Multiplex fluorescent PCR primer probe combination and kit thereof

Abstract

The invention relates to the technical field of pathogen detection, in particular to a primer and a probe for detecting treponema pallidum, a herpes simplex virus 1 and a herpes simplex virus 2 through single-tube multiplex fluorescent PCR, and further relates to a fluorescent PCR kit comprising the primer and the probe and application of the fluorescent PCR kit. The primer comprises specific sequences which respectively aim at the treponema pallidum, the herpes simplex virus 1 and the herpes simplex virus 2 and are not subjected to cross reaction, and the specific sequences of the primer and the probe are as shown in SEQ ID NO: 1-SEQ ID NO: 9. The kit can be used for simultaneously detecting various sexually transmitted pathogens such as treponema pallidum, herpes simplex virus 1 and herpes simplex virus 2, and the technical effects of high sensitivity and accuracy, strong specificity and simplicity and convenience in operation are well realized.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological detection, and in particular relates to a single-tube multiplex rapid detection kit for herpes simplex virus 1, herpes simplex virus 2 and syphilis spirochetes in a sample based on PCR and a use thereof. Background Art

[0002] Every year, more than 340 million new cases of sexually transmitted infections (STIs) are reported worldwide. Treponema pallidum (TP), herpes simplex virus 1 (HSV-1), and herpes simplex virus 2 (HSV-2) are the main pathogens that cause ulcers in the genital, perianal, and oropharyngeal regions. These genital ulcers not only have a direct impact on the patient's health, but also significantly increase the risk of human immunodeficiency virus (HIV) transmission. Therefore, accurate identification of the pathogens of these ulcers is crucial to reduce the risk of HIV infection. The diagnosis of syphilis mainly relies on clinical manifestations and serological testing methods, but their effectiveness is limited by factors such as the antibody response window period and reinfection. Although traditional cell culture and serological testing are used for the diagnosis of herpes simplex virus, the development of polymerase chain reaction (PCR) technology in recent years has significantly improved the speed and sensitivity of pathogen diagnosis, making it possible to detect multiple pathogens simultaneously in a single sample.

[0003] Although PCR technology has been widely used for the diagnosis of HSV-2, the application of nucleic acid detection methods for syphilis in clinical practice is still relatively limited. Current single pathogen nucleic acid detection usually requires a separate swab, and swab collection for syphilis needs to be performed under high clinical suspicion, which leads to delays in diagnosis and treatment. It is necessary to develop a multiplex fluorescent PCR detection kit that aims to simultaneously diagnose TP, HSV-1, and HSV-2 in different types of skin lesions to solve many bottlenecks in the current diagnostic process and improve the accuracy and efficiency of clinical diagnosis.

[0004] Although multiplex PCR technology can add multiple target DNA / RNA sequences to a single PCR reaction system, and simultaneously amplify multiple target genes in one experiment, and detect multiple pathogens at the same time, greatly shortening the detection time and reducing sample requirements, it has relatively high requirements for primer design. While ensuring amplification specificity, it is necessary to avoid interactions between multiple specific primers and the formation of primer dimers, which will affect the amplification and specific detection results of pathogenic microorganisms. Summary of the invention

[0005] In view of this, one of the purposes of the present invention is to provide a primer-probe combination for multiple fluorescent PCR, and the second purpose of the present invention is to provide the use of the primer-probe combination for multiple fluorescent PCR in the preparation of a reagent or kit for simultaneously detecting Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2. The third purpose of the present invention is to provide a reagent or kit comprising the primer-probe combination.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] 1. A primer-probe combination for multiplex fluorescent PCR, comprising: primers or a combination thereof; and / or probes or a combination thereof; (1) the primers or the combination thereof have any one of the following nucleotide sequences:

[0008] Ⅰ. A nucleotide sequence having any of SEQ ID No: 1 to SEQ ID No: 6;

[0009] or II. a nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases of the nucleotide sequence shown in any of SEQ ID No: 1 to SEQ ID No: 6 and having the same function as the nucleotide sequence shown in any of SEQ ID No: 1 to SEQ ID No: 6;

[0010] or III, a nucleotide sequence having at least 90% homology to the nucleotide sequence shown in any of SEQ ID No: 1 to SEQ ID No: 6 and having the same function as the nucleotide sequence shown in any of SEQ ID No: 1 to SEQ ID No: 6;

[0011] or IV, a complementary sequence of the sequence shown in Ⅰ, Ⅱ or III;

[0012] (2) The probe or its combination has any one of the following nucleotide sequences:

[0013] V, having a nucleotide sequence shown in any of SEQ ID No: 7 to SEQ ID No: 9;

[0014] or VI, a nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases of the nucleotide sequence shown in any of SEQ ID No: 7 to SEQ ID No: 9 and having the same function as the nucleotide sequence shown in any of SEQ ID No: 7 to SEQ ID No: 9;

[0015] or VII, a nucleotide sequence having at least 90% homology to the nucleotide sequence shown in any of SEQ ID No: 7 to SEQ ID No: 9 and having the same function as the nucleotide sequence shown in any of SEQ ID No: 7 to SEQ ID No: 9;

[0016] or VIII, a complementary sequence of the sequence shown in V, VI or VII.

[0017] Furthermore, in the probe or the combination thereof, the 5' end of the probe sequence is connected to a fluorescent reporter group, and the 3' end is connected to a fluorescent quencher group.

[0018] Furthermore, the fluorescent reporter group is selected from FAM, VIC, Cy5, HEX, JOE, ROX, Texas Red, TAMRA, and Cy3.

[0019] Furthermore, the fluorescence quenching group is selected from BHQ-1, BHQ-2, BHQ-3, and MGB.

[0020] Furthermore, the primer-probe combination of the multiplex fluorescent PCR also includes specific primers and probes for human internal standard genes.

[0021] Furthermore, the human internal standard gene is selected from the group consisting of G3PDH gene, Actin gene, GAPDH gene, β2 microglobulin gene, and Globin gene.

[0022] Furthermore, the human internal standard gene is the G3PDH gene.

[0023] Furthermore, the forward primer sequence of the G3PDH gene is shown in SEQ ID NO:10, and the reverse primer sequence is shown in SEQ ID NO:11; the sequence of the G3PDH gene detection probe is shown in SEQ ID NO:12.

[0024] Technical solution 2 specifically involves the use of any of the above-mentioned multiplex fluorescent PCR primer-probe combinations in the preparation of reagents or kits for detecting Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2.

[0025] Technical solution three is specifically a reagent or kit for detecting Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2, including a primer-probe combination as described in any of the above items and an acceptable auxiliary agent.

[0026] In the further reagent or kit, the concentration of each primer or probe is 0.1 to 1.0 μM.

[0027] Further reagents or kits also include a PCR reaction solution, which includes: 5-15U DNA polymerase, 0.1-5U UDG enzyme, 0.1-0.3mM dATP, 0.1-0.3mM dGTP, 0.1-0.3mM dCTP, 0.2-0.6mM dUTP, 0.05%-2% v / v Tween20, 1%-2% v / v glycerol, 10-100mM tris(hydroxymethyl)methylglycine, and 1-8mM magnesium chloride.

[0028] Furthermore, the invention also comprises a nucleic acid releaser, which comprises 10-100 mM sodium hydroxide, 0.01%-2% w / v sodium dodecyl sulfate, and 1%-8% v / v Tween20.

[0029] Furthermore, it also includes positive quality control products and / or negative quality control products; the positive quality control product is a mixture of cloned plasmids of Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2; the negative quality control product is a reagent that does not contain cloned plasmids of Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2.

[0030] The beneficial effects of the present invention are as follows: the present invention is experimentally verified by designing a plurality of specific primers, and finally provides a group of primers and probe sequences that can simultaneously detect multiple pathogens such as Treponema pallidum, herpes simplex virus 1, herpes simplex virus 2, etc. in one experiment, and realizes multiple PCR in one step. The primer set avoids the formation of interactions and primer dimers, improves sensitivity and specificity, and is expected to play an important role in clinical practice, especially in the preliminary screening of high-risk populations and the rapid diagnosis of patients with existing related symptoms, thereby effectively reducing complications and transmission risks. When the primer and probe sequence set detects Treponema pallidum and HSV, there is no cross reaction with common clinical pathogens Chlamydia trachomatis, gonococci, Ureaplasma urealyticum, human cytomegalovirus, human papillomavirus 16, and human papillomavirus 18, and no false positives will be caused.

[0031] In addition, the kit can also be used for epidemiological research, helping public health departments understand the spread of syphilis and herpes and develop more effective prevention and control strategies. The required sample size is small, thereby improving the accuracy and efficiency of clinical diagnosis, improving the overall health of patients, and having a profound impact on public health. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:

[0033] Figure 1 This is the amplification curve of the reference substance for the detection limit of Treponema pallidum by the kit of the present invention.

[0034] Figure 2 This is the amplification curve of the detection limit reference material for the HSV-1 type detected by the kit of the present invention.

[0035] Figure 3 This is the amplification curve of the detection limit reference material for the HSV-2 type detected by the kit of the present invention.

[0036] Figure 4 This is the Treponema pallidum amplification curve of the specificity experiment of the kit of the present invention.

[0037] Figure 5 This is the HSV-1 amplification curve of the specific experiment of the kit of the present invention.

[0038] Figure 6 This is the HSV-2 amplification curve of the specific experiment of the kit of the present invention. DETAILED DESCRIPTION

[0039] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively below in conjunction with the accompanying drawings in the embodiments of the present invention. Preferred embodiments of the present invention are provided in the accompanying drawings. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items. The experimental methods for which specific conditions are not indicated in the embodiments are usually based on conventional conditions or the conditions recommended by the manufacturer.

[0041] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0042] Example 1

[0043] The present invention provides a primer and probe for multiple detection of Treponema pallidum, herpes simplex virus 1 and herpes simplex virus 2, including a treponema pallidum amplification primer pair 1 and a corresponding detection probe 1, a herpes simplex virus 1 amplification primer pair 2 and a corresponding detection probe 2, and a herpes simplex virus 2 amplification primer pair 3 and a corresponding detection probe 3. Compared with other patents, such as the target described in the patent disclosed in CN 110157838A, the UL27 gene is used, and the similarity (Identities) between HSV1 and HSV2 is as high as 89% by using the Pairwise Sequence Alignment (PSA) system of EMBOSS Needle for comparison. Therefore, when performing multiple amplification, HSV1 and HSV2 may have cross reactions, causing false results. After multiple experiments, the target sequence of the present invention is finally determined to be the UL42 gene, and the similarity between the sequences of HSV1 and HSV2 is only 75%, so it is more suitable for typing detection of HSV1 and HSV2. Further comparison was performed using the BLAST system provided by the National Center for Biotechnology Information (NCBI) of the United States, and the results showed that no other similar species had sequences identical to those of each primer and probe designed by the present invention. This result also shows that the specificity of the primers and probes of the present invention is quite high, and the corresponding primer pairs and probes can only be used to amplify and detect the UL42 gene of HSV1 or the UL42 gene of HSV2. The sequences of the two primers of the syphilis treponema amplification primer pair 1 are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively, and the sequence of the corresponding detection probe 1 is shown in SEQ ID NO:7. The sequences of the two primers of the herpes simplex virus 1 amplification primer pair 2 are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively, and the sequence of the corresponding detection probe 2 is shown in SEQ ID NO:8. The sequences of the two primers of the herpes simplex virus 2 amplification primer pair 3 are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively, and the sequence of the corresponding detection probe 3 is shown in SEQ ID NO:9. Both ends of the above detection probes are respectively labeled with a fluorescent reporter group and a fluorescent quencher group, and different detection probes have different fluorescent reporter groups.

[0044] The fluorescent reporter groups include but are not limited to: FAM, VIC, Cy5, HEX, JOE, ROX, Texas Red, TAMRA, Cy3, Cy5.5, TET. The fluorescent quencher groups include but are not limited to: BHQ-1, BHQ-2, BHQ-3, MGB, Eclipse, Dabcyl.

[0045] Treponema pallidum forward primer, SEQ ID No: 1: CCTTTGCGCACGTCCCTTAT;

[0046] Treponema pallidum reverse primer, SEQ ID No: 2: GGTGCATGACAGCTTGGACA;

[0047] Treponema pallidum detection probe 1, SEQ ID No: 7: TCTGCTGTGCAGGATCCGGCA;

[0048] Herpes simplex virus 1 forward primer, SEQ ID No: 3: GAACCGCCGGGAACCAAG;

[0049] Herpes simplex virus 1 reverse primer, SEQ ID No: 4: TCTGGAGGTCGCGAAAGTAG;

[0050] Herpes simplex virus 1 detection probe 2, SEQ ID No: 8: CCGCCGCCTCGGGTCCGTAT;

[0051] Herpes simplex virus 2 forward primer, SEQ ID No: 5: GACCGACAGCCAGGACTC;

[0052] Herpes simplex virus 2 reverse primer, SEQ ID No: 6: TCGAGGCCTTCTTCTTCTGG,

[0053] Herpes simplex virus 2 detection probe 3, SEQ ID No: 9: CTCCTCCGAGCCGGACGCGG.

[0054] It is understandable that in other embodiments, the fluorescent reporter groups labeled on each detection probe are not limited to those described above, as long as the fluorescent groups labeled on both ends can undergo fluorescence energy resonance transfer, and the fluorescent reporter groups labeled on the detection probes corresponding to different pathogens are different.

[0055] Preferably, the concentration of the forward primer and the reverse primer for multi-target nucleotide amplification is 0.1-1.0 μM; the concentration of the detection probe is 0.1-1.0 μM.

[0056] Example 2

[0057] The present invention also provides a kit for detecting Treponema pallidum, herpes simplex virus 1 and herpes simplex virus 2, which comprises the primers and probes for the above detection.

[0058] In one embodiment, the kit also includes a human internal standard gene amplification specific primer pair and a detection probe as an internal standard positive quality control. The sequences of the two primers of the internal standard positive quality control amplification primer pair are shown in SEQ ID No: 10 and SEQ ID No: 11, respectively, and the sequence of the corresponding detection probe is shown in SEQ ID No: 12. The two ends of the detection probe of the internal standard positive quality control are also labeled with a fluorescent reporter group and a fluorescent quencher group, respectively, and the fluorescent reporter group labeled is different from the fluorescent reporter group labeled on the detection probe of other pathogens. The human internal standard gene can be selected from: glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene, Actin (actin) gene, GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene, β2 microglobulin gene, Globin (globin) gene, etc. Selecting an internal standard can monitor sample collection factors and avoid false negatives.

[0059] SEQ ID No: 10: CAGGGGGGAGCCAAAAGGGTC;

[0060] SEQ ID No: 11: CAGGAGGCATTGCTGA;

[0061] SEQ ID No: 12: CATGGGTGTGAACCATGAGA.

[0062] Preferably, the concentration of the primers used for internal standard fragment amplification is 0.1-1 μM; the concentration of the internal standard probe for detection is 0.1-1.0 μM.

[0063] Further, in one embodiment, the kit includes positive controls: a plasmid containing a target fragment of Treponema pallidum, a plasmid containing a target fragment of herpes simplex virus 1, and a plasmid containing a target fragment of herpes simplex virus 2.

[0064] Preferably, the cloned plasmids of Treponema pallidum, herpes simplex virus 1 and herpes simplex virus 2 can be mixed together at a specific concentration ratio to form a positive control.

[0065] Preferably, Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2 clone plasmids are mixed, and the concentration of each component is 1.00 to 5.00E+05 copies / ml.

[0066] Furthermore, the kit also includes a negative control substance, which may be, but is not limited to, substances such as sterile water.

[0067] Preferably, the negative control is sterile TE buffer.

[0068] The fluorescent PCR kit of the present invention further comprises at least one of a nucleic acid releasing agent and a PCR reaction solution.

[0069] Preferably, the concentrations of the components in the PCR reaction solution are as follows: 5-15U DNA polymerase, 0.1-5U UDG enzyme, 0.1-0.3mM dATP, 0.1-0.3mM dGTP, 0.1-0.3mM dCTP, 0.2-0.6mM dUTP, 0.05%-2% v / v Tween20, 1%-2% v / v glycerol, 10-100mM tris(hydroxymethyl)methylglycine (pH8.3), 1-8mM magnesium chloride;

[0070] 0.1-1.0 μM Treponema pallidum forward primer, 0.1-1.0 μM Treponema pallidum reverse primer;

[0071] 0.1-1.0 μM herpes simplex virus 1 forward primer, 0.1-1.0 μM herpes simplex virus 1 reverse primer;

[0072] 0.1-1.0 μM herpes simplex virus 2 forward primer, 0.1-1.0 μM herpes simplex virus 2 reverse primer;

[0073] 0.1-1.0 μM human G3PDH gene forward primer, 0.1-1.0 μM human G3PDH gene reverse primer;

[0074] 0.1~1.0μM Treponema pallidum probe, 0.1~1.0μM herpes simplex virus 1 probe, 0.1~1.0μM herpes simplex virus 2 probe, 0.1~1.0μM human G3PDH gene probe.

[0075] Preferably, the DNA polymerase is a hot-start Taq enzyme.

[0076] Example 3

[0077] This embodiment is a method for detecting Treponema pallidum, herpes simplex virus type 1 or herpes simplex virus type 2 DNA nucleic acid in a genital herpes fluid swab sample using the above kit.

[0078] 1. Reagent Preparation

[0079] According to the number of samples to be tested, negative controls and positive controls, take the corresponding amount of PCR reaction solution and dispense it into reaction tubes, centrifuge it instantly and set it aside for later use.

[0080] 2. Sample Nucleic Acid Extraction

[0081] This step extracts the DNA of Treponema pallidum, herpes simplex virus 1 and herpes simplex virus 2 and human G3PDH gene DNA in the sample, wherein the sample is a genital herpes fluid swab sample. DNA extraction can use a commercial DNA extraction and purification kit. The present invention also provides a nucleic acid releaser, and the sample can be directly added by simply treating the sample with the nucleic acid releaser without extracting DNA.

[0082] The sample is concentrated by high-speed centrifugation and then a nucleic acid releasing agent is added (the nucleic acid releasing agent includes 10-100 mM sodium hydroxide, 0.01%-2% w / v sodium dodecyl sulfate, and 1%-8% v / v Tween20).

[0083] The specific operation is to take 200-500 μl of the sample to be tested, centrifuge at 12,000 rpm for 5 minutes, discard the supernatant, add 100-200 μl of nucleic acid release agent, shake and mix, let it stand for 10 minutes, and set aside.

[0084] 3. Fluorescence PCR

[0085] 1. Take the PCR reaction tubes prepared in step 1, add 25 μL of the extracted sample to be tested and the negative / positive control nucleic acid product, cover the tubes (after removing bubbles), and centrifuge for 10 seconds.

[0086] 2. Sample PCR reaction system after centrifugation

[0087] Table 1

[0088] volume PCR reaction solution 25μL template 25μL

[0089] The concentrations of components in the PCR reaction solution were as follows: 10 U hot start Taq enzyme, 1 U UDG enzyme, 0.2 mM dATP, 0.2 mM dGTP, 0.2 mM dCTP, 0.4 mM dUTP, 0.05% Tween 20, 1% glycerol, 50 mM tris(hydroxymethyl)methylglycine (pH 8.3), 4 mM magnesium chloride;

[0090] 0.3 μM Treponema pallidum forward primer, 0.3 μM Treponema pallidum reverse primer;

[0091] 0.5 μM herpes simplex virus 1 forward primer, 0.5 μM herpes simplex virus 1 reverse primer;

[0092] 0.5 μM herpes simplex virus 2 forward primer, 0.5 μM herpes simplex virus 2 reverse primer;

[0093] 0.3 μM human G3PDH gene forward primer, 0.3 μM human G3PDH gene reverse primer;

[0094] 0.15μM Treponema pallidum probe, 0.25μM herpes simplex virus 1 probe, 0.25μM herpes simplex virus 2 probe,

[0095] 0.15 μM human G3PDH gene probe.

[0096] Place the PCR reaction tube into the sample slot of the thermal cycler and set the name of the sample to be tested and the concentration of the positive reference in the corresponding order.

[0097] The fluorescent reporter group labeled on the detection probe 1 of Treponema pallidum is FAM, and the fluorescent quenching group is BHQ1; the fluorescent reporter group labeled on the detection probe 2 of herpes simplex virus 1 is VIC, and the fluorescent quenching group is BHQ1; the fluorescent reporter group labeled on the detection probe 3 of herpes simplex virus 2 is CY5, and the fluorescent quenching group is BHQ2.

[0098] Both ends of the detection probe of the internal standard positive quality control are also labeled with a fluorescent reporter group, which is Texas Red, and a fluorescent quencher group, which is BHQ2.

[0099] 3. Fluorescence detection channel selection: select FAM channel to detect TP, select VIC channel to detect HSV-1 target; select CY5 channel to detect HSV-2 target; select Texas Red channel to detect internal standard;

[0100] 4. Fluorescence PCR reaction conditions are shown in Table 2:

[0101] Table 2: Fluorescence PCR reaction conditions:

[0102]

[0103] IV. Results Analysis

[0104] After the reaction is finished, the instrument automatically saves the results. You can use the software that comes with the instrument to automatically analyze (you can also manually adjust the baseline start value, end value and threshold line for analysis), and then record the sample Ct value results. The intersection of the amplification curve and the threshold line is called the Ct value (i.e., cycle threshold, which refers to the number of cycles experienced when the fluorescent signal in the PCR reaction tube reaches the set threshold); the instrument software can judge the test results based on the Ct value of each sample. For samples with a Ct value of ≤38.00, the report is positive; for samples with a Ct value of >38 and a positive internal standard test (Ct value ≤40), the report is less than the detection limit; for samples with no Ct value and a positive internal standard test (Ct value ≤40), the report is negative; if the internal standard Ct value is >40 or no display, the test result of the sample is invalid, the cause should be found and eliminated, and the sample should be tested again.

[0105] Example 4: Performance study of the kit of the present invention

[0106] 1. Sensitivity test

[0107] The detection kit of the present invention is used to detect the enterprise detection limit reference product (the enterprise detection limit reference product is a single reference product, including 300 copies / ml of Treponema pallidum, 300 copies / ml of herpes simplex virus 1, and 300 copies / ml of herpes simplex virus 2 clone plasmid. This can verify that there is no cross reaction between the three systems and at the same time verify the stability of the detection limit of the detection kit.), and the detection limit reference product (300 copies / mL) detection rate is greater than 95%. This kit detects 8 examples of enterprise working reference products for TP, HSV-1 and HSV-2 detection limits, Figure 1 is the amplification curve of the reference substance for the detection limit of Treponema pallidum detected by the kit of the present invention, Figure 2 The detection limit reference amplification curve of the HSV-1 type detected by the kit of the present invention; Figure 3 This is the amplification curve of the detection limit reference material for the HSV-2 type detected by the kit of the present invention.

[0108] Conclusion: According to the test results, the kit of the present invention detected 8 cases of TP, HSV-1 and HSV-2 enterprise detection limit working reference materials respectively, and the amplification curves were all standard "S" curves, among which the detection limit of Treponema pallidum was 8 cases, and all of them were detected, with a detection rate of 100%, among which the detection limit of HSV-1 was 8 cases, and all of them were detected, with a detection rate of 100%; the detection limit of HSV-2 was 8 cases, and all of them were detected, with a detection rate of 100%.

[0109] 2. Specificity experiment

[0110] The detection kit of the present invention is used to carry out specific experiments, and Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Ureaplasma urealyticum (UU), human cytomegalovirus (HCMV), and human papillomavirus 16 and 18 (HPV-16 and HPV-18) are detected respectively. The quality control products are purchased from Guangzhou Bondeson Biotechnology Co., Ltd., and 10000cps / mL of the above pathogen quality control products are used for amplification. The results show that Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Ureaplasma urealyticum (UU), human cytomegalovirus (HCMV), and human papillomavirus 16 and 18 (HPV-16 and HPV-18) have no cross reaction, and the detection results are all negative.

[0111] The results are as follows Figure 4-Figure 6 As shown, Figure 4 This is the Treponema pallidum amplification curve of the specific experiment of the kit of the present invention; Figure 5 This is the HSV-1 amplification curve of the specific experiment of the kit of the present invention; Figure 6 This is the HSV-2 amplification curve of the specific experiment of the kit of the present invention.

[0112] Conclusion: The test results showed that the common clinical pathogens Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Ureaplasma urealyticum (UU), human cytomegalovirus (HCMV), human papillomavirus 16, 18 (HPV-16, HPV-18) had no cross reaction to Treponema pallidum and HSV detection, proving that the kit has high specificity.

[0113] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail through the above preferred embodiments, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection defined by the claims.

Claims

1. A primer-probe combination for multiplex fluorescent PCR, characterized in that: include: Primers or combinations thereof; and / or probes or combinations thereof; (1) the primers or combinations thereof have any one of the following nucleotide sequences: Ⅰ. A nucleotide sequence having any of SEQ ID No: 1 to SEQ ID No: 6; or II. a nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases of the nucleotide sequence shown in any of SEQ ID No: 1 to SEQ ID No: 6 and having the same function as the nucleotide sequence shown in any of SEQ ID No: 1 to SEQ ID No: 6; or III, a nucleotide sequence having at least 90% homology to the nucleotide sequence shown in any of SEQ ID No: 1 to SEQ ID No: 6 and having the same function as the nucleotide sequence shown in any of SEQ ID No: 1 to SEQ ID No: 6; or IV, a complementary sequence of the sequence shown in Ⅰ, Ⅱ or III; (2) The probe or its combination has any one of the following nucleotide sequences: V, having a nucleotide sequence shown in any of SEQ ID No: 7 to SEQ ID No: 9; or VI, a nucleotide sequence obtained by modifying, replacing, deleting or adding one or more bases of the nucleotide sequence shown in any of SEQ ID No: 7 to SEQ ID No: 9 and having the same function as the nucleotide sequence shown in any of SEQ ID No: 7 to SEQ ID No: 9; or VII, a nucleotide sequence having at least 90% homology to the nucleotide sequence shown in any of SEQ ID No: 7 to SEQ ID No: 9 and having the same function as the nucleotide sequence shown in any of SEQ ID No: 7 to SEQ ID No: 9; or VIII, a complementary sequence of the sequence shown in V, VI or VII.

2. The primer-probe combination for multiplex fluorescent PCR according to claim 1, characterized in that: In the probe or the combination thereof, the 5' end of the probe sequence is connected to a fluorescent reporter group, and the 3' end is connected to a fluorescent quencher group.

3. The primer-probe combination for multiplex fluorescent PCR according to claim 1, characterized in that: Also included are primers and probes specific for a human internal standard gene.

4. The primer-probe combination for multiplex fluorescent PCR according to claim 1, characterized in that: The human internal standard gene is the G3PDH gene.

5. Use of the primer-probe combination for multiplex fluorescent PCR according to any one of claims 1 to 4 in the preparation of a reagent or a kit for detecting Treponema pallidum, herpes simplex virus 1, or herpes simplex virus 2.

6. A reagent or kit for detecting Treponema pallidum, herpes simplex virus 1, or herpes simplex virus 2, characterized in that: The method comprises the primer-probe combination as described in any one of claims 1 to 4 and an acceptable auxiliary agent.

7. The reagent or kit according to claim 6, characterized in that The concentration of each primer or probe is 0.1 to 1.0 μM.

8. The reagent or kit according to claim 6, characterized in that The method also includes a PCR reaction solution, which includes: 5-15U DNA polymerase, 0.1-5U UDG enzyme, 0.1-0.3mM dATP, 0.1-0.3mM dGTP, 0.1-0.3mM dCTP, 0.2-0.6mM dUTP, 0.05%-2% Tween20, 1%-2% glycerol, 10-100mM tris(hydroxymethyl)methylglycine, and 1-8mM magnesium chloride.

9. The reagent or kit according to claim 6, characterized in that The invention also comprises a nucleic acid releasing agent, which comprises 10-100 mM sodium hydroxide, 0.01%-2% w / v sodium dodecyl sulfate, and 1%-8% v / v Tween20.

10. The reagent or kit according to claim 6, characterized in that It also includes positive quality control products and / or negative quality control products; the positive quality control products are a mixture of cloned plasmids of Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2; the negative quality control products are reagents that do not contain cloned plasmids of Treponema pallidum, herpes simplex virus 1, and herpes simplex virus 2.

Images