SNP (Single Nucleotide Polymorphism) site related to seta length of millet, molecular marker and application of SNP site and molecular marker

Abstract

The invention discloses SNP sites related to seta length of foxtail millet, a molecular marker and application of the SNP sites, the SNP sites comprise a first SNP site and a second SNP site, the first SNP site is located at the 38241023th site of a first chromosome of foxtail millet, and the allelic variation of the first SNP site is T / C; the first SNP site is located at the 35484548th site of the fifth chromosome of the foxtail millet, the second SNP site is located at the 35484548th site of the fifth chromosome of the foxtail millet, the allelic variation of the second SNP site is A / G, and when the first SNP site shows C allelic variation and the second SNP site shows A allelic variation, the seta length of the foxtail millet is too long. According to the SNP marker obviously related to the seta character (length), the genome DNA sequence and the seta character gene of the millet are linked, establishment of a molecular marker-assisted breeding system of the millet is facilitated, and a direction and a basis can be provided for finer positioning and millet breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of biomolecules, and in particular relates to a SNP site related to the length of millet bristles, a molecular marker and an application thereof. Background Art

[0002] Millet (Setaria italica), also known as millet or millet in ancient times, is an annual herbaceous crop native to China. It is one of China's important food crops and plays an irreplaceable role in the sustainable development of dryland agriculture. Millet is drought-resistant and water-saving, and is considered a strategic reserve crop to cope with future drought environments and climate warming. Millet is a spike-shaped panicle, consisting of a main axis, branches, spikelets and flowers, with bristles at the base of the spikelets. Studies have found that the long bristles of millet can reduce and prevent insect and bird damage. Long bristles are not conducive to the flight of pests, egg laying and the adhesion of pathogens, reducing the chance of pests and diseases; and long bristles can reduce the loss of millet caused by bird feeding. As a diploid self-pollinating crop, millet has a small genome, is easy to operate, has a short reproductive cycle, and is relatively simple in inheritance. It now has a high-quality reference genome sequence, and the publication of the millet SSR genetic linkage map has laid a good foundation for the genetic analysis of millet. Although the whole genome sequence of millet has been sequenced, there are few reports on the genetic association studies of the bristle trait; therefore, it is necessary to develop, utilize, and identify molecular markers for the bristle trait of millet in order to breed better varieties. Summary of the invention

[0003] Based on the above background, the present invention provides SNP sites and molecular markers related to millet bristle length and their applications to breed better varieties.

[0004] The technical solution of the present invention is:

[0005] One of the objects of the present invention is to provide:

[0006] The SNP site associated with the length of millet bristles is characterized in that the SNP site includes a first SNP site and a second SNP site, the first SNP site is located at position 38241023 of the first chromosome of millet, and its allele variation is T / C; the second SNP site is located at position 35484548 of the fifth chromosome of millet, and its allele variation is A / G.

[0007] Furthermore, when the first SNP site exhibits a C allele variation and the second SNP site exhibits an A allele variation, the bristle length of the millet is relatively long.

[0008] Based on the same inventive concept, the present invention also provides the use of a substance for detecting the polymorphism or genotype of SNP in the millet genome in any of the following applications, the application comprising:

[0009] 1) Application in predicting the length of millet bristles;

[0010] 2) Application in identification or auxiliary identification of millet bristle length traits;

[0011] 3) Application in related breeding or auxiliary breeding for improving millet bristle length.

[0012] The SNP sites include a first SNP site and a second SNP site. The first SNP site is located at position 38241023 of the first chromosome of millet, and its allele variation is T / C; the second SNP site is located at position 35484548 of the fifth chromosome of millet, and its allele variation is A / G.

[0013] Based on the same inventive concept, the present invention also provides a molecular marker related to the length of millet bristles, the molecular marker comprising a first molecular marker and a second molecular marker, the first molecular marker comprising the 38241023rd position of the first chromosome of millet, and the second molecular marker comprising the 35484548th position of the fifth chromosome of millet;

[0014] The nucleotide sequence of the first molecular marker is shown in SEQ ID No. 1, and the details are as follows:

[0015] CATCACTGGTTGTTCATCCACTGTTATTCTTACTGCATCCTGAAGTAAATTTCTCTCACACGGTTCATCCC, the 36th base allele variation is C or T;

[0016] The nucleotide sequence of the second molecular marker is shown in SEQ ID No. 2, and is specifically as follows:

[0017] TCTCTGCGGCTTTCAGAGAAGCTGTTGAGTGGCACAGGATCGCGAAGGAGAATTAAACTAGTACAGATGCC, the 36th base allele variation is A or G.

[0018] Based on the same inventive concept, the present invention also provides the use of molecular markers related to millet bristle length in any of the following, the application comprising:

[0019] 1) Application in predicting the length of millet bristles;

[0020] 2) Application in identification or auxiliary identification of millet bristle length traits;

[0021] 3) Application in related breeding or auxiliary breeding for improving millet bristle length.

[0022] Based on the same inventive concept, the present invention also provides a method for predicting the length of millet bristles, using a specific probe or chip for detecting the above-mentioned SNP site to detect the millet genomic DNA of the prediction object, obtain the base situation of the allele variation site of the SNP site, and predict the length of millet bristles according to the base situation;

[0023] Alternatively, a single leaf of millet is used as a DNA template, and primers corresponding to the above molecular markers are used for PCR amplification, and the amplified products are sequenced and identified, and the length of the millet bristles is predicted based on the identification results.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention provides SNP sites significantly associated with the length trait of millet bristles, and develops molecular markers associated with the length of millet bristles, thereby linking the genomic DNA sequence with the millet bristle length trait, which is beneficial to the establishment of a millet molecular marker-assisted breeding system and can provide direction and basis for more precise positioning and millet breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The millet population structure analysis of Example 1 of the present invention;

[0027] Figure 2 This is the LD attenuation distribution diagram of Example 1 of the present invention. DETAILED DESCRIPTION

[0029] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with its embodiments; it should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0031] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0032] Example 1: Determination of SNP sites and molecular markers associated with millet bristle length

[0033] In this example, 230 millet materials provided by Zhangjiakou Academy of Agricultural Sciences were selected, and the varieties of the millet materials included the following: Xiaofannuo, Sugu, Hongguzi, Dogtail Millet, Huangxu, Longzhuahuang, Xiangyanggu, Huanggu, Dahuanggu, Maomaohuang, Longgu 26, Longgu 30, Longgu 31, Longgu 17, Longgu 18, Longgu 19, Henggu 10, Henggu 11, Henggu 12, Henggu 21 varieties from various provinces across the country, and Liuwahonggu×Henan 4·2SE165. 5·Xiaomaohuang·Xia1f, Chaoxianggu×Selected Dasui 5·2SE Mixed·8father, Liuwahonggu×Henan 4·2SE1655·Xiaomaohuang·Xia1f, Liuwahonggu×Henan 4·2SE1655·Xiaomaohuang·Xia1f hybrid varieties, 230 millet materials were sown in the experimental field of Zhangjiakou Academy of Agricultural Sciences in mid-May 2023. Field tests were adopted, and each millet material was planted in 2 rows, with a row length of 2m, a row spacing of 50cm, and a plant spacing of 3-5cm. According to local routine management, field traits of each material were measured at the heading stage.

[0034] DNA samples were extracted from 230 millet materials (leaves). After the DNA quality inspection was qualified, it was quantitatively and qualitatively checked by NanoDropND-2000, Thermo Scientific, and the DNA integrity was tested by gel electrophoresis. According to the conventional method and its standard process, the experimental samples were amplified, fragmented, precipitated, resuspended, hybridized on the chip, and washed according to the standard process of the chip.

[0035] 1) Original millet chip data processing

[0036] First, the raw data obtained by scanning with the GeneTitan system was imported into the software Affymetrix Power Tools, and the raw data was clustered and genotyped using the software. Finally, the PLINK format data was exported through the Affymetrix Power Tools software for subsequent data analysis. The PLINK format data was further converted into SNP VCF format data using the PLINK program, and the VCF format data was further analyzed.

[0037] 2) Conversion of chip SNP data

[0038] The total SNP VCF files above were screened, and the VCF files of SNPs of heading period traits were obtained according to the number of samples with phenotypes at different periods.

[0039] 3) Sample population structure analysis

[0040] ADMIXTURE program was used to perform principal component analysis to obtain the population clustering of the samples.

[0041] 4) Linkage disequilibrium (LD) analysis

[0042] The linkage disequilibrium coefficient (r2) is used to measure the linkage disequilibrium level between SNP sites on chromosomes. When r2 = 0, it means that the population is in linkage equilibrium or has no LD. The larger the r2, the closer the distance between SNP sites. Generally, when r2 is greater than or equal to 0.8, the two sites are considered to be in linkage disequilibrium. The distance between sites corresponding to the decay of r2 to half is used as the linkage disequilibrium decay distance. The VCFtools software is used to calculate the decay value of linkage disequilibrium, and a nonlinear regression model is used to draw a trend graph of the decay of r2 as the physical distance between SNP sites increases.

[0043] 5) GWAS analysis of chip data and prediction of candidate genes

[0044] Based on a customized SNP chip (Affymetrix chip) with 82,738 loci, SNP loci that appeared in at least 95% of the samples were further screened, and a total of 54,975 SNP loci were obtained at the heading stage. Entering the formal GWAS analysis, the R package GWASpoly analysis process was used to conduct various phenotypic association analyses at different developmental stages. Under the 1-dom and additive modes, the mixed linear Q+K algorithm (population structure + kinship) was used to find genes within 10kb upstream and downstream of the significant SNPs associated with the phenotypic association, and the SNP sites were functionally annotated. The results showed that the significant SNPs associated with the length of millet bristles were most highly associated with chromosome 1 (1_38241023) and chromosome 5 (5_35484548), namely the first SNP site and the second SNP site, respectively. The polymorphism of the first SNP site is T / C, and the polymorphism of the second SNP site is A / G. The additive of the first SNP site is 7.22, and the additive of the second SNP site is 6.02. And by Figure 1 It can be seen that the clustering of ADMIXTURE needs to calculate the CV error (correlation error) under different K values. The trend of K value is to decrease first and then increase ( Figure 1 ), the K value at the beginning of the rise is the number of ancestral groups with the best genetic background. This experiment can be divided into approximately 35 ancestral groups. Figure 2 It can be seen that the LD decay distance of the foxtail millet genome in this embodiment is 9 M. A smaller LD decay distance is beneficial to narrowing the candidate regions for subsequent association analysis and improving the accuracy of the association results.

[0045] Example 2: Based on the above SNP sites, this example develops molecular markers associated with the length of millet bristles, the molecular markers comprising a first molecular marker and a second molecular marker, the first molecular marker comprising the 38241023rd site of the first chromosome of millet, and the second molecular marker comprising the 35484548th site of the fifth chromosome of millet;

[0046] The nucleotide sequence of the first molecular marker is shown in SEQ ID No. 1, and the details are as follows:

[0047] CATCACTGGTTGTTCATCCACTGTTATTCTTACTGCATCCTGAAGTAAATTTCTCTCACACGGTTCATCCC, the 36th base allele variation is C or T;

[0048] The nucleotide sequence of the second molecular marker is shown in SEQ ID No. 2, and is specifically as follows:

[0049] TCTCTGCGGCTTTCAGAGAAGCTGTTGAGTGGCACAGGATCGCGAAGGAGAATTAAACTAGTACAGATGCC, the 36th base allele variation is A or G.

[0050] The above molecular markers can be used to predict the length of millet bristles. Specifically, according to conventional operations, Primer Premier is used to design molecular primers corresponding to the molecular markers (this is a conventional technology and will not be described in detail here). The genome of millet is used as a template, and specifically the DNA of millet leaves can be used as a template. Primers are used for PCR amplification, and the amplified products are sequenced and identified. The length of millet bristles is predicted based on the identification results. If the identification results show that millet carries the first molecular marker and the second molecular marker, and the site corresponding to the 38241023 position of the first chromosome in the first molecular marker shows a C allele variation, and the site corresponding to the 35484548 position of the fifth chromosome in the second molecular marker shows an A allele variation, the length of millet bristles will be longer.

[0051] Example 3: SNP marker verification

[0052] After heading, the length of the bristles of the 230 materials of Example 1 was measured, among which the average length of the bristles of 65 materials was 5 mm or more, the average length of the bristles of 159 materials was 3 mm, the average length of the bristles of 1 material was 2 mm, and the average length of the bristles of 5 materials was 1 mm. According to the detection results of the SNP sites of the 230 materials on the chip, the 38241023rd position on the first chromosome of the 65 materials with an average bristle length of 5 mm or more showed a C allele variation, and the 35484548th position on the fifth chromosome showed an A allele variation.

[0053] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A SNP site associated with millet bristle length, characterized in that: The SNP sites include a first SNP site and a second SNP site. The first SNP site is located at position 38241023 of the first chromosome of millet, and its allele variation is T / C; the second SNP site is located at position 35484548 of the fifth chromosome of millet, and its allele variation is A / G.

2. The SNP locus associated with foxtail millet bristle length according to claim 1, characterized in that: When the first SNP site shows a C allele variation and the second SNP site shows an A allele variation, the bristle length of the millet is relatively long.

3. Use of a substance for detecting the polymorphism or genotype of SNP in a millet genome in any of the following, characterized in that: The applications include: 1) Application in predicting the length of millet bristles; 2) Application in identification or auxiliary identification of millet bristle length traits; 3) Application in related breeding or auxiliary breeding for improving millet bristle length. The SNP sites include a first SNP site and a second SNP site. The first SNP site is located at position 38241023 of the first chromosome of millet, and its allele variation is T / C; the second SNP site is located at position 35484548 of the fifth chromosome of millet, and its allele variation is A / G.

4. A molecular marker associated with foxtail millet bristle length, characterized in that: The molecular markers include a first molecular marker and a second molecular marker, wherein the first molecular marker includes the 38241023rd position of the first chromosome of millet, and the second molecular marker includes the 35484548th position of the fifth chromosome of millet; The nucleotide sequence of the first molecular marker is shown as SEQ ID No.1; The nucleotide sequence of the second molecular marker is shown as SEQ ID No.

2.

5. Use of the molecular marker associated with millet bristle length according to claim 4 in any of the following applications, characterized in that: The applications include: 1) Application in predicting the length of millet bristles; 2) Application in identification or auxiliary identification of millet bristle length traits; 3) Application in related breeding or auxiliary breeding for improving millet bristle length.

6. A method for predicting the length of millet bristles, characterized in that: Using a specific probe or chip for detecting the SNP site described in claim 1, the millet genomic DNA of the prediction object is detected to obtain the base situation of the allele variation site of the SNP site described in claim 1, and predict the length of the millet bristles according to the base situation; Alternatively, a single leaf of millet is used as a DNA template, and primers corresponding to the molecular marker of claim 4 are used for PCR amplification, and the amplified product is sequenced and identified, and the length of the millet bristles is predicted according to the identification result.

Images