ShRNA (short hairpin Ribonucleic Acid) targeting KRT6B gene and application

Abstract

The invention discloses shRNA (short hairpin Ribonucleic Acid) of a targeted KRT6B gene and application of the shRNA. The RNAi target spot of the shRNA targeted KRT6B gene comprises any one or more of RNAi-1 as shown in SEQ ID NO.1, RNAi-2 as shown in SEQ ID NO.2 and RNAi-3 as shown in SEQ ID NO.3, and the RNAi target spot of the shRNA targeted KRT6B gene comprises any one or more of RNAi-1 as shown in SEQ ID NO.1, RNAi-2 as shown in SEQ ID NO.2 and RNAi-3 as shown in SEQ ID NO.3; and / or a sequence which is obtained by substituting, deleting or adding one or more base sequences to any sequence as shown in SEQ ID NO.1-3 and has the same activity as any sequence as shown in SEQ ID NO.1-3. The gene KRT6B which is highly expressed in bladder cancer cells is screened out through a Shenxing gene bank and serves as an action target. A recombinant lentiviral vector for RNA interference of KRT6B is designed, and expression of KRT6B is effectively knocked down, so that proliferation and migration of bladder cancer cells are inhibited, and gene therapy of bladder cancer is realized.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, in particular to shRNA targeting KRT6B gene and application thereof, and in particular to application of a KRT6B inhibitor in preparing a drug for treating bladder cancer. Background Art

[0002] Bladder cancer refers to a malignant tumor that occurs on the bladder mucosa. It is the most common malignant tumor of the urinary system and one of the top ten common tumors in the body. Bladder cancer can occur at any age, even in children. Its incidence increases with age, and the peak age is 50 to 70 years old. The incidence of bladder cancer in men is 3 to 4 times that of women. Bladder tumors are biologically invasive and have specific resistance to radiotherapy and chemotherapy, resulting in high recurrence and progression rates in patients. Most bladder cancers can be cured by transurethral resection of bladder tumors (TUR), but the recurrence rate is as high as 60% to 90% within 3 to 5 years after surgery.

[0003] The growth and metastasis of cancer are achieved through the proliferation and migration of cancer cells, which are often accompanied by the overexpression of some genes. Knocking out and silencing these overexpressed genes can inhibit the growth and metastasis of tumors and further inhibit the development of cancer. Therefore, the construction technology of lentiviral vectors for gene knockout and silencing is particularly important.

[0004] Lentivirus is a type of viral vector modified from human immunodeficiency virus (HIV). It is a type of retrovirus. Its genome is RNA, and its toxic genes have been removed and replaced by exogenous target genes. It is a pseudotype virus that can integrate exogenous genes into the genome to achieve stable expression. It has the characteristics of infecting both dividing and non-dividing cells. After the lentivirus genome enters the cell, it is reverse transcribed into DNA in the cytoplasm to form a pre-DNA integration complex. After entering the cell nucleus, the DNA is integrated into the cell genome. The integrated DNA is transcribed into mRNA, which returns to the cytoplasm to express the target protein or produce small RNA. Lentivirus-mediated gene expression or small RNA interference is continuous and stable, and divides with the division of the cell genome.

[0005] At the same time, lentiviral infection has integration characteristics, which can effectively integrate exogenous genes into host chromosomes to achieve persistent expression, thereby constructing stable cell lines for the study of gene cellular functions. Summary of the invention

[0006] In view of this, the object of the present invention is to provide a shRNA targeting the KRT6B gene and its application.

[0007] The technical solution provided by the present invention is as follows:

[0008] <First aspect>

[0009] A shRNA for specifically knocking down KRT6B gene expression, wherein the RNAi target targeted by the shRNA includes any one or more of RNAi-1 as described in SEQ ID NO.1, RNAi-2 as described in SEQ ID NO.2, and RNAi-3 as described in SEQ ID NO.3;

[0010] And / or, a sequence in which one or more base sequences are substituted, deleted or added to any of the sequences shown in SEQ ID NO.1-3 and which has the same activity as any of the sequences shown in SEQ ID NO.1-3.

[0011] The shRNA targeting RNAi-1 is denoted as shRNA-1, and its sequence is as follows:

[0012] shKRT6B-1F: nucleotide sequence is shown in SEQ ID NO.4;

[0013] shKRT6B-1R: The nucleotide sequence is shown in SEQ ID NO.5.

[0014] The shRNA targeting RNAi-2 is denoted as shRNA-2, and its sequence is as follows:

[0015] shKRT6B-2F: nucleotide sequence is shown in SEQ ID NO.6;

[0016] shKRT6B-2R: The nucleotide sequence is shown in SEQ ID NO.7.

[0017] The shRNA targeting RNAi-3 is denoted as shRNA-3, and its sequence is as follows:

[0018] The sequence looks like this:

[0019] shKRT6B-3F: nucleotide sequence is shown in SEQ ID NO.8;

[0020] shKRT6B-3R: The nucleotide sequence is shown in SEQ ID NO.9.

[0021] <Second Aspect>

[0022] A KRT6B gene interference nucleic acid construct comprises the shRNA as described above.

[0023] The interfering nucleic acid construct is selected from a viral vector or a plasmid vector.

[0024] The viral vector is selected from one or more of a lentiviral vector, an adenoviral vector, a retroviral vector, and AAV.

[0025] The lentiviral vector includes pLKO.1-U6-EF1a-copGFP-T2A-puro.

[0026] <Third Aspect>

[0027] A method for constructing a recombinant lentiviral vector comprises the following steps:

[0028] S1. According to the mRNA sequence of the KRT6B gene, an RNAi target sequence is designed to obtain an RNAi target, wherein the RNAi target comprises at least one of RNAi-1 described in SEQ ID NO.1, RNAi-2 described in SEQ ID NO.2, and RNAi-3 described in SEQ ID NO.3;

[0029] S2, design and synthesize the corresponding shRNA for each RNAi target sequence;

[0030] S3. Insert the shRNA synthesized in S2 into the expression vector pLKO.1-U6-EF1a-copGFP-T2A-puro, transform competent cells, and pick monoclonal colonies for PCR identification and sequencing verification after culture to obtain the recombinant lentiviral vector.

[0031] The competent cells are Escherichia coli DH5α.

[0032] In step S2, the shRNA includes shRNA-1 targeting RNAi-1, and its sequence is as follows:

[0033] shKRT6B-1F: nucleotide sequence is shown in SEQ ID NO.4;

[0034] shKRT6B-1R: The nucleotide sequence is shown in SEQ ID NO.5.

[0035] and / or,

[0036] The sequence of shRNA-2 targeting RNAi-2 is as follows:

[0037] shKRT6B-2F: nucleotide sequence is shown in SEQ ID NO.6;

[0038] shKRT6B-2R: the nucleotide sequence is shown in SEQ ID NO.7;

[0039] and / or,

[0040] The sequence of shRNA-3 targeting RNAi-3 is as follows:

[0041] shKRT6B-3F: nucleotide sequence is shown in SEQ ID NO.8;

[0042] shKRT6B-3R: The nucleotide sequence is shown in SEQ ID NO.9.

[0043] <Fourth Aspect>

[0044] The present invention provides a KRT6B gene inhibitor, which includes the shRNA described above; or the interfering nucleic acid construct described above.

[0045] Compared with the prior art, the present invention has the following beneficial effects:

[0046] The present invention discloses a shRNA targeting the KRT6B gene and its application; the RNAi target of the KRT6B gene targeted by the shRNA includes any one or more of RNAi-1 as described in SEQ ID NO.1, RNAi-2 as described in SEQ ID NO.2, and RNAi-3 as described in SEQ ID NO.3; and / or, any sequence as shown in SEQ ID NO.1-3 is replaced, deleted or added with one or more base sequences and has the same activity as any sequence as shown in SEQ ID NO.1-3. The present invention screens out the gene KRT6B highly expressed in bladder cancer cells as a target through the bioinformatics gene library. A recombinant lentiviral vector for RNA interference against KRT6B is designed to effectively knock down its expression, thereby inhibiting the proliferation and migration of bladder cancer cells and achieving gene therapy for bladder cancer.

[0047] The present invention screened out the gene KRT6B, which is highly expressed in bladder cancer cells, as a target through the bioinformatics gene library. A recombinant lentiviral vector for RNA interference targeting KRT6B was designed to effectively knock down its expression, thereby inhibiting the proliferation and migration of bladder cancer cells and achieving gene therapy for bladder cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0049] Figure 1 is the spectrum of PMD2.G;

[0050] Figure 2 This is the VSV-G envelope expression plasmid map;

[0051] Figure 3is the expression level of gene KRT6B in cells 5637, T24, TCCSUP, and RT-112 in Example 4;

[0052] Figure 4 The expression of GFP in bladder cancer cell 5637 infected with shNC and shKRT6B-2 lentivirus in Example 5;

[0053] Figure 5 The expression of GFP in bladder cancer cell T24 infected with shNC and shKRT6B-2 lentivirus in Example 5;

[0054] Figure 6 The interference results of shKRT6B-1, shKRT6B-2, and shKRT6B-3 on KRT6B in bladder cancer cell T24 in Example 6;

[0055] Figure 7 The interference results of shKRT6B-2 on KRT6B in bladder cancer cell 5637 in Example 6;

[0056] Figure 8 The interference results of shKRT6B-2 on KRT6B in bladder cancer cell T24 in Example 6;

[0057] Fig. 9 The results of the CCK8 experiment in Example 7 to detect cell proliferation of bladder cancer cell 5637 infected with lentivirus shKRT6B-2;

[0058] Fig.10 The results of the CCK8 experiment in Example 7 to detect cell proliferation of bladder cancer cell T24 infected with lentivirus shKRT6B-2;

[0059] Fig.11 The results of the scratch test after bladder cancer cell 5637 cells were infected with lentivirus shKRT6B-2 in Example 8; A is a cell scratch image (40 times); B is a cell migration rate bar chart;

[0060] Fig.12 The results of the scratch test after bladder cancer cell 5637 cells were infected with lentivirus shKRT6B-2 in Example 8; A is a cell scratch image (40 times); B is a cell migration rate bar chart;

[0061] Fig.13 The results of the Transwell migration experiment after bladder cancer cell T24 was infected with lentivirus shKRT6B-2 in Example 9; A is a Transwell image (100 times); B is a bar chart of the number of migrated cells; C is a bar chart of the migration times

[0062] Fig.14 The results of the Transwell migration experiment after bladder cancer cell 5637 was infected with lentivirus shKRT6B-2 in Example 9; A is a Transwell picture (100 times); B is a bar chart of the number of migrated cells; C is a bar chart of the migration fold. DETAILED DESCRIPTION

[0063] The present invention is described in detail below in conjunction with embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, some adjustments and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0064] In the following embodiments and comparative examples:

[0065] Pancreatic enzyme: Melan; Product number: MA0233-1;

[0066] Serum-free medium:

[0067] Example 1 Target Confirmation

[0068] The gene KRT6B, which is highly expressed in bladder cancer cells, was screened out through the bioinformatics gene library as a target. Figure 1 Shown is the expression of KRT6B in bladder cancer.

[0069] Among them, the NM number of KRT6B is: NM_005555.4

[0070] Example 2 shRNA Design

[0071] 1. Design RNAi target sequence according to the mRNA sequence of KRT6B, as shown in Table 1:

[0072] Table 1

[0073] sequence Serial Number RNAi-1 GCACAGCAGCAGAGAATGAAT SEQ ID NO.1 RNAi-2 GCAGATCAAGACCCTCAACAA SEQ ID NO.2 RNAi-3 GCAGGAGATTGCTGAGATCAA SEQ ID NO.3

[0074] 2. Based on the RNAi principle, shRNA was designed as shown in Table 2:

[0075] Table 2

[0076]

[0077]

[0078] Note: The underlined part is the base complementary region (from 5'→3'), the bold part is the RNAi target sequence, and the first several bases of the 5' end of the sequence are restriction endonuclease sites.

[0079] 3. The following three pairs of primers were designed according to each shRNA sequence. Each primer pair contained the specific sequence of the corresponding target gene and the homologous sequence on the vector, so that the amplified shRNA fragment could be inserted into the expression vector by homologous recombination; see Table 3 for details.

[0080] Table 3

[0081]

[0082]

[0083] Example 3 Construction of shKRT6B lentiviral vector

[0084] 1. Annealing and glue recovery:

[0085] Dissolve the three pairs of primers in Table 2 of Example 2 in double distilled water (ddH2O) to 50 pmol / μl, take 5 μL of each complementary single strand and mix them two by two, add 10 μL of 10× annealing buffer (oligoannealing buffer), and make up with ddH2O to make a total reaction volume of 50 μL. Heat the reaction mixture of the three pairs of primers at 95°C for 10 minutes, then cool naturally at room temperature to obtain annealing products. Perform gel recovery on the annealing products to prepare for the connection experiment.

[0086] 2. Enzyme digestion and ligation of vector plasmid: Use restriction endonucleases to cut the two enzyme cleavage sites (AgeI and EcoRI) on the vector pLKO.1-U6-EF1a-copGFP-T2A-puro (manufacturer: Jiangsu Saisuofei Biotechnology Co., Ltd.) and recover the vector backbone; connect the gel recovery product obtained in the above step 1 with the recovered vector backbone (use T4 ligase for connection).

[0087] Table 4 Connection system

[0088] Connection system Dosage (μL) 2*QBbuffer 10 pLKO.1-U6-EF1a-copGFP-T2A-puro vector backbone 2 The glue recovery product in step 1 6 T4 Ligase 2 Total volume 20

[0089] Reaction conditions: react at room temperature for 30 minutes at 22 degrees, and then leave for 2-3 minutes to lower the temperature.

[0090] 3. Transformation experiment

[0091] a. Resuscitate competent E. coli DH5α cells on ice;

[0092] b. Transfer the product of the ligation reaction in step 2 into competent cells and place on ice for 10 minutes;

[0093] c. Heat shock at 42°C for 90 seconds after ice bath, immediately ice bath for 3 minutes, add 800ul LB liquid medium without antibiotics and culture for 1 hour;

[0094] d. Centrifuge the cultured sample to remove part of the supernatant, and spread the remaining mixture onto LB solid medium containing 25 mg / L kanamycin and culture it upside down overnight.

[0095] 4. Colony screening experiment

[0096] a. Pick a single colony from the overnight plate;

[0097] b. Perform colony PCR using the three pairs of shRNA primers in Table 3;

[0098] c. Identify positive clones by electrophoresis;

[0099] d. Randomly select 3 positive bacteria and culture them in a 4 ml single tube of LB liquid medium containing 25 mg / L kanamycin at 37°C in a shaker overnight;

[0100] Colony PCR reaction system:

[0101] Table 5

[0102] 1*Taq enzyme MIX (homemade) 27μl Monoclonal colonies 1μl shRNA forward primer 1μl shRNA reverse primer 1μl Total volume 30μl

[0103] 5. Plasmid extraction and sequencing

[0104] Plasmid extraction and sequencing: The recombinant plasmid DNA was extracted using a conventional plasmid extraction kit (Fuji Universal Plasmid Miniprep Kit), and the recombinant plasmid was obtained by U6-5N sequencing verification.

[0105] 6. Lentivirus packaging and transfection

[0106] The recombinant plasmid prepared in step 4 and the backbone plasmid were configured into a transfection plasmid in a mass ratio of 1:1; the total mass of the transfection plasmid was 20 μg, and the amount of the transfection aid PEI was 2.5-3 times that of the plasmid.

[0107] Among them, the backbone plasmid is a three-plasmid transfection system; VSVG (see the map Figure 2 )、PMD2.G(see the spectrum Figure 1 ) and RRE are prepared in a ratio of 4:3:1, that is, VSVG:PMD2.G:RRE=4:3:1.

[0108] The transfection steps are as follows:

[0109] (1) HEK293T cells in the logarithmic growth phase were digested and counted, and 3×10 cells were inoculated into each 10 cm cell culture dish. 6 Cells were cultured overnight in a 37°C, 5% CO2 incubator;

[0110] (2) Add 20 μg of the transfection plasmid into a total volume of 500 μL of RPMI1640 serum-free and dual-antibody-free medium, referred to as solution A, and mix 20 times with a pipette;

[0111] (3) Take 50 μg (i.e., 50 μL) of PEI (prepared at 1 μg / mL) and add it to a total volume of 500 μL of RPMI1640 serum-free and dual antibody-free medium, recorded as liquid B, and mix with a pipette 20 times;

[0112] (4) Add solution B dropwise into solution A, mix gently 66 times with a pipette, and let stand at room temperature for 15-20 min to prepare the transfection reagent (A+B);

[0113] (5) Slowly add the transfection reagent (A+B) dropwise to the HEK293T cells that have been in recovery state for 20 h;

[0114] (6) At 18 h after transfection, the HEK293T supernatant containing the transfection reagent was replaced with 10 mL of RPMIlo1640 complete medium;

[0115] (7) 48-72 h after transfection is the peak period of virus production. The virus solution was collected 48 h after transfection (30 h after medium replacement and 30 h of virus production) for subsequent experiments;

[0116] (8) The virus solution was collected in a 15 mL test tube, centrifuged at 500 g for 5 mL to remove cell debris and impurities, filtered through a 0.45 mm cellulose acetate filter, and concentrated for later use.

[0117] The virus solutions prepared in this example are:

[0118] shKRT6B-1 (corresponding to RNAi-1);

[0119] shKRT6B-2 (corresponding to RNAi-2);

[0120] shKRT6B-3 (corresponding to RNAi-3).

[0121] Example 4 Selection of infected cells

[0122] qPCR was used to detect the expression of KRT6B in bladder epithelial cells, TCCSUP, RT-112, T24, and 5637 cells. The specific steps are as follows:

[0123] The RNA of different cells was extracted by Trizol method, and the RNA was reverse transcribed to obtain cDNA, and then qPCR was performed, where:

[0124] The upstream primer sequence is GGACCTCAAGAACAAATATG as shown in SEQ ID NO.16;

[0125] The downstream primer sequence is CTCTCAGGAAGTTGATCT as shown in SEQ ID NO.17.

[0126] The reaction system was prepared according to Table 6, Real-Time PCR was performed by two-step method, and a melting curve was prepared. The reaction program is shown in Table 7.

[0127] Table 6 qPCR reaction system

[0128]

[0129]

[0130] Table 7 Real-Time PCR Program

[0131]

[0132] Results Figure 3 Compared with bladder epithelial cells, the expression of gene KRT6B was upregulated in cells 5637, T24, TCCSUP, and RT-112 (P<0.05). Due to the high expression of 5637 and T24, bladder cancer T24 and 5637 were preferred for subsequent research.

[0133] Example 5 RNA interference effect test

[0134] In this example, the interference effect of RNAi on KRT6B was detected. Bladder cancer cells (T24, 5637) were infected with the shKRT6B-2 virus solution obtained in Example 3 to knock down the expression of KRT6B lentivirus.

[0135] The specific steps are as follows:

[0136] 1. T24 and 5637 cells in the logarithmic growth phase were digested with trypsin (brand: Meilun; catalog number: MA0233-1) to prepare cell suspensions;

[0137] 2. Plate the cell suspension on a 6-well plate and add T24 and 5637 cell suspensions respectively, with 1×10 cells per well. 5 After 24 hours, the cells were in good condition. The culture medium was discarded, and the infection solution Polybrene (brand: Yisheng; item number: 40804ES76) was added, and the virus solution obtained in Example 3 was added for infection;

[0138] 3. After 18-20 hours of infection, replace with new RPMI1640 medium; after 72 hours, take photos under an inverted fluorescence microscope.

[0139] 4. Experimental results are as follows Figure 4 and Figure 5 ;

[0140] shNC is the negative group infected with empty lentivirus (i.e., lentivirus without recombinant plasmid);

[0141] shKRT6B is the group infected with lentivirus.

[0142] Figure 4 and Figure 5 The results showed that in T24 and 5637 cells, after the cells were infected with lentivirus, the infection efficiency of each group of cells reached more than 80%.

[0143] Example 6 Screening of effective KRT6B targets

[0144] T24 cells and 5637 cells were infected with lentivirus corresponding to the three targets, and qPCR was used to detect the expression of KRT6B 48 hours later (for specific operations, refer to the qPCR detection in Example 4). The results are shown in Figure 6 ;

[0145] in:

[0146] Control is a blank control group, in which no lentivirus infection was performed;

[0147] shNC is the negative group, which is the group infected with empty lentivirus (i.e., lentivirus without shRNA sequence);

[0148] shKRT6B-1 was experimental group 1, and the group was infected with lentivirus carrying RNAi target sequence RNAi-1;

[0149] shKRT6B-2 is experimental group 2, a group infected with lentivirus carrying the RNAi target sequence RNAi-2;

[0150] shKRT6B-3 is experimental group 2, and the group is infected with lentivirus carrying RNAi target sequence RNAi-2.

[0151] Figure 6 Results for lentiviral infection of T24 cells:

[0152] The expression level in the shKRT6B-1 group was downregulated by 28% (P>0.05);

[0153] The expression level in the shKRT6B-2 group was downregulated by 75% (P < 0.05);

[0154] The expression level of shKRT6B-3 group was down-regulated by 66% (P<0.01).

[0155] The results showed that shKRT6B-2 had a good interference effect in T24 cells.

[0156] Figure 7 The interference results of shKRT6B-2 on KRT6B in bladder cancer cell 5637 in Example 6;

[0157] Figure 8 This is the interference result of shKRT6B-2 on KRT6B in bladder cancer cell T24 in Example 6.

[0158] Example 7 CCK8 experiment to detect the effect of KRT6B on the activity of bladder cancer cells

[0159] In order to explore the effect of KRT6B on the proliferation of bladder cancer cells, the virus solution obtained in Example 3 was infected in bladder cancer cell lines (T24, 5637) to knock down the expression of KRT6B, and the CCK-8 experiment was used to detect the effect of KLK5 on the activity of bladder cancer cells. The specific operation was as follows:

[0160] (1) T24 and 5637 cells in the logarithmic growth phase were digested with trypsin, resuspended in complete medium to form a cell suspension, and counted using a cell counter;

[0161] (2) Determine the cell density (2000 cells / well) based on the cell growth rate, add 100 μl per well, replicate 3 wells per group, and plate 5 96-well plates;

[0162] (3) After the cells are uniformly laid out and completely settled, the cell density of each experimental group is observed under a microscope and the cells are placed in a cell culture incubator for culture;

[0163] (4) Starting from the second day after plating, add 10 μL of CCK-8 reagent to the well before terminating the culture. No need to change the medium;

[0164] (5) After 1-3 hours, the 96-well plate was placed on an oscillator for 5 minutes and the OD value was measured at 450 nm using a microplate reader.

[0165] The results show (such as Fig. 9 and Fig.10 The results of CCK8 detection showed that:

[0166] In 5637 cells, compared with the LV-shNC group (negative group, empty lentivirus), the cell proliferation in the LV-shKRT6B (shKRT6B-2) group was inhibited (P<0.01, fold change=1.63).

[0167] In T24 cells, compared with the LV-shNC group (negative group, empty lentivirus), the cell proliferation in the LV-shKRT6B (shKRT6B-2) group was inhibited (P<0.01, fold change=1.56).

[0168] Example 8 Cell scratch test

[0169] In order to explore the mechanism of cancer occurrence and development, we conducted metastasis experiments to explore the effect of intervening target genes on cell metastasis.

[0170] In this example, bladder cancer cells (T24, 5637) were infected with the three virus solutions obtained in Example 3 to knock down KRT6B lentivirus, and the effect of KRT6B on the proliferation ability of bladder cancer cells was detected by scratch test; the specific steps are as follows:

[0171] (1) First, use a marker pen and a ruler to evenly draw horizontal lines on the back of the 6-well plate, one line every 0.5 to 1 cm, across the holes. Make at least 5 lines across each hole.

[0172] (2) T24 and 5637 cells in the logarithmic growth phase were trypsinized, resuspended in complete culture medium to form cell suspensions, and counted using a cell counter;

[0173] (3) Determine the cell density based on cell size (the number of cells plated is set to 500,000 cells / well), and the cells should reach a confluence of more than 90% the next day;

[0174] (4) On the second day, use the tip of a pipette to scratch the cell layer perpendicular to the cell plane along the line drawn on the back of the plate on the first day (it is best to use the same pipette tip or toothpick between different wells);

[0175] (5) After the scratching is completed, wash the cells three times with sterile PBS to wash away the non-adherent cells (i.e., the cells that were scratched during the scratching process), so that the gap left after the scratching is clearly visible, and then replace with fresh serum-free culture medium;

[0176] (6) Place the cells in a 37°C 5% CO2 incubator and culture them. Then, take out the cells after 24 hours, observe under a microscope, and measure the width of the scratches.

[0177] (7) After opening the image using Image J software, 6 horizontal lines were randomly drawn, the mean of the intercellular area was calculated, and data analysis was performed.

[0178] Fig.11 The results of the scratch experiment after bladder cancer cell 5637 cells were infected with lentivirus shKRT6B-2; A is a cell scratch image (40 times); B is a bar chart of cell migration rate;

[0179] Fig.12 The results of the scratch test after bladder cancer cell 5637 was infected with lentivirus shKRT6B-2; A is a cell scratch image (40 times); B is a cell migration rate bar chart;

[0180] The scratch test results show.

[0181] In T24 cells (such as Fig.11 As shown in the figure, compared with the LV-shNC group, the cell migration rate in the LV-shKRT6B (shKRT6B-2) group was significantly reduced by 31% at 24h (P<0.05);

[0182] In 5637 cells (such as Fig.12 As shown in Figure 2, compared with the LV-shNC group, the cell migration rate in the LV-shKRT6B (shKRT6B-2) group was significantly reduced by 73% at 24 h (P<0.05).

[0183] Example 9 Transwell experiment

[0184] Bladder cancer cells (T24, 5637) were infected with the virus solution obtained in Example 3 to knock down the expression of KRT6B, and the effect of KRT6B on the migration ability of bladder cancer cells was detected by Transwell assay. The specific operation was as follows:

[0185] (1) Place the required number of chambers in an empty 24-well plate, add 100 μL of serum-free culture medium to the chambers, and place in an incubator for 1 to 2 hours for hydration;

[0186] (2) T24 and 5637 cells in the logarithmic growth phase were trypsinized and resuspended in serum-free medium;

[0187] (3) After step (1) is completed, carefully remove the culture medium from the chamber;

[0188] (4) Add 600 μL of culture medium containing 30% FBS to the lower chamber;

[0189] (5) Dilute the cells in proportion with serum-free medium and add 100 uL of the cell suspension (containing 100,000 cells) to each chamber;

[0190] (6) Use forceps to transfer the chamber into the lower chamber containing 30% FBS medium;

[0191] (7) Culture in a 37°C incubator for 24 h;

[0192] (8) Remove the culture medium in the upper chamber and fix the cells with 4% FPA fixative at room temperature for 30 min;

[0193] (9) Remove the 4% FPA fixative and wash the cells in the upper chamber 1-2 times with 1× PBS;

[0194] (10) The chamber was immersed in crystal violet staining solution (Brand: Solebow; Catalog No.: G1063) for 10 min to stain the transferred cells on the lower surface of the membrane.

[0195] (11) Invert the chamber on absorbent paper to remove the culture medium and gently remove non-metastatic cells with a cotton swab;

[0196] (12) Clean the upper chamber several times with ddHO2;

[0197] (13) Air drying;

[0198] (14) Take photos under a microscope.

[0199] Fig.13 The results of the Transwell migration experiment after bladder cancer cell T24 was infected with the lentivirus shKRT6B-2; A is the Transwell image (100 times); B is the bar chart of the number of migrated cells; C is the bar chart of the migration multiple

[0200] Fig.14 These are the results of the Transwell migration experiment in the shKRT6B-2 group; after bladder cancer cell 5637 was infected with the lentivirus shKRT6B-2; A is the Transwell picture (100 times); B is the bar chart of the number of migrated cells; C is the bar chart of the migration multiples.

[0201] The results show that:

[0202] In T24 cells, the cell migration was inhibited in the LV-shKRT6B (shKRT6B-2) group compared with the LV-shNC group (P<0.001).

[0203] In 5637 cells, the migration of cells in the LV-shKRT6B (shKRT6B-2) group was inhibited compared with that in the LV-shNC group (P<0.001).

[0204] The results of this example show that our KRT6B not only affects tumor cell proliferation but also cell metastasis.

[0205] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A shRNA that specifically knocks down KRT6B gene expression, characterized in that: The RNAi target targeted by the shRNA includes any one or more of RNAi-1 as described in SEQ ID NO.1, RNAi-2 as described in SEQ ID NO.2, and RNAi-3 as described in SEQ ID NO.3; And / or, a sequence in which one or more base sequences are substituted, deleted or added to any of the sequences shown in SEQ ID NO.1-3 and which has the same activity as any of the sequences shown in SEQ ID NO.1-3.

2. The shRNA for specifically knocking down KRT6B gene expression according to claim 1, characterized in that: The shRNA targeting RNAi-1 is denoted as shRNA-1, and its sequence is as follows: shKRT6B-1F: nucleotide sequence is shown in SEQ ID NO.4; shKRT6B-1R: The nucleotide sequence is shown in SEQ ID NO.

5.

3. The shRNA for specifically knocking down KRT6B gene expression according to claim 1, characterized in that: The shRNA targeting RNAi-2 is denoted as shRNA-2, and its sequence is as follows: shKRT6B-2F: nucleotide sequence is shown in SEQ ID NO.6; shKRT6B-2R: The nucleotide sequence is shown in SEQ ID NO.

7.

4. The shRNA for specifically knocking down KRT6B gene expression according to claim 1, characterized in that: The shRNA targeting RNAi-3 is denoted as shRNA-3, and its sequence is as follows: The sequence looks like this: shKRT6B-3F: nucleotide sequence is shown in SEQ ID NO.8; shKRT6B-3R: The nucleotide sequence is shown in SEQ ID NO.

9.

5. A KRT6B gene interfering nucleic acid construct, characterized in that: The invention comprises the shRNA according to any one of claims 1 to 4.

6. The interfering nucleic acid construct of the KRT6B gene according to claim 5, characterized in that: The interfering nucleic acid construct is selected from a viral vector or a plasmid vector.

7. The interfering nucleic acid construct of the KRT6B gene according to claim 6, characterized in that: The viral vector is selected from one or more of a lentiviral vector, an adenoviral vector, a retroviral vector, and AAV.

8. A method for constructing a recombinant lentiviral vector, characterized in that: The following steps are involved: S1. According to the mRNA sequence of the KRT6B gene, an RNAi target sequence is designed to obtain an RNAi target, wherein the RNAi target comprises at least one of RNAi-1 described in SEQ ID NO.1, RNAi-2 described in SEQ ID NO.2, and RNAi-3 described in SEQ ID NO.3; S2, design and synthesize the corresponding shRNA for each RNAi target sequence; S3. Insert the shRNA synthesized in S2 into the expression vector pLKO.1-U6-EF1a-copGFP-T2A-puro, transform competent cells, and pick monoclonal colonies for PCR identification and sequencing verification after culture to obtain the recombinant lentiviral vector.

9. The method for constructing a recombinant lentiviral vector according to claim 8, characterized in that: In step S2, the shRNA includes shRNA-1 targeting RNAi-1, and its sequence is as follows: shKRT6B-1F: nucleotide sequence is shown in SEQ ID NO.4; shKRT6B-1R: The nucleotide sequence is shown in SEQ ID NO.

5. and / or, The sequence of shRNA-2 targeting RNAi-2 is as follows: shKRT6B-2F: nucleotide sequence is shown in SEQ ID NO.6; shKRT6B-2R: the nucleotide sequence is shown in SEQ ID NO.7; and / or, The sequence of shRNA-3 targeting RNAi-3 is as follows: shKRT6B-3F: nucleotide sequence is shown in SEQ ID NO.8; shKRT6B-3R: The nucleotide sequence is shown in SEQ ID NO.

9.

10. A KRT6B gene inhibitor, characterized in that: The inhibitor comprises the shRNA according to any one of claims 1 to 4; or the interfering nucleic acid construct according to any one of claims 5 to 7.

Images