has a free active hydroxyl group that can be extended along the paired template under the action of DNA polymerase.

[0035] 2) When the denatured single-stranded target polynucleotide is introduced into the chip, since sequences that can complementarily pair with the primers on the biochip surface have been connected to both ends of the target polynucleotide when the target polynucleotide is prepared into a library, the target polynucleotide library forms a single-stranded state after denaturation, which will complementarily pair with the primer sequence fixed on the solid surface of the biochip. The single-stranded target polynucleotide can better pair with the linker sequence on the chip.

[0036] 3) The target polynucleotide single strand has been successfully paired with the adapter sequence on the chip, and then the amplification reagent R1 is introduced. The amplification reagent R1 contains DNA polymerase, which can use the library as a template and the adapter sequence fixed on the biochip as a primer to extend the first strand. After the first strand is synthesized, since the 5' end primer is fixed on the chip, the product of the first strand synthesis is also fixed on the chip. Since the newly synthesized DNA double strand is not denatured at this time, the extension result should only synthesize the first strand after the target polynucleotide single strand is paired.

[0037] 4) DNA denaturation treatment (or any reagent and temperature that can denature double-stranded DNA) can be performed. Since only one DNA strand of the double-stranded DNA is fixed on the surface of the biochip through primers after the first strand is synthesized, the template target polynucleotide that is not fixed on the chip can be denatured and washed away. At this time, only one single-stranded DNA strand complementary to the template target polynucleotide strand remains on the chip.

[0038] 5) Reagent R2 contains recombinant proteins and DNA polymerase with strand displacement activity. At 37°C, after reagent R2 is introduced, the recombinant proteins in the reagent form a protein-DNA filamentous complex with the single-stranded adapter primer fixed on the chip, and search for complementary sequences under the action of ATP. As a result, the synthesized first-strand DNA will be complementary to the nearby single-stranded adapter primer and form an arch bridge structure. At this time, the DNA polymerase will replace the recombinant protein and replicate along the template. After the replication is completed, the protein-DNA filamentous complex formed by the recombinant protein and the primer will search for complementary sequences and open the DNA double strand for the next replication cycle. Under the action of auxiliary proteins, single-stranded binding proteins and ATP circulation system, this replication process can proceed spontaneously at a constant temperature.

[0039] Definition and explanation:

[0040] Target polynucleotide cluster

[0041] The target polynucleotide library with P5 or P7 sequences at both ends is complementary paired with the P5 or P7 bases on the surface of the solid support in the form of a single molecule, and multiple rounds of DNA polymerization reactions are carried out in the presence of necessary components to form multiple target polynucleotide molecules aggregated together on the solid support. Such a DNA community composed of many target polynucleotide molecules aggregated on the surface of the solid support after multiple rounds of DNA polymerization reactions from one or more target polynucleotide libraries is called a target polynucleotide cluster.

[0042] Solid support

[0043] Suitable solid support materials include controlled pore glass (CPG), silica gel, macroporous cross-linked polystyrene, poly(vinyl methacrylate) copolymer, silicon chip, glass, polystyrene beads, polypropylene sheets, non-porous silica beads, polyacrylamide or polyacrylate, etc. Solid supports are well known in the art, as described in "Solid-Phase Supports for Oligonucleotide Synthesis" in Current Protocols in Nucleic Acid Chemistry, 2000, Chapter 3, Section 3.1.

[0044] The solid support material is made into a solid support without dead corners such as a membrane, a disk or a cylinder, which is then fixed or enclosed in a suitable container such as a tube or a plate, or prepared into a rectangular sheet.

[0045] The term "arrayed solid support" means that P5 and P7 primers are covalently bound to the surface of the solid support, and their binding sites are relatively regularly arranged on holes, pits, channels, ridges, raised areas, pins, columns or similar structures on the support surface. Such areas can be polygonal or circular, thereby forming an array structure on the surface of the solid support.

[0046] The term "non-arrayed solid support" means that when the primers are modified on the surface of the solid support, they are not arranged relatively regularly on the holes, pits, channels, ridges, raised areas, pins, columns or similar structures on the surface of the support, but the primers are randomly modified on the surface of the solid support.

[0047] After the solid support surface is inoculated with the polynucleotide primers P5 and P7 in the form of covalent chemical bonds, the solid support is generally called a "DNA chip" or "biochip". Among them, the biochip with array modification on the solid support surface is called a pattern chip, and the biochip with random modification is called a random chip.

[0048] In some embodiments, the solid support may be a commercial biochip. For example, the commercial biochip provided in the NextSeq 500 / 550v2.5 Kits of Illumina is a Random chip, and the biochip provided in the NovaSeq 6000 Reagent Kits of Illumina is a Pattern chip.

[0049] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms in the present disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs.

[0050] Beneficial effects of the present invention:

[0051] 1) Less reagent volume

[0052] The present invention provides a non-array solid support, such as a target polynucleotide amplification on a random chip surface. Compared with the existing bridge PCR reaction for amplification on a random chip solid surface, the fixed-chain method eliminates the need for multiple rounds of reagent replacement and reaction in the denaturing reagent scheme used in the bridge PCR amplification. The reagent usage of the present invention is greatly reduced, which can save reagent costs.

[0053] 2) Shorten reaction time

[0054] In the embodiments of bridge PCR amplification described in patent US8652810B2 (ILLUMINA, INC.) and WO2007107710A1 (SOLEXA, INC.), 30-50 rounds of thermal cycles or reagent cycles are used in the amplification on the Random chip, and the reaction time is relatively long. This is mainly because each round of reaction of the amplification reagent involves heating, cooling or liquid replacement, polymerization reaction and other processes, and there are many processes. According to the embodiment in WO2007107710A1 (SOLEXA, INC.), it is estimated that in each round of amplification, it takes 75 seconds to pass the denaturing reagent, 120 seconds to pass the neutralizing reagent, 75 seconds to rinse, and 255 seconds to pass the extension reagent and incubate. Each cycle takes at least 525 seconds. If you want to get better results, more rounds of amplification will result in longer amplification time. The amplification method used in the present invention can effectively solve the problem of long reaction time. The amplification reagent does not require thermal cycling or denaturing reagents. The synthesis stage of the target polynucleotide cluster only requires one round of liquid flow under constant temperature conditions for 20-30 minutes to complete the reaction. Therefore, the present invention can quickly amplify the target polynucleotide into clusters, greatly shortening the reaction time.

[0055] 3) The temperature is suitable and does not involve temperature changes

[0056] The amplification method of the present invention does not involve variable temperature amplification, so theoretically only constant temperature control equipment is needed to complete the reaction, which places lower demands on equipment temperature control and can also greatly avoid the reduction in amplification reaction efficiency caused by temperature control conditions.

[0057] 4) Even distribution

[0058] Since the primers on the Random chip are randomly distributed and not limited by nanopores, when R2 is directly used as an amplification reagent, the amplified target polynucleotide clusters are irregular in shape and clustered, which has a great impact on subsequent analysis. The target polynucleotide clusters formed by the present invention can use a lower template amount (1.5pM) to achieve a target polynucleotide cluster density similar to that of a higher template amount (20pM) when R2 is directly used as an amplification reagent, and the clusters are more uniform and fill the field of view. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] FIG1 is a fluorescence image of base A in the first cycle of sequencing when the target polynucleotide cluster is obtained by amplifying the premixed target polynucleotide single strands on a solid surface using only the isothermal amplification reagent R2; Figure 1a The target nucleic acid concentration was 1.5 pM. Figure 1b The target nucleic acid concentration was 20 pM;

[0060] Figure 2 . Formation of target polynucleotide clusters by a fixed one-strand amplification scheme for the first cycle of A base fluorescence image during sequencing;

[0061] Figure 3 . Formation of target polynucleotide clusters by a fixed one-strand amplification scheme for the A base fluorescence map of the first cycle during sequencing;

[0062] Figure 4 . Formation of target polynucleotide clusters by a fixed one-strand amplification scheme for the A base fluorescence map of the first cycle during sequencing;

[0063] Figure 5 The target polynucleotide cluster amplified by fixed one-strand amplification was used for sequencing analysis of the 15-cycle route verification of the four AGTC bases. DETAILED DESCRIPTION

[0064] The technical scheme of the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only exemplary descriptions and explanations of the present invention, and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are included in the scope that the present invention is intended to protect.

[0065] Unless otherwise specified, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods.

[0066] The random biochip uses the commercial biochip provided in the NextSeq 500 / 550v2.5 Kits of Illumina, and the target polynucleotide cluster signal is sequenced by one base on the NextSeq 500 / 550 instrument using the reagents provided in the kit, and only the signal of the A base is detected to form a pattern. The experimental methods in the following examples where the specific conditions are not specified are usually carried out under conventional conditions or under the conditions recommended by the manufacturer.

[0067] Example 1: Formation of target polynucleotide clusters by premixed library synthesis protocol

[0068] Preparation of target polynucleotide library: According to Vazyme's commercial kit VAHTS Universal DNA Library Prep Kit for Illumina V3, the genomic DNA was randomly sheared to prepare a library. At this time, the two ends of the library were connected to polynucleotide sequences that could complement the forward or reverse primers on the biochip; denaturation was performed with 0.2M fresh NaOH solution for 5 minutes, and the reaction was terminated with 375mM Tris-HCl. The target polynucleotide library was diluted with Low TE buffer and placed on ice for later use;

[0069] The target polynucleotide single-stranded library denatured by 0.2M NaOH alkali is mixed with reagent R2, so that the final concentration of the target polynucleotide single-stranded library in reagent R2 is controlled at 1.5pM or 20pM. The preferred reagent R2 includes: 50mM acetate buffer, 0.2U / μl Bsu DNA polymerase, 60ng / μl UvsX, 800ng / μl GP32, 30ng / μl UvsY, 6% PEG35000, ATP circulation system (10mM ATP; 0.15U / μl creatine kinase; 50mM phosphocreatine), 14mM magnesium acetate, 75mM potassium acetate, 2mM DTT, 5% trehalose, 1.8mM dNTPs.

[0070] The mixed target polynucleotide single-stranded library reagent R2 solution is passed into the biochip so that the chip is completely immersed in the reagent. Incubate at 37°C for 40 minutes. The amplification of the target polynucleotide cluster is completed. (Figure 1)

[0071] This example shows that after the target polynucleotide single-stranded library is mixed with the RPA isothermal amplification reagent, the target polynucleotide cluster can be amplified in one step. However, when the concentration of the target nucleic acid library is low (1.5pM), the cluster density is also low, which affects the data output in the next step of sequencing. When the concentration of the target polynucleotide library is increased (20pM), bubble clusters appear on the biochip, and the cluster distribution is not as uniform as that of the low-concentration target polynucleotide library.

[0072] Example 2 Formation of target polynucleotide clusters by fixed-strand amplification scheme

[0073] Preparation of target polynucleotide library: According to Vazyme's commercial kit VAHTS Universal DNA Library Prep Kit for Illumina V3, genomic DNA was randomly sheared to prepare a library. At this time, the two ends of the library were connected to polynucleotide sequences that could complement the forward or reverse primers on the biochip; denaturation was performed with 0.2M fresh NaOH solution for 5 minutes, and the reaction was terminated with 375mM Tris-HCl. The target polynucleotide library was diluted to 1.5pM with Low TE buffer and placed on ice for later use;

[0074] The target polynucleotide dilution solution was soaked in the biochip (commercial biochip provided in the NextSeq 500 / 550v2.5 Kits of Illumina Company), and annealed at 42°C for 3 minutes. The chip was washed with SSC solution. Reagent R1 was introduced, which included DNA polymerase Bsu 2U / μl and its polymerase-adapted buffer: Tris buffer (PH7.9, 300mM), Tween200.05%, 0.2mM dNTPs, 100mM ammonium sulfate, 50mM magnesium sulfate. The reagent R1 was soaked in the biochip, and the chip was kept at 37°C for 3 minutes.

[0075] Use SSC solution to clean the chip. Pass reagent R2, which includes: 100mM acetate buffer, 1U / μl BsuDNA polymerase, 150ng / μl UvsX, 800ng / μl GP32, 50ng / μl UvsY, 6% PEG 20000, ATP circulation system (7mM ATP; 0.02U / μl creatine kinase; 40mM creatine phosphate), 10mM magnesium acetate, 75mM potassium acetate, 2mM DTT, 5% trehalose, 10mM dNTPs. Incubate at 37℃ for 40min. The amplification of the target polynucleotide cluster is completed. ( Figure 2 )

[0076] This example shows that fixed single-strand synthesis followed by constant temperature amplification can be used to amplify the target polynucleotide clusters on the solid surface, and the 1.5 pM library has a higher cluster density than the 20 pM target polynucleotide library amplified in Example 1, and can better solve the cluster agglomeration phenomenon.

[0077] Example 3 Formation of target polynucleotide clusters by fixed-strand amplification scheme

[0078] Preparation of target polynucleotide library: According to Vazyme's commercial kit VAHTS Universal DNA Library Prep Kit for Illumina V3, genomic DNA was randomly sheared to prepare a library. At this time, the two ends of the library were connected to polynucleotide sequences that could complement the forward or reverse primers on the biochip; denaturation was performed with 0.2M fresh NaOH solution for 5 minutes, and the reaction was terminated with 375mM Tris-HCl. The target polynucleotide library was diluted to 1.5pM with Low TE buffer and placed on ice for later use;

[0079] The target polynucleotide dilution solution is soaked in the biochip (commercial biochip provided in the NextSeq 500 / 550v2.5 Kits of Illumina), and annealed at 42°C for 3 minutes. The chip is washed with SSC solution. Reagent R1 is introduced, which includes DNA polymerase Bst 4.5U / μL and its polymerase-adapted buffer. The buffer required for Bst DNA polymerase includes: Tris buffer (PH7.9, 50mM), Tween20 0.2%, 0.2mM dNTPs, 20mM ammonium sulfate, 80mM magnesium sulfate. The reagent R1 is soaked in the biochip, and the chip is kept at 37°C for 3 minutes.

[0080] Use SSC solution to clean the chip. Pass reagent R2, which includes: 30mM acetate buffer, 0.2U / μl BsuDNA polymerase, 400ng / μl RecA, 500ng / μl ET SSB, 150ng / μl UvsY, 8% PEG 2000, ATP circulation system (3mM ATP; 5U / μl creatine kinase; 10mM creatine phosphate), 5mM magnesium acetate, 30mM potassium acetate, 4mM DTT, 2% trehalose, 0.2mM dNTPs. Incubate at 37℃ for 40min. The amplification of the target polynucleotide cluster is completed. ( Figure 3 )

[0081] This example shows that by using fixed one-strand synthesis, adjusting the concentration of reagent components within a certain range and / or replacing components / systems with similar performance, it is still possible to obtain significantly better results than in Example 1. That is, this example uses a 1.5 pM target polynucleotide library, which has a higher density of identifiable clusters than the 20 pM library amplified in Example 1, and can also better solve the cluster agglomeration phenomenon.

[0082] Example 4 Formation of target polynucleotide clusters by fixed-strand amplification scheme

[0083] Preparation of target polynucleotide library: According to Vazyme's commercial kit VAHTS Universal DNA Library Prep Kit for Illumina V3, genomic DNA was randomly sheared to prepare a library. At this time, the two ends of the library were connected to polynucleotide sequences that could complement the forward or reverse primers on the biochip; denaturation was performed with 0.2M fresh NaOH solution for 5 minutes, and the reaction was terminated with 375mM Tris-HCl. The target polynucleotide library was diluted to 1.5pM with Low TE buffer and placed on ice for later use;

[0084] The target polynucleotide library dilution solution is soaked in the biochip (commercial biochip provided in NextSeq 500 / 550v2.5Kits of Illumina), and annealed at 42°C for 3 minutes. The chip is washed with SSC solution. Reagent R1 is introduced, which includes DNA polymerase Bsu 0.1U / μL and its polymerase-adapted buffer. The buffer required for Bsu DNA polymerase includes: Tris buffer (PH7.9, 30mM), Tween40 0.8%, 18mM dNTPs, 150mM ammonium sulfate, 10mM magnesium sulfate. The reagent R1 is soaked in the biochip, and the chip is kept at 37°C for 3 minutes.

[0085] Use SSC solution to clean the chip. Pass reagent R2, which includes: 150mM acetate buffer, 3U / μl Phi29 DNA polymerase, 60ng / μl RecO, 1200ng / μl GP32, 30ng / μl UvsY, 3% PEG 35000, ATP circulation system (10mM ATP; 0.15U / μl creatine kinase; 50mM creatine phosphate), 14mM magnesium acetate, 50mM potassium acetate, 3mM DTT, 8% trehalose, 1.8mM dNTPs. Incubate at 37℃ for 40min. The amplification of the target polynucleotide cluster is completed. ( Figure 4 )

[0086] This example shows that by using fixed one-strand synthesis, adjusting the concentration of reagent components within a certain range and / or replacing components / systems with similar performance, it is still possible to obtain an effect significantly better than that of Example 1. That is, this example uses a 1.5 pM target polynucleotide library, which has a higher cluster density than the 20 pM target polynucleotide library amplified in Example 1, and can also better solve the cluster agglomeration phenomenon.

[0087] Example 5. Target polynucleotide clusters obtained in Examples 1-4 are used for sequencing

[0088] The DNA amplified in Examples 1-4 was sequenced on a NextSeq 500 / 550 instrument. When the target polynucleotide cluster obtained on a non-array solid support using the methods and reagents of Examples 2-4 was used for 15 cycles of DNA base sequencing, a relatively clear optical signal of the four bases AGCT was obtained, verifying the application for DNA sequencing. However, the target polynucleotide cluster obtained on a non-array solid support using the methods and reagents of Example 1 could not obtain relatively normal sequencing data. Taking Example 2 as an example, DNA base sequencing was performed on the obtained target polynucleotide cluster, and stable base signals ( Figure 5 )

[0089] The above is an explanation of the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A reagent for isothermal amplification of a target polynucleotide cluster on a non-array solid support, characterized in that: The reagents include reagent R1 and reagent R2, wherein reagent R1 includes: DNA polymerase, surfactant, dNTPs and magnesium ions; the reagent R2 includes: DNA polymerase, recombinase, single-strand binding protein, auxiliary protein, PEG, dNTPs, ATP, creatine phosphate, creatine kinase, magnesium acetate and potassium acetate.

2. The reagent according to claim 1, characterized in that The DNA polymerase is selected from: bacteriophage polymerase, Bst polymerase, Sau polymerase, Phi29 polymerase, Gst polymerase, Vent polymerase, PyroPhage polymerase, Bsu polymerase, Deep-Vent polymerase, Klenow polymerase or DispIaceAce polymerase, preferably Bst polymerase or Bsu polymerase; the concentration of the DNA polymerase is 0.01-5U / μL.

3. The reagent according to claim 1, characterized in that The surfactant is selected from: anionic surfactant, cationic surfactant, nonionic surfactant or zwitterionic surfactant; preferably nonionic surfactant, more preferably Tween 10, 20, 60 or TX-100, and the concentration of the surfactant is 0.01%-1%.

4. The reagent according to claim 1, characterized in that In R1: The concentration of dNTPs is 0.02-2 mM; the magnesium ion in the reagent R1 is selected from: magnesium sulfate, magnesium acetate or magnesium chloride; preferably, the magnesium ion in R1 is selected from magnesium sulfate; the concentration of the magnesium ion is 4-100 mM; Preferably, the reagent R1 further comprises a buffer, including but not limited to Tris, Glycine-HCl buffer, acetate buffer or citrate buffer; preferably Tris; preferably, the concentration of the buffer is 20-500 mM; Preferably, the reagent R1 further comprises an ammonium salt, including but not limited to ammonium sulfate, ammonium acetate or ammonium chloride, and the concentration of the ammonium salt is 20-200 mM.

5. The reagent according to claim 1, characterized in that In the reagent R2: The recombinase is selected from UvsX, RecA, RecT or RecO, more preferably UvsX; the concentration of the recombinase is 10-600 ng / μL; The single-stranded binding protein SSB is selected from T4 GP32 or ET SSB, preferably GP32; the concentration of the single-stranded binding protein is 300-1500 ng / μL; The auxiliary protein is selected from T4 UvsY, and the concentration of the auxiliary protein is 10-200 ng / μl; The PEG is selected from PEG1000-35000, such as PEG1000, PEG2000, PEG3000, PEG4000, PEG6000, PEG8000, PEG10000, PEG20000, PEG35000, PEG40000; the concentration of the PEG is 1%-10% (w / v); The concentration of ATP is 1-10 mM, the concentration of creatine phosphate is 2-60 mM, the concentration of creatine kinase is 0.01-10 U / μl; the concentration of magnesium acetate is 5.0-15 mM; the concentration of potassium acetate is 25-100 mM; Preferably, the reagent R2 further comprises a buffer, including but not limited to acetate buffer, Tris, Glycine-HCl buffer or citric acid buffer, preferably acetate buffer, and the concentration of the buffer is 20-200 mM; Preferably, the reagent R2 further comprises trehalose and / or a reducing agent; the reducing agent is selected from DTT, DTE, TCEP-HCl; preferably DTT; the concentration of the reducing agent is 1.0-5.0 mM, the concentration of the trehalose is 1-10% (w / v); the concentration of the dNTPs in R2 is 0.1-20 mM; Preferably, the reagent R2 may also include BSA; or a surfactant, such as Tween 20, Tween 40, Tween 65, Tween 80 or Tween 85; or a defoaming agent, such as a non-ionic defoaming agent; or a single-sided linker primer, such as P5 (AATGATACGGCGACCACCGAGATCTACAC) or P7 (CAAGCAGAAGACGGCA TACGAGAT).

6. A method for obtaining a target polynucleotide cluster by isothermal amplification on a non-array solid support, characterized in that: The method comprises the following steps: 1) Template hybridization: hybridization of a single strand of a template target polynucleotide with a paired adapter primer on a non-arrayed solid support; 2) First chain synthesis: introducing the reagent R1 in any one of claims 1 to 5 to synthesize the first chain; 3) Synthesis of target polynucleotide clusters: removing the single-stranded template target polynucleotide, and introducing the reagent R2 in any one of claims 1 to 5 to synthesize a monoclonal target polynucleotide cluster.

7. The method according to claim 6, characterized in that Prior to step 1), the step 0) may also be included: randomly interrupting genomic DNA, connecting forward or reverse primers at both ends to obtain a target polynucleotide library, wherein the library is in a double-stranded state, and the primers at both ends need to be paired with primers fixed on a non-array solid support, and the obtained target polynucleotide library is then treated with a denaturing agent to become a single-stranded molecule of the target polynucleotide; Preferably, the target polynucleotide library is directly purchased from a commercial finished product library or a standard library, and the primers at both ends of the library are paired with primers fixed on a non-array solid support; Further preferably, the primers at both ends and the primers fixed to the non-array solid support are selected from P5 and P7, the nucleotide sequence of P5 is AATGATACGGCGACCACCGAGATCTACAC, and the nucleotide sequence of P7 is CAAGCAGAAGACGGCATACGAGAT.

8. The method according to claim 6, characterized in that The method step 1) may further include washing with a buffer that promotes hybridization reaction, wherein the hybridization buffer is SSC or Tris HCl.

9. The method according to claim 6, characterized in that The method may further include washing with a reagent that promotes nucleic acid denaturation between step 2) and step 3), wherein the reagent that promotes nucleic acid denaturation is selected from sodium hydroxide or formamide.

10. Use of the reagent according to any one of claims 1 to 5 or the method according to any one of claims 6 to 9, wherein the use is used to provide nucleic acid molecules for nucleic acid sequencing and resequencing in the following fields: genomics, pharmacogenomics, drug development, food property analysis, genotyping, diagnosis, monitoring of gene expression, genetic diversity distribution map, whole genome sequencing and discovery of polymorphisms or any other application involving nucleic acid amplification.

Images