Kit for HPV (human papillomavirus) nucleic acid detection based on universal fluorescent nanoparticle counting method combined with CRISPR / Cas12a recognition

Abstract

The invention discloses a kit for HPV (human papillomavirus) nucleic acid detection based on a universal fluorescent nanoparticle counting method in combination with CRISPR / Cas12a recognition, and belongs to the field of nucleic acid detection.The kit comprises crRNA, Cas12a, a buffer solution 3.1, an RNA enzyme inhibitor, Target, HPV-MB and HPV-FNP. According to the kit, the Cas12a nucleic acid molecule recognition characteristic, the fluorescent nanoparticle characteristic and the base complementary pairing hybridization and magnetic separation principle are utilized, so that the nucleic acid molecule recognition characteristic of the crRNA, the fluorescent nanoparticle characteristic and the base complementary pairing hybridization and magnetic separation principle are utilized; fluorescent nanoparticle counting and CRISPR detection are combined for the first time, universal virus nucleic acid detection is achieved, operation is easy and convenient, observation is easy, and a CRISPR / Cas probe design method is widened. By taking HPV16 and 18 virus nucleic acids as examples, nucleic acid detection schematic results show that 1 pM can be detected at least. And the HPV16 virus and the HPV18 pseudovirus are selected as examples to carry out actual sample detection and verification.

Description

Technical Field

[0001] The present invention relates to a kit, in particular to a kit for detecting HPV virus nucleic acid based on a universal fluorescent nanoparticle counting method combined with CRISPR / Cas12a identification, belonging to the field of nucleic acid detection. Background Art

[0002] Nucleic acids include DNA and RNA, which are carriers of genetic information and can be used as markers for the diagnosis of a variety of diseases, such as cancer and pathogenic infectious diseases. Nucleic acid molecular diagnosis has the advantages of high sensitivity, good real-time performance, and simple operation. It is of great significance for the early screening and diagnosis of cancer and pathogenic infectious diseases. Currently, the commonly used nucleic acid detection methods mainly include gene sequencing and nucleic acid amplification detection.

[0003] Cervical cancer is one of the common gynecological malignancies. Studies have shown that almost 90% of cervical cancers are caused by human papillomavirus (HPV) infection. The most common high-risk HPV types in cervical cancer are HPV16 (55.2%), 18 (14.2%), 45 (5.0%), 33 (4.2%) and 58 (3.9%), of which HPV16 / 18 account for about 70%. In my country, the most common high-risk HPV types for cervical cancer are HPV16 (59.5%), 18 (9.6%), 58 (8.2%), 52 (6.5%) and 33 (3.5%). In recent years, my country is in a critical period of accelerating the elimination of cervical cancer. Using high-quality screening methods to increase screening coverage is one of the main means to eliminate cervical cancer. On April 25, 2023, the Tumor Prevention and Control Professional Committee of the Chinese Preventive Medicine Association issued the "Chinese Expert Consensus on Human Papillomavirus Nucleic Acid Testing for Cervical Cancer Screening (2022)", recommending HPV nucleic acid testing as the main method for cervical cancer screening in my country.

[0004] Most existing nucleic acid detection methods have complex operating steps and rely on expensive instruments and equipment. The CRISPR / Cas system, known as the "gene magic scissors", has shown great potential and advantages in nucleic acid detection. Clustered regularly interspaced short palindromic repeats (CRISPR) is an acquired immune system in bacteria, which together with Cas proteins form the CRISPR / Cas system. After Cas12a specifically recognizes the target molecule, it activates the "trans-cutting" activity and continues to non-specifically cut other single-stranded DNA (ssDNA) or RNA.

[0005] Counting is an analytical method that can detect a single signal source and can achieve detection at the single molecule level. In counting analysis, counting measurements based on optical microscopy visualize the imaging of a single signal source generated after a molecular recognition reaction, thereby associating the number of target molecules with the signal source. However, this optical signal-based counting measurement requires a single signal source to have high brightness. Usually, the brightness of organic small molecules is not enough to make the signal of a single luminescent molecule stand out from the Raman scattering of the solvent. Confocal fluorescence microscopy can achieve single-molecule detection, and thousands of organic fluorescent small molecules can be labeled or encapsulated on the surface or inside of fluorescent nanoparticles. It has very high imaging brightness and rich coding elements, and has the advantages of spectrally adjustable spectra, stable optical properties, good biocompatibility, easy surface modification, and low cost. Fluorescent nanoparticles can be observed through a fluorescence microscope to achieve counting detection, which is very suitable for conventional fluorescence microscopy imaging counting analysis of target nucleic acids. Summary of the invention

[0006] In view of this, the present invention provides a kit for HPV virus nucleic acid detection based on a universal fluorescent nanoparticle counting method combined with CRISPR / Cas12a identification. Taking HPV16 / 18 as an example, the trans-cleavage activity of CRISPR / Cas12a and the characteristics of fluorescent nanoparticles are utilized to construct a universal fluorescent nanoparticle counting method combined with CRISPR / Cas12a for HPV virus nucleic acid, which simplifies the operation and reduces the cost. At the same time, it is applied to HPV pseudovirus nucleic acid detection and has good analytical performance.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] A kit for HPV virus nucleic acid detection based on the universal fluorescent nanoparticle counting method combined with CRISPR / Cas12a identification, including 0.5μL 20μM crRNA 500nM, 0.5μL 10μM Cas12a protein 250nM, 2μL 1μM Linker chain (10nM), 14.5μL buffer 3.1, 0.5μL RNase inhibitor, 2μL 10nM Target-HPV16100 pM or 2μL 10nM Target-HPV18100 pM, 40μL HPV-MB modified magnetic nanoparticles, and 10μL HPV-FNP modified fluorescent nanoparticles.

[0009] On the basis of the above technical solution, the present invention can also be improved as follows:

[0010] Further, the crRNA is crRNA-HPV16 or crRNA-HPV18;

[0011] The sequence of the crRNA-HPV16 is: UAAUUUCUACUAAGUGUAGAU GAAUACAUUUACCUGACCCC;

[0012] The sequence of the crRNA-HPV18 is: UAAUUUCUAAGUGUAGAU GAAGAUGGUGAUAUGGUAGA.

[0013] Furthermore, primers are included. When the target is HPV16, the primer sequence is:

[0014] HPV16-Forward Primer: AAG TAT CAG GAT TAC AAT CAC GGG T; HPV16-ReversePrimer: ACC AAA CTT ATT GGG GTC AGG T;

[0015] When the target is HPV18, the primer sequence is:

[0016] HPV18-Forward Primer: TGG CGG CCT AGT GAC AAT AC; HPV18-Reverse Primer: AGC ACA GGC CCA CAC TAA AC.

[0017] Further, the Cas12a protein is a Cpf1 endonuclease.

[0018] Furthermore, the linker chain sequence is: TAC CAT TTT TTT AAC TTA TTT GGT A.

[0019] Furthermore, the RNase inhibitor is a recombinant obtained from pig liver RNase inhibitor purified from Escherichia coli.

[0020] Further, the Target-HPV16 sequence is: GTT CCT AAA GTA TCA GGA TTA CAA TAC AGGGTA TTT AGA ATA CAT TTA CCT GAC CCC AATAAG TTT GGT TTT CCT GACACC TCA TTT TATAAT CCA GAT A;

[0021] The Target-HPV18 sequence is: CGT CCT TTA TCA CAGGGC GCC TGC CCC CCT TTA GAACTT AAA AAC ACA GTT TTG GAA GAT GGT GAT ATG GTA GAT ACT GGA TAT GGT GCC ATGGAC TTT A.

[0022] Furthermore, the HPV-MB sequence is: TAA AAA AAT GGT A; HPV-FNP sequence is: TACCAAATAAGT.

[0023] Furthermore, the method for modifying the DNA chain on the surface of the magnetic nanoparticles is:

[0024] Take 200 μL of streptavidin-modified magnetic nanoparticles, wash them three times with 1 ml PBS and redisperse them in 1 mL PBS, add 25 μL of 100 mM biotin-modified DNA, shake and react at 25°C, 1500 rpm for 15 min; add 1 mL of 0.1% Triton-X100 PBS for magnetic separation, repeat washing 5 times to remove unreacted oligonucleotide sequences, redisperse them in 1 mL of 0.1% Triton-X100 PBS, and store them at 4°C for later use.

[0025] The method for modifying the surface of the fluorescent nanoparticles with DNA is a condensation reaction of amino groups and carboxyl groups catalyzed by EDC:

[0026] Dissolve the amino-modified DNA powder to 100 μM with purified water. Take 10 μL of 10 mg / mL fluorescent nanoparticle stock solution, wash with 100 μL of 50 mM MES buffer (pH 5.0), centrifuge, repeat 3 times, redisperse in 85 μL of MES buffer, add 10 μL of 50 mg / mL newly prepared EDC solution, 5 μL of 100 μM amino-modified DNA, and oscillate at 25°C; after 30 minutes, add 10 μL of 50 mg / mL newly prepared EDC solution to the system, react overnight; wash with 100 μL of 10 mM PBS, centrifuge, repeat 5 times, remove unreacted amino-modified DNA, redisperse in 1 mL of PBS, and store at 4°C for later use.

[0027] The principle of the present invention is that after Cas12a combines with crRNA-HPV16 or crRNA-HPV18, it specifically recognizes the target HPV16 or HPV18, activates the trans-cutting activity of the ternary complex, and cuts the Linker single chain around it.

[0028] Linker single chain is the key to constructing universal signal readout. When its concentration is high, the Linker single chain hybridizes with HPV-MB-modified magnetic nanoparticles and HPV-FNP-modified fluorescent nanoparticles through base complementary pairing to form a sandwich structure.

[0029] After magnetic separation, the fluorescent nanoparticles that have not formed a sandwich structure are removed, and then the sandwich structure is dissociated with sodium hydroxide. The fluorescence spectrum is detected with a fluorescence spectrometer, and the fluorescent nanoparticles are observed and counted with a fluorescence microscope. The concentration of the target nucleic acid is determined by the relationship between the fluorescence intensity of the fluorescent nanoparticle solution and the number of fluorescent nanoparticles and the concentration of the target nucleic acid.

[0030] Specifically, the method for Cas12a HPV virus nucleic acid recognition comprises the following steps:

[0031] HPV target core, corresponding crRNA, Cas12a protein, buffer 3.1, and RNase inhibitor were added to a centrifuge tube, and 2 μL of 1 μM Linker chain (10 nM) was added, and the resulting mixture was reacted at 47° C. for 1 h to obtain reaction mixture 1;

[0032] Then, 40 μL of 0.1% Triton-X100 PBS, 40 μL of HPV-MB-modified magnetic nanoparticles, and 10 μL of reaction mixture 1 were added to a 1.5 mL centrifuge tube, placed in a metal bath, heated and shaken at 1500 rpm, 75°C for 5 min, and then shaken at 37°C for 60 min;

[0033] Then, the HPV-FNP-modified fluorescent nanoparticles were sonicated for 2 min, and 10 μL was added to the detection system. After being thoroughly vortexed and mixed, the mixture was shaken at 37°C for 10 min, and then at 25°C for 60 min.

[0034] After taking out, perform magnetic separation, discard the supernatant, add 100 μL 0.1% Triton-X100 PBS to wash 5 times, ultrasonicate for 2 min, add 100 μL 0.15M NaOH solution, shake at 25°C, 1500 rpm, react for 15 min, perform magnetic separation, and take the supernatant;

[0035] First, fluorescence spectrum detection was performed to observe the change in fluorescence intensity, and then 5 μL of supernatant was taken on a cell counting plate and fluorescent microsphere counting was performed using a fluorescence microscope.

[0036] The beneficial effects of the present invention are:

[0037] 1. The present invention uses Cas12a target-specific recognition combined with fluorescent nanoparticle counting method to construct a universal nucleic acid detection signal readout method. This nucleic acid detection method is suitable for nucleic acid detection signal readout of a variety of different HPV virus typing or a variety of virus types, and the results are obtained more quickly and simply, which is suitable for developing nucleic acid detection products with good application value. The kit is used in HPV virus nucleic acid detection, with good analytical performance. Taking HPV virus nucleic acids HPV16 and HPV18 as examples, the minimum detectable amount is 1pM, which proves the universality of this method.

[0038] 2. The nanoscale fluorescent balls used in the present invention have rich color coding, high luminous intensity, strong stability, can be mass-produced, and are easy to functionalize, which not only ensures the efficiency of the probe in the recognition reaction, but also ensures the single-particle level imaging and counting detection under the microscope. Fluorescent nanoparticles serve as signal probes and reaction carriers at the same time, simplifying the experimental design and reducing the experimental cost. At the same time, the bright spot signal presented by the fluorescent nanoparticles during fluorescence microscope imaging is under a black background, and the background signal of the image is almost zero, which has low requirements on the quality of the glass slide.

[0039] 3. The kit of the present invention combined with a specific method has good accuracy for actual HPV virus detection.

[0040] 4. The kit only requires an ordinary wide-field fluorescence microscope to achieve highly sensitive multi-target detection. It has low requirements for the quality of fluorescent nanoparticles (such as size uniformity and preparation operation) and low requirements for the configuration of the microscopic imaging system.

[0041] 5. The automated batch processing program used in the present invention can process a large number of images in batches, thereby solving the problems of human bias errors, slow counting speed and easy errors in manual counting, and improving the accuracy of the data. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is a graph showing the experimental results of targets of different concentrations when the HPV16 Linker chain is 10 nM and the HPV-FNP addition amount is 10 μL in Example 1 of the present invention;

[0043] Figure 2 This is a graph showing the experimental results of targets of different concentrations when the HPV18 Linker chain is 10 nM and the HPV-FNP addition amount is 10 μL in Example 2 of the present invention;

[0044] Figure 3 This is a graph of the actual HPV16 sample detection results in Example 3 of the present invention;

[0045] Figure 4 This is a graph of the actual HPV18 sample detection results of Example 4 of the present invention. DETAILED DESCRIPTION

[0046] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0047] In the following examples, the nucleic acid sequences used are shown in Tables 1-3, synthesized by Shanghai Sangon Biotechnology Co., Ltd. and purified by HPLC;

[0048] Lba Cas12a and buffer 3.1 were purchased from NEB Beijing; RNase inhibitor was purchased from Takara, and DEPC-treated water was purchased from Shanghai Sangon Biotechnology Co., Ltd.

[0049] Table 1 Nucleic acid sequences used for HPV virus detection in the present invention.

[0050]

[0051] Table 2 Nucleic acid sequences used in actual sample detection in the present invention.

[0052]

[0053]

[0054] Table 3 Nucleic acid sequences used in the fluorescent nanoparticle counting method of the present invention

[0055]

[0056] The fluorescence spectrum signals were collected using Hitachi F-4500 and Olympus IX73.

[0057] Other instruments and reagents not specially described are commonly used in this field.

[0058] Example 1

[0059] Experiments with different target concentrations when the HPV16 Linker chain was 10 nM and the HPV-FNP addition amount was 10 μL

[0060] The Cas12a-based and fluorescent nanocounting method was used for detection of HPV16 at different concentrations, including 0.5 μL 20 μM crRNA (500 nM), 0.5 μL 10 μM Cas12a protein (250 nM), 2 μL 1 μM Linker chain (10 nM), 14.5 μL buffer 3.1, 0.5 μL RNase inhibitor, 2 μL different concentrations of Target-HPV16 (100 pM, 50 pM, 10 pM, 5 pM, 1 pM, 0), 40 μL HPV-MB-modified magnetic nanoparticles, and 10 μL HPV-FNP-modified fluorescent nanoparticles. The brackets are the concentrations in the detection system.

[0061] Among them, crRNA-HPV16 is: UAAUUUCUACUAAGUGUAGAU GAAUA CAUUUACCUGACCCC.

[0062] Cas12a protein is a Cpf1 endonuclease.

[0063] The linker chain sequence is: TAC CAT TTT TTT AAC TTA TTT GGT A.

[0064] The RNase inhibitor was a recombinant product obtained from pig liver RNase inhibitor purified from Escherichia coli.

[0065] The Target-HPV16 sequence is: GTT CCT AAA GTA TCA GGA TTA CAA TAC AGG GTA TTTAGA ATA CAT TTA CCT GAC CCC AATAAG TTT GGT TTT CCT GACACC TCA TTT TAT AAT CCAGAT A;

[0066] HPV-MB sequence: TAA AAA AAT GGT A-biotin;

[0067] HPV-FNP chain sequence: NH2-TACCAAATAAGT.

[0068] The results are as follows Figure 1 , Figure 1 a is the fluorescence spectrum curve of HPV16 at different concentrations. Figure 1 b is the fluorescence peak histogram of HPV16 at different concentrations. Figure 1 c is a bar graph of the number of HPV16 fluorescent nanoparticles at different concentrations.

[0069] 1d is the microscopic imaging of fluorescent nanoparticles with different concentrations.

[0070] Depend on Figure 1 It can be seen that with the increase of HPV16 concentration, the fluorescence intensity and the number of fluorescent nanoparticles gradually decreased, and there was a good correlation when the Target concentration was in the range of 0pM to 100pM.

[0071] Example 2

[0072] Experiments with different target concentrations when the HPV18 Linker chain was 10 nM and the HPV-FNP addition amount was 10 μL

[0073] The Target in Example 1 was replaced with HPV-18 Target of different concentrations (100 pM, 50 pM, 10 pM, 5 pM, 1 pM, 0), and the detection was performed according to the method in Example 1.

[0074] First, perform fluorescence spectrum detection and comparison, and then use fluorescence microscope to perform fluorescent microsphere counting detection. The results are as follows Figure 2 , Figure 2 a is the fluorescence spectrum curve of HPV18 at different concentrations. Figure 2 b is the peak fluorescence bar graph of HPV18 at different concentrations. Figure 2 c is a bar graph of the number of HPV18 fluorescent nanoparticles at different concentrations, and 2d is a microscopic imaging of fluorescent nanoparticles at different concentrations.

[0075] Depend on Figure 2 It can be seen that with the increase of HPV18 concentration, the fluorescence intensity and the number of fluorescent nanoparticles gradually decreased, and there was a good correlation when the Target concentration was in the range of 0pM to 100pM.

[0076] Example 3

[0077] HPV16 detection in real samples

[0078] In order to verify the ability of this method to detect actual samples, HPV16 pseudovirus was selected, and the target nucleic acid sequence fragment was extracted from virus culture, nucleic acid extraction, and PCR amplification, and the method in Example 1 was used for detection. The results are as follows Figure 3 , and it also has good analytical performance in actual sample detection.

[0079] Example 4

[0080] HPV18 actual sample testing

[0081] In order to verify the ability of the present method to detect actual samples, HPV18 pseudovirus was selected, and the target nucleic acid sequence fragment was extracted from virus culture, nucleic acid extraction, and PCR amplification. The detection was performed using the method in Example 2, and the crRNA-HPV18 in Example 2 was replaced with crRNA-HPV18-L1. The sequence of crRNA-HPV18-L1 was: UAA UUU CUA CUA AGU GUA GAUGGG UGC AGU UAC CUG ACC CA. The results are as follows: Figure 4 , and it also has good analytical performance in actual sample detection.

[0082] It can be seen from the above embodiments that the present invention uses Cas12a target-specific recognition combined with fluorescent nanoparticle counting method to construct a universal nucleic acid detection signal readout method, which is suitable for nucleic acid detection signal reading of a variety of different HPV virus typing or a variety of virus types, and can obtain results more quickly and simply, and is suitable for the development of nucleic acid detection products with good application value.

[0083] The method of the present invention is used for HPV virus nucleic acid detection and has good analytical performance. Taking HPV virus nucleic acids HPV16 and HPV18 as examples, the lowest level that can be detected is 1pM, which proves the universality of the method.

Claims

1. A kit for HPV virus nucleic acid detection based on a universal fluorescent nanoparticle counting method combined with CRISPR / Cas12a identification, characterized in that: The detection system concentration includes 0.5 μL 20 μM crRNA 500 nM, 0.5 μL 10 μM Cas12a protein 250 nM, 2 μL 1 μM Linker chain (10 nM), 14.5 μL buffer 3.1, 0.5 μL RNase inhibitor, 2 μL 10 nM Target-HPV16 100 pM or 2 μL 10 nM Target-HPV18 100 pM, 40 μL HPV-MB modified magnetic nanoparticles, and 10 μL HPV-FNP modified fluorescent nanoparticles.

2. The kit according to claim 1, characterized in that The crRNA is crRNA-HPV16 or crRNA-HPV18; The sequence of the crRNA-HPV16 is: UAAUUUCUACUAAGUGUAGAU GAAUACAUUUACCUGACCCC; The sequence of the crRNA-HPV18 is: UAAUUUCUAAGUGUAGAU GAAGAUGGUGAUAUGGUAGA.

3. The kit according to claim 2, characterized in that Primers are also included. When the target is HPV16, the primer sequence is: HPV16-ForwardPrimer: AAGTATCAGGATTACAATCACGGGT; HPV16-ReversePrimer: ACAAAACTTATTGGGGTCAGGT; When the target is HPV18, the primer sequence is: HPV18-ForwardPrimer: TGGCGGCCTAGTGACAATAC; HPV18-ReversePrimer: AGCACAGGCCCACACTAAAC.

4. The kit according to claim 1, characterized in that The Cas12a protein is a Cpf1 endonuclease.

5. The kit according to claim 1, characterized in that The linker chain sequence is: TACCATTTTTTAACTTATTTGGTA.

6. The kit according to claim 1, characterized in that The RNase inhibitor is a recombinant obtained from pig liver RNase inhibitor purified from Escherichia coli.

7. The kit according to claim 1, characterized in that The Target-HPV16 sequence is: GTTCCTAAGTATCAGGATTACAATACAGGGTATTTAGA ATACATTTACCTGACCCCAATAAGTTTGGTTTTCCTGACACCTCATTTTATAATCCAGATA; The Target-HPV18 sequence is: CGTCCTTTATCACAGGGCGCCTGC CCCCCTTTAGAACTTAAAAACACAGTTTTGGAAGATGGTGAT ATGGTAGATACTGGATATGGTGCCATGGACTTTA.

8. The kit according to claim 1, characterized in that The HPV-MB sequence is: TAAAAAAATGGTA; the HPV-FNP sequence is: TACCAAATAAGT.

9. The kit according to claim 1, characterized in that The method for modifying the DNA chain on the surface of magnetic nanoparticles is: Take 200 μL of streptavidin-modified magnetic nanoparticles, wash them three times with 1 ml PBS and redisperse them in 1 mL PBS, add 25 μL of 100 mM biotin-modified DNA, shake and react at 25°C, 1500 rpm for 15 min; add 1 mL of 0.1% Triton-X100 PBS for magnetic separation, repeat washing 5 times to remove unreacted oligonucleotide sequences, redisperse them in 1 mL of 0.1% Triton-X100 PBS, and store them at 4°C for later use.

10. The kit according to claim 1, characterized in that The method for modifying the surface of the fluorescent nanoparticles with DNA is a condensation reaction of amino groups and carboxyl groups catalyzed by EDC: Dissolve the amino-modified DNA powder to 100 μM with purified water. Take 10 μL of 10 mg / mL fluorescent nanoparticle stock solution, wash and centrifuge with 100 μL of 50 mM MES buffer (pH 5.0), repeat 3 times, redisperse in 85 μL of MES buffer, add 10 μL of 50 mg / mL newly prepared EDC solution, 5 μL of 100 μM amino-modified DNA, and oscillate at 25°C; after 30 minutes, add 10 μL of 50 mg / mL newly prepared EDC solution to the system and react overnight; wash and centrifuge with 100 μL of 10 mM PBS, repeat 5 times, remove unreacted amino-modified DNA, redisperse in 1 mL of PBS, and store at 4°C for later use.

Images