Application of reagent for inhibiting binding of EGFR (epidermal growth factor receptor) and MPZL3 protein in preparation of medicine for treating tumor and / or reversing tumor drug resistance

Abstract

The invention provides application of a reagent for inhibiting binding of EGFR and MPZL3 protein in preparation of drugs for treating tumors and / or reversing tumor drug resistance, and belongs to the technical field of biological medicines. By screening the reagent for inhibiting EGFR and MPZL3 protein binding, the result shows that the reagent can significantly inhibit tumor proliferation and overcome tumor drug resistance, so that small molecule drugs screened based on EGFR and MPZL3 binding inhibition can be potentially used for anti-tumor and / or anti-tumor drug resistance clinical treatment, and have wide development prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the use of a reagent for inhibiting the binding between EGFR and MPZL3 protein in the preparation of a drug for treating tumors and / or reversing tumor resistance. Background Art

[0002] Lung cancer has become the malignant tumor with the largest number of affected people in the world. Its overall morbidity and mortality rates have long ranked first among all malignant tumors in the world. According to statistics from the National Cancer Center, in 2022, the number of new cases of lung cancer in China reached 1.0606 million, and the number of deaths reached 733,300, ranking first in the incidence and mortality of all malignant tumors and increasing year by year. The 5-year survival rate of advanced lung cancer is low. Given that the pathogenesis of lung cancer, especially the mechanism of resistance to targeted therapy, has not been fully elucidated, and there is a lack of effective subtype diagnosis and treatment products, it is imperative to strengthen research on the etiology and resistance mechanism of lung cancer and screen efficient diagnostic and treatment monitoring drugs.

[0003] The vast majority of lung cancers are non-small cell lung cancer (NSCLC), among which lung adenocarcinoma (LUAD) is the largest pathological type of lung cancer. In terms of pathogenesis, unlike the occurrence of squamous cell lung carcinoma, which is closely related to persistent smoking behavior, the 2022 ESMO (European Society of Oncology) study reported that lung adenocarcinoma is more likely to be caused by the combined effects of genetic susceptibility and dust exposure. In terms of genetics, common driver genes for lung adenocarcinoma in Asian populations include EGFR, TP53, KRAS, KEAP1, STK11, EML4-ALK and HER2, among which EGFR mutations have the highest rate.

[0004] EGFR (Epidermal Growth Factor Receptor) is a broad-spectrum anti-tumor target that was discovered the earliest and studied the most intensively. Studies have shown that EGFR mutation, amplification or overexpression can cause a variety of tumors such as lung cancer. EGFR is a receptor for epithelial growth factor (EGF) cell proliferation and signal transduction, and one of the four members of the receptor tyrosine kinase (RTK) HER family, which includes EGFR (ErbB-1), HER2 (ErbB-2), Her (ErbB-3) and Her4 (ErbB-4). The human EGFR gene is located in the p13-q22 region of chromosome 7, with a total length of 200kb and 28 exons. The protein it encodes has a molecular weight of 170KDa and is a transmembrane glycoprotein. EGFR is widely distributed on the cell surfaces of mammalian epithelial cells, fibroblasts, glial cells, keratinocytes, etc., and the mediated signal pathways play an important role in physiological processes such as cell growth, proliferation and differentiation.

[0005] Based on the structure and activation mechanism of EGFR, the anti-NSCLC drugs targeting EGFR are mainly divided into two categories: monoclonal antibodies and small molecule kinase inhibitors. Among them, small molecule targeted drugs are mainly EGFR-TKI (EGFR tyrosine kinase inhibitors), and the mainstream drugs have developed to the third generation: the first generation erlotinib, gefitinib, etc., targeting the star driver mutations of EGFR, namely the deletion mutation of exon 19 of EGFR (delE746-A750) and the point mutation of exon 21 (L858R); the second generation dacomitinib, afatinib, etc., because the efficacy has not been significantly improved compared with the first generation of drugs and the side effects are large, so they are not widely used in clinical practice; the third generation osimertinib (AZD9291), ametinib, ametinib, etc., are currently used as the first choice for selective treatment of EGFR sensitive mutations and T790M drug-resistant mutations NSCLC, using ATP analogs to block the phosphorylation of the intracellular domain to block the activation of the signaling pathway. The above TKI targeted therapies will become resistant after a "honeymoon period". Each generation of EGFR-TKI resistance has different mechanisms: the most common cause of resistance to first- and second-generation TKIs is T790M mutation (accounting for 50%); bypass amplification mainly based on MET and HER2; whether osimertinib is used as first-line or second-line, the drug resistance mechanism is mostly: MET amplification and C797S mutation. In addition, traditional chemotherapy, immunotherapy alone, and immunotherapy combined with chemotherapy and / or anti-angiogenic therapy are widely used in clinical research, but limited efficacy and safety issues have led to poor results.

[0006] Although third-generation TKIs such as osimertinib can partially solve (about 60%) the resistance problem of first- and second-generation TKIs, resistance still occurs, and the mechanism is more complicated. Studies have shown that the resistance mechanism of third-generation TKIs can be generally divided into EGFR-dependent and EGFR-independent resistance. EGFR-dependent resistance refers to changes in the EGFR gene or protein itself (EGFR amplification, triple mutation, overexpression), which makes EGFR-TKIs unable to target and kill tumor cells. Among them, the incidence of C797S mutation is relatively low, accounting for only about 7% of all resistance mechanisms. EGFR-independent resistance is due to abnormal activation of carcinogenic pathways other than EGFR (histological transformation, bypass activation and downstream pathway changes), thereby achieving escape. Among them, MET amplification and MET protein overexpression are the most common resistance mechanisms in the bypass activation pathway, accounting for 15% of the resistance mechanisms. The MET gene, full name mesenchymal epithelial transition factor, encodes a synthetic protein c-Met, which is a receptor tyrosine kinase that binds to hepatocyte growth factor (HGF). HGF binds to the Sema domain of c-Met, causing dimerization and activation of c-Met, which then phosphorylates the tyrosine residues of multiple downstream proteins (such as Y1349 and Y1356), activating numerous downstream signaling pathways, such as PI3K-Akt, Ras-MAPK, STAT, and Wnt / β-catenin, thereby promoting cell proliferation, cell growth, cell migration, vascular invasion, and angiogenesis.

[0007] At present, the treatment of EGFR-TKI-resistant NSCLC is in a diversified and hot development stage, among which the fourth-generation TKI, ADC antibodies and other drugs have attracted much attention. ADC is a type of targeted biological agent that connects cytotoxic drugs to monoclonal antibodies through linkers. It uses monoclonal antibodies as targeting carriers to efficiently transport small molecule cytotoxic drugs to target tumor cells. Dual-target treatment schemes based on ADC bispecific antibody drugs have developed rapidly in the field of TKI-resistant treatment of lung cancer. At present, the main targets of ADC drugs include HER2, TROP2, c-Met, HER3, CEACMA5, etc. For example, the fourth-generation drug BL-B01D1, as the world's first EGFR / HER3 dual-antibody ADC to enter clinical trials, has performed well in the treatment of advanced NSCLC. Based on the principle of dual blocking of EGFR and c-Met pathways, the treatment method of using MET-TKI combined with EGFR-TKI has been initially explored in many clinical studies such as TATTON, SAVANNAH, and NCT01610336. This combination scheme has also become a potential effective choice for patients with MET amplification after EGFR-TKI resistance in lung cancer. Therefore, it is of great clinical significance to find drugs that activate EGFR signaling pathways and bypass pathways such as MET and screen strategies that can simultaneously block dual pathways.

[0008] MPZL3 belongs to the lipoprotein family and is a 235 amino acid single-channel type I membrane protein that plays an important role in cell differentiation, lipid and energy metabolism, and immune regulation. MPZL3 contains an Ig-like V-type (immunoglobulin-like) domain and is highly expressed in most tumors (such as lung adenocarcinoma cells). Summary of the invention

[0009] In view of this, the object of the present invention is to provide an agent for inhibiting the binding between EGFR and MPZL3 protein for use in the preparation of drugs for treating tumors and / or reversing tumor resistance.

[0010] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0011] The present invention provides an application of a reagent for inhibiting the binding between EGFR and MPZL3 protein, comprising at least one of the following:

[0012] (1) Application in the preparation of drugs for treating tumors;

[0013] (2) Application in the preparation of drugs for reversing tumor resistance.

[0014] Preferably, the tumor comprises lung cancer.

[0015] Preferably, the lung cancer comprises lung adenocarcinoma.

[0016] Preferably, the agent comprises saquinavir.

[0017] Preferably, the drug has as its only active ingredient an agent that inhibits the binding between EGFR and MPZL3 protein.

[0018] The present invention also provides a method for screening drugs for treating tumors and / or reversing tumor resistance, comprising the following steps:

[0019] (1) The candidate drug interacting with the receptor cells containing EGFR protein and MPZL3 protein is used as the test group, and the medium without any drug interacting with the receptor cells containing EGFR protein and MPZL3 protein is set as the control group;

[0020] (2) When the binding ability of EGFR protein and MPZL3 protein in the test group is weakened compared with the control group, and tumor proliferation is inhibited, the candidate drug can be determined as a drug for treating tumors and / or reversing tumor resistance.

[0021] In the above method, the recipient cells include HEK293 cells.

[0022] In the above method, the method for preparing the receptor cells containing EGFR protein and MPZL3 protein includes: transfecting the EGFR protein plasmid and the MPZL3 protein plasmid into the receptor cells.

[0023] In the above method, the tumor comprises lung cancer, such as lung adenocarcinoma.

[0024] The present invention also provides a drug for treating tumors and / or reversing tumor resistance, wherein the drug comprises an agent for inhibiting the binding between EGFR and MPZL3 protein and a pharmaceutically acceptable excipient.

[0025] In the above-mentioned drug for treating tumors and / or reversing tumor resistance, the agent that inhibits the binding between EGFR and MPZL3 protein includes saquinavir.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention provides an application of an agent for inhibiting the binding of EGFR to MPZL3 protein in the preparation of a drug for treating tumors and / or reversing tumor drug resistance. The present invention screens an agent for inhibiting the binding of EGFR to MPZL3 protein, and the result shows that the agent can significantly inhibit tumor proliferation. Therefore, the small molecule drugs screened based on the inhibition of the binding of EGFR to MPZL3 can be potentially used in the clinical treatment of anti-tumor and / or anti-tumor drug resistance, and have broad development prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The results of WB detection of the expression levels of exogenous MPZL3, P-EGFR and total EGFR in different lung adenocarcinoma cells;

[0029] Figure 2 The results of the drug sensitivity of osimertinib and cetuximab to different lung adenocarcinoma cells are shown in Figure 1. A shows the drug sensitivity of osimertinib to different lung adenocarcinoma cells, and B shows the drug sensitivity of cetuximab to different lung adenocarcinoma cells. From left to right, the first column shows the results of H520 cells, the second column shows the results of H1975 cells, and the third column shows the results of EGFR (T790M / L858R / C797S) cells, i.e., EGFR-3M cells.

[0030] Figure 3 A is a schematic diagram of EGFR and MPZL3 protein molecules, and B is a molecular docking diagram of the binding of EGFR and MPZL3 proteins;

[0031] Figure 4 This is a schematic diagram of the target of saquinavir as a small molecule drug;

[0032] Figure 5The results of immunoprecipitation experiments, A is the result of the ability of MPZL3 protein to bind to EGFR after the mutation of the Glu33Ala (E33A) site; B is the effect of two small molecule drugs, Saquinavir (SQV) and Cefoperazone (Cef), on the binding between EGFR and MPZL3;

[0033] Figure 6 The results of in vitro antitumor activity determination of saquinavir and cefoperazone, A is the results of cell CCK8 proliferation assay to detect the antitumor activity of saquinavir and cefoperazone, B is the results of saquinavir and cefoperazone inhibition of tumor colony formation assay, C is the results of EdU assay to detect the effects of saquinavir and cefoperazone on tumor cell proliferation;

[0034] Figure 7 This is the tumor morphology after saquinavir treatment;

[0035] Figure 8 Results of in vivo tumor weight after saquinavir treatment. DETAILED DESCRIPTION

[0036] The present invention provides an application of a reagent for inhibiting the binding between EGFR and MPZL3 protein, comprising at least one of the following:

[0037] (1) Application in the preparation of drugs for treating tumors;

[0038] (2) Application in the preparation of drugs for reversing tumor resistance.

[0039] The present invention has been found that by screening drugs that inhibit the binding of EGFR and MPZL3 proteins, it has the effect of treating tumors and / or reversing tumor resistance. The present invention is based on computer virtual screening of the molecular docking model of EGFR and MPZL3 proteins, and performs drug screening on the binding sites. The results show that saquinavir has significant protein affinity for MPZL3 and EGFR binding sites, can effectively inhibit the binding of MPZL3 and EGFR proteins, inhibit the proliferation of tumor cells, and has good anti-tumor activity, such as EGFR-TKI resistance. In the present invention, the tumor includes lung cancer, such as lung adenocarcinoma. Saquinavir is a mature drug, and its physicochemical parameters, pharmacokinetic and safety data are relatively complete. Its application and development as a drug for treating tumors and / or reversing tumor resistance can greatly save research and development cycles and costs, has less toxicity to normal cells, and has good selectivity. The present invention has a new expansion of its clinical application.

[0040] The saquinavir has a structure shown in Formula I:

[0041]

[0042] In the present invention, the drug can be an agent that inhibits the binding of EGFR and MPZL3 protein as an active ingredient in combination with other active ingredients for treating tumors and / or reversing tumor resistance to treat tumors and / or reverse tumor resistance. It can also be an agent that inhibits the binding of EGFR and MPZL3 protein as the only active ingredient to treat tumors and / or reverse tumor resistance.

[0043] The present invention also provides a method for screening drugs for treating tumors and / or reversing tumor resistance, comprising the following steps:

[0044] (1) The candidate drug interacting with the receptor cells containing EGFR protein and MPZL3 protein is used as the test group, and the medium without any drug interacting with the receptor cells containing EGFR protein and MPZL3 protein is set as the control group;

[0045] (2) When the binding ability of EGFR protein and MPZL3 protein in the test group is weakened compared with the control group, and tumor proliferation is inhibited, the candidate drug can be determined as a drug for treating tumors and / or reversing tumor resistance.

[0046] In the above method, the receptor cells include HEK293 cells. The preparation method of the receptor cells containing EGFR protein and MPZL3 protein includes: transfecting the EGFR protein plasmid and MPZL3 protein plasmid into the receptor cells. The preparation method of the EGFR protein plasmid and the MPZL3 protein plasmid includes linearizing the GV492 vector using BamHI / AgeI to obtain a linearized GV492 vector, introducing BamHI / AgeI endonuclease sites at both ends of the EGFR gene sequence and the MPZL3 gene sequence, and then connecting them to the linearized GV492 vector to obtain the EGFR protein plasmid and the MPZL3 protein plasmid. The sequence of the EGFR protein is Gene ID: 1956NP_005219.2; the Gene ID of the MPZL3 protein sequence is Gene ID: 196264NP_938016.1. The tumor includes lung cancer, such as lung adenocarcinoma.

[0047] The present invention also provides a drug for treating tumors and / or reversing tumor resistance, wherein the drug comprises an agent for inhibiting the binding between EGFR and MPZL3 protein and a pharmaceutically acceptable excipient.

[0048] In the above-mentioned drug for treating tumors and / or reversing tumor resistance, the agent for inhibiting the binding of EGFR to MPZL3 protein includes saquinavir, and the mass percentage of saquinavir in the drug is preferably 20-90%, more preferably 30-70%. The excipients include powders, tablets, solutions, granules, pellets, pills or powders. The excipients include one or more of excipients, lubricants, preservatives, diluents, sweeteners, adhesives, colorants, cosolvents and surfactants.

[0049] In the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0050] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0051] In the following examples, osimertinib was purchased from Selleck. Cetuximab was purchased from Selleck.

[0052] Preparation of the cell culture medium: 500 mL of RPMI-1640 culture medium was divided into 45 mL portions in a clean bench, 5 mL of fetal bovine serum and 1% penicillin and streptomycin mixed antibiotics were added to each portion, and the portions were stored in a 4° C. refrigerator for future use.

[0053] Example 1

[0054] 1. Construction of lung adenocarcinoma H520 cells overexpressing MPZL3 (denoted as OE):

[0055] Experimental Materials

[0056] (S1) Cell line 293T, packaging cells of lentivirus, is an anchorage-dependent epithelial cell, and the growth medium is DMEM (containing 10% FBS). The adherent cells are cultured, grown, and proliferated to form a monolayer of cells. Lung adenocarcinoma H520 cells are EGFR protein-deficient cells, used for transfection of MPZL3 overexpressing lentivirus, are anchorage-dependent epithelial cells, and the growth medium is 1640 (containing 10% FBS). The adherent cells are cultured, grown, and proliferated to form a monolayer of cells.

[0057] (S2) Virus vector plasmids GV492, pHelper 1.0, and pHelper 2.0 were purchased from Shanghai Jikai Gene Chemistry Technology Co., Ltd. GV492-MPZL3 plasmid construction

[0058] (1) Using GV492 plasmid as a vector, the MPZL3 sequence (Gene ID of the MPZL3 sequence: 196264NP_938016.1) was amplified using Takara's high-fidelity PCR amplification kit, and endonuclease (BamHI and AgeI) sites were introduced at both ends. (2) Purification of target fragment: The PCR product was digested with BamHI and AgeI, and the digested product was recovered using the Kangwei Century Kit. (3) Vector digestion and recovery: The GV492 plasmid was digested with BamHI and AgeI, and the plasmid was recovered using the Kangwei Century Kit after 1% agarose gel electrophoresis. (4) Ligation: The PCR digestion product and the plasmid digestion product were ligated with Takara's T4 DNA ligase at 4°C overnight, transformed into E. coli Dh5α competent cells, and then spread on LB solid culture medium containing 100 μg / mL ampicillin, and cultured at 37°C overnight. (5) Identification of transformants: Pick a single colony, culture it overnight in LB liquid medium (containing 100 μg / mL ampicillin), and screen the positive clones by PCR. Use a plasmid extraction kit to extract the positive plasmid GV492 / MPZL3; the forward primer of PCR is: GAAGTCATCTATTGAGGTTT (SEQ ID NO.1), and the reverse primer is: CCTTAGTCCTTATCATCGTC (SEQ ID NO.2). (6) Plasmid sequencing identification: Send the positive plasmid to Shanghai Biotech for sequencing. The sequencing results are compared by software to verify the correctness of the gene cloning.

[0059] GV492-MPZL3 lentiviral construction

[0060] (1) HEK293T cell plating: Discard the medium of the 293T cells of stable passage, add 3 mL PBS to wash once; add about 500 μL 0.05% TrpSin-EDTA to rinse for 20 seconds and then discard; dry digest for 3 minutes and observe the cells shrink under the microscope, add 2 mL of complete medium containing 10% FBS; transfer to a 15 mL centrifuge tube after washing by pipetting, and centrifuge at 800 rpm / min for 5 minutes; add 2 mL of complete medium to resuspend, and pipette repeatedly until homogenous. homogenous suspension; add the cell suspension to the 6-well plate and add the culture medium to 2mL of the culture system, mix well and move to a carbon dioxide incubator for culture; (2) 24 hours later, the fusion degree of 293T cells reaches about 70%, and each plasmid contains two six-well plates of viruses (GV492-Mock, GV492-MPZL3) for a total of 4 wells; replace with serum-free culture medium 2 hours before transfection; (3) add the prepared DNA solutions (20μg of GV492 vector plasmid, 15μg of pHelper 1.0 vector plasmid, 10μg of pHelper 2.0 vector plasmid) to a sterile centrifuge tube, add the corresponding volume of Jikai's transfection reagent and mix evenly, adjust the total volume to 1mL, and incubate at room temperature for 15 minutes; (4) slowly add the mixed solution dropwise to the culture medium of 293T cells, mix well, and incubate at 37°C, 5% CO 2 (5) After 6 h of culture, discard the culture medium containing the transfection mixture, add 10 mL of PBS solution to wash once, gently shake the culture dish to wash the remaining transfection mixture and then discard; (6) Slowly add 20 mL of cell culture medium containing 10% serum and incubate at 37°C and 5% CO 2 Continue to culture in the incubator for 48-72 hours. (7) According to the cell status, collect the 293T cell supernatant 48 hours after transfection (transfection can be counted from 0 hours); (8) Centrifuge at 4000g for 10 minutes at 4°C to remove cell debris; (9) Filter the supernatant with a 0.45μm filter into a 40mL ultracentrifuge tube: (10) Balance the samples separately, put the ultracentrifuge tubes with virus supernatant into the Beckman ultracentrifuge one by one, set the centrifugation parameters to 25000rpm, the centrifugation time to 2h, and the centrifugation temperature to 4°C; (11) After the centrifugation is completed, discard the supernatant, try to remove the liquid remaining on the tube wall, add virus preservation solution (can be replaced by PBS or cell culture medium), and gently blow and resuspend; (12) After sufficient dissolution, centrifuge at high speed at 10000rpm for 5 minutes, and take the supernatant and package it as required. After preparing the sample for testing, store it in a -80°C low-temperature refrigerator.

[0061] GV492-MPZL3 lentivirus infection to construct MPZL3 overexpression lung cancer cell line

[0062] (1) Lung cancer cell seeding: The day before lentiviral infection, lung cancer cells were seeded. The medium of the stably passaged lung cancer cells (H520) was discarded and 3 mL of PBS was added for washing. About 500 μL of 0.05% Trvpsin EDTA was added for 20 seconds and then discarded. After dry digestion for 3 minutes, the cells were observed to be rounded under the microscope and 2 mL of complete medium containing 10% FBS was added. After pipetting and rinsing, the cells were transferred to a 15 mL centrifuge tube and centrifuged at 800 rpm / min for 5 minutes. 2 mL of complete medium was added for resuspending and pipetting repeatedly until a uniform suspension was obtained. The cell suspension was added to a 6-well plate so that the cell confluence could reach 30%-50% on the next day. The medium was supplemented to 2 mL of the culture system, and the mixture was transferred to a carbon dioxide incubator for culture. (2) Infection: The original medium in the well plate was discarded, and 1 mL of complete medium and 1 mL of lentiviral venom (GV502-MPZL3, GV502-Mock) were added to the well plate. After gentle mixing, the well plate was transferred to an incubator at 37°C and 5% CO 2 Culture; (3) Medium change: 24 hours after infection, discard the culture medium in the well plate, replace it with fresh complete culture medium, and move the well plate to a carbon dioxide incubator for continued culture; (4) Antibiotic screening: 48 hours after infection, replace the culture medium in the well plate with complete culture medium containing 2 μg / mL of puromvcin, move the well plate to a carbon dioxide incubator for continued culture, and stop antibiotic screening after all cells in the blank control group die, indicating that the overexpression stable strain has been constructed. Replace the cells in the experimental group and the negative control group with complete culture medium without antibiotics; (5) After the screened cells are amplified, subsequent experiments can be carried out.

[0063] 2. Construction of MPZL3 knockdown lung adenocarcinoma H1975 cells (denoted as KD):

[0064] siRNA transfection

[0065] (1) Preparation of siRNA working solution: siRNA dry powder was purchased from Suzhou Jima Biotechnology Co., Ltd., siMPZL3 sequence: TTGGAAATGTATACAAAUUTT (SEQ ID NO.3). The tube containing siRNA dry powder was centrifuged at 2000g in a precooled centrifuge at 4°C for 5 minutes to centrifuge the siRNA dry powder to the bottom of the tube; 125 μL of nuclease-free water was added to 1OD siRNA dry powder, and gently pipetted with a pipette to prepare a 20pmol working solution, which can be stored in a -20°C refrigerator for a short period of time; (2) Cell plate: Stably cultured lung adenocarcinoma H1975 cells were cultured, the culture medium was discarded from the culture dish, and 3mL PBS was added to wash once; about 500 μL 0.05% Trvpsin-EDTA was added to rinse for 20 seconds and then discarded; dry digested for 3 minutes and observed under a microscope Observe the cells shrinking, add 2mL of complete medium containing 10% FBS; transfer to a 15mL centrifuge tube after washing by pipetting, and centrifuge at 800rpm / min for 5min; resuspend in 2mL of complete medium, and pipette repeatedly until a uniform suspension is obtained; add the cell suspension to a 6-well plate, add the medium to a 2mL culture system, mix well, and transfer to a carbon dioxide incubator for culture; (3) When the H1975 cells in the 6-well plate have grown to a confluency of about 70%, perform siRNA transfection, and prepare the transfection system in a sterile 1.5mL EP tube: 1) Add 3.75μL of transfection reagent Lipofectamine to tube A TM 3000 and 125μL serum-free 1640 medium; 2) Add 5μL siRNA working solution and 125μL serum-free 1640 medium to tube B; 3) Mix the solutions in A and B and let stand at room temperature for 5 minutes; 4) Then mix the solutions in tubes A and B, mix thoroughly and let stand at room temperature for 15 minutes to prepare the transfection working solution; 5) Discard the original culture medium in the 6-well plate and add 1mL complete culture medium again; 6) Add the transfection working solution prepared in 4) to the 6-well plate; 7) After mixing, move to a carbon dioxide incubator for continued culture. Subsequent experiments can be carried out after 48 hours.

[0066] 3. Construction of lung adenocarcinoma H520 cells overexpressing EGFR and knocking down MPZL3 (denoted as EGFR-3M+KD)

[0067] Experimental Materials

[0068] The cell line lung adenocarcinoma H520 cells are EGFR protein-deficient cells, used for transfection of EGFR (T790M / L858R / C797S) 3 mutant plasmids, and are anchorage-dependent epithelial-like cells. The growth medium is 1640 (containing 10% FBS). The adherent cells grow and proliferate to form a monolayer of cells after culture.

[0069] The viral vector GV141 was purchased from Shanghai GeneChem Technology Co., Ltd.

[0070] 3.1 EGFR (T790M / L858R / C797S) plasmid construction

[0071] (1) Using GV141 plasmid as a vector, Takara's high-fidelity PCR amplification kit was used to amplify the 3-site mutated EGFR sequence (the 3-site mutated EGFR sequence is the EGFR sequence Gene ID: 1956NP_005219.2, where T at position 790 mutated to M, L at position 858 mutated to R, and C at position 797 mutated to S), and endonuclease sites (XhoI and KpnI) were introduced at both ends. (2) Purification of target fragment: The PCR product was digested with XhoI and KpnI, and the digested product was recovered using the Conway kit. (3) Vector digestion and recovery: GV141 plasmid was digested with XhoI and KpnI, and the plasmid was recovered using the Conway kit after 1% agarose gel electrophoresis. (4) Ligation: The PCR digestion product and the plasmid digestion product were ligated with Takara's T4 DNA ligase at 4°C overnight, transformed into E. coli Dh5α competent cells, and then spread on LB solid medium containing 100 μg / mL ampicillin, and cultured at 37°C overnight. (5) Identification of transformants: Pick a single colony, culture it in LB liquid medium (containing 100 μg / mL ampicillin) overnight, and screen the positive clones by PCR. The positive plasmid GV141-EGFR (T790M / L858R / C797S) was extracted with a plasmid extraction kit; wherein, the forward primer of PCR is: GAGGACAGCATAGACGACA (SEQ ID NO.4), and the reverse primer is: TTATTAGGAAAGGACAGTGGG (SEQ ID NO.5).

[0072] (6) Plasmid sequencing identification: The positive plasmids were sent to Shanghai Bioengineering for sequencing. The sequencing results were compared by software to verify the correctness of the gene cloning.

[0073] 3.2 Plasmid transfection and transfer of siMPZL3

[0074] The GV141-EGFR (T790M / L858R / C797S) plasmid was transfected into H520 cells by liposome transfection reagent (purchased from Life). After 48 hours of transfection, exogenously constructed EGFR (T790M / L858R / C797S) 3 mutant (EGFR-3M) cells were obtained. The cells were subcultured and plated into six-well plates. When the H520 cells in the six-well plates were cultured to a confluence of about 70%, siRNA transfection was performed. The transfection system was prepared in a sterile 1.5 mL EP tube: 1) 3.75 μL of transfection reagent LipofectamineTM3000 and 125 μL of serum-free 1640 culture medium were added to tube A; 2) 5 μL of siRNA working solution and 125 μL of serum-free 1640 culture medium were added to tube B; 3) The solutions in A and B were mixed and allowed to stand at room temperature for 5 minutes;

[0075] 4) Then, mix the solutions in tubes A and B, mix thoroughly and let stand at room temperature for 15 minutes to prepare the transfection working solution; 5) Discard the original culture medium in the 6-well plate and add 1 mL of complete culture medium again; 6) Add the transfection working solution prepared in 4) to the 6-well plate; 7) After mixing, move to a carbon dioxide incubator for continued culture. Subsequent experiments can be carried out after 48 hours.

[0076] Protein samples were collected from lung adenocarcinoma H520 (denoted as Mock and OE), lung adenocarcinoma H1975 (denoted as NC and KD), EGFR-3M and EGFR-3M+KD, and proteins were detected by Western blot to detect exogenous MPZL3, phosphorylated (1068) EGFR (P-EGFR) and total EGFR in each cell. GAPDH was used as an internal reference. The results are shown in Figure 1 .

[0077] Figure 1 The results showed that OE MPZL3 cells in H520, KD MPZL3 cells in H1975, and EGFR-3M+KD cells in H520 were successfully constructed. Compared with H520-Mock, EGFR expression was increased in lung adenocarcinoma cells overexpressing MPZL3; compared with H1975-NC, EGFR expression was also reduced in lung adenocarcinoma H1975 cells (KD) with MPZL3 knockdown; compared with EGFR-3M cells, EGFR expression was also reduced in EGFR-3M+KD cells, so MPZL3 can significantly promote the expression of EGFR and activate its activity.

[0078] Example 2

[0079] Effects of osimertinib and cetuximab on the drug sensitivity of different lung adenocarcinoma cells.

[0080] 2.1 CCK8 assay to determine cell proliferation inhibition rate

[0081] The lung adenocarcinoma H520 cells (Mock), MPZL3-overexpressing lung adenocarcinoma H520 cells (OE), lung adenocarcinoma H1975 cells (denoted as H1975 NC), MPZL3-knockdown lung adenocarcinoma H1975 cells (denoted as H1975 KD), EGFR (T790M / L858R / C797S)-overexpressing lung adenocarcinoma H520 cells (denoted as EGFR-3M NC), and MPZL3-knockdown EGFR-3M cells (denoted as EGFR-3M+KD) prepared above were taken in the logarithmic growth phase, and 100 μL of culture medium was added to each well of a 96-well plate. Approximately 2×10 3 Cells were placed in a cell culture incubator for 24 hours to allow the cells in the 96-well plate to adhere to the wall. Different concentrations of osimertinib (0.001μM, 0.01μM, 0.1μM, 1μM, 10μM) and cetuximab (2.5μg / mL, 5μg / mL, 10μg / mL, 20μg / mL, 40μg / mL) were added to the experimental group, and the culture medium was used as a blank group. After 24 hours of action, 10μL of CCK-8 solution was added to each well, and after incubation for 2 hours, the OD value at a wavelength of 450nm was detected by an enzyme reader, and finally the cell inhibition rate after drug treatment was calculated by GraphPadPrism 7.0.

[0082] The results are as follows Figure 2 As shown in Table 1, in H520 cells, MPZL3 did not affect the drug sensitivity of osimertinib and cetuximab. In H1975 and EGFR-3M cells, knocking down MPZL3 promoted the sensitivity of osimertinib and cetuximab. This indicates that MPZL3 can inhibit the drug sensitivity of EGFR-resistant cells.

[0083] Table 1 In vitro cytotoxicity half inhibition rate of osimertinib and cetuximab on different cells (n=3)

[0084]

[0085] Note: *P≤0.05 and **P≤0.01 are the Student's t test results of the drug group relative to the control group. 50 Half maximal inhibitory concentration refers to the concentration at which the drug inhibits biological activity by 50% under certain conditions.

[0086] Example 3

[0087] 3.1 Docking of MPZL3 to EGFR protein

[0088] The sequence of the MPZL3 protein used in this study is Gene ID: 196264NP_938016.1;

[0089] Gene ID of EGFR protein sequence: 1956NP_005219.2.

[0090] The protein EGFR structure used in this embodiment uses the full name structure predicted by alphafold2.3.2, and MPZL3 also uses Alphafold2.3.2 prediction model. Use H++3 online server to carry out protonation treatment under neutral conditions. Then use UCSF Chimera software to optimize the protein structure, and distribute Amber14SB charge. Then use professional macromolecular docking tool HDOCK to carry out molecular docking, use experience-based iterative scoring function ITScorePP to carry out molecular docking and configuration scoring, score is negative number to indicate molecular binding, the larger the absolute value, the stronger the binding ability. The maximum output configuration quantity of docking is set to 100, the top 10 configurations are scored, and confidence score (Confidence score) is used to carry out credibility analysis, greater than 0.7 indicates that the docking score is reliable, and the possibility of molecular binding is large, and less than 0.7 indicates that the docking score credibility is low, and the possibility of binding is small, as shown in Table 2. The configurations with the highest docking scores and confidence scores were selected from the docked configurations for subsequent analysis. PyMOL2.04 was used for 3D mapping analysis, and the academic version of Maestro was used for 2D interaction analysis and statistical interaction type, distance and number.

[0091] Table 2 Docking scores (kcal / mol) and confidence ranking

[0092] Ranking Docking score Confidence score 1 -319.77 0.9424 2 -295.94 0.9104 3 -264.29 0.9077 4 -263.36 0.9061 5 -261.93 0.9037 6 -257.46 0.8956 7 -255.23 0.8913 8 -252.03 0.885 9 -251.64 0.8842 10 -248.83 0.8783

[0093] like Figure 3 As shown in A, MPZL3 protein and EGFR protein can bind well, and EGFR binds to MPZL3 protein through the extracellular domain. Moreover, there are many amino acid pairs involved in the contact interface between the two.

[0094] As shown in Table 3 , two salt bridges and two hydrogen bonds were formed between the two proteins, and van der Waals contacts and hydrophobic contacts were formed between multiple amino acid pairs in close contact.

[0095] Table 3 Amino acid pairs of EGFR and MPZL3 binding interface

[0096]

[0097]

[0098] like Figure 3As shown in B, Lys253 of EGFR forms a salt bridge with Glu33 of MPZL3 at a distance of 2.3; Asp388 of EGFR forms a hydrogen bond with Phe152 of MPZL3 at a distance of 1.7; Lys593 of EGFR forms a salt bridge and hydrogen bond with Asp67 of MPZL3 at a distance of 1.2.

[0099] (2) In this embodiment, screening was performed based on the targeted site Glu33. The screening library used was derived from FDA-approved drug molecules downloaded from the ZINC20 database. The research screening library contained 1,800 drug molecules and 1,671 screening data were successfully obtained. Then, saquinavir was screened based on the docking score sorting. Saquinavir is an antiretroviral drug of the protease inhibitor class.

[0100] like Figure 4 As shown, saquinavir can bind to MPZL3, form hydrogen bonds with Thr78, Thr69, and Ser127, form polar van der Waals contacts with His77, Ser76, and Arg71, and form hydrophobic contacts with Ala129, Ile140, and Met142.

[0101] (3) EGFR-GFP, MPZL3-Flag and MPZL3-E33A-Flag plasmids were transfected into HEK293 cells using liposome transfection reagent. After 24 hours of transfection, 10 μM MG132 was added and treated for 4 hours. After collecting the protein, Anti-GFP-tagmAb-Magnetic Beads (purchased from MBL) or Anti-DDDDK-tagmAb-agnetic Beads (purchased from MBL) were added. After overnight at 4°C, the protein on the magnetic beads was collected and the expression of each protein was detected by Western blot.

[0102] Among them, the GV492 / Flag-MPZL3 (also known as MPZL3-Flag plasmid) and GV492 / Flag-MPZL-E33A vector (also known as MPZL3-E33A-Flag plasmid) were constructed by the following steps: the commercial GV492 vector was linearized using BamHI / AgeI to obtain a linearized GV492 vector, Shanghai JiKai Gene Chemistry Technology was commissioned to chemically synthesize the MPZL3 and MPZL3-E33A gene sequences and BamHI / AgeI endonuclease sites were introduced at both ends of the sequences, the synthesized target sequence was connected to the linearized GV492 vector, and the recombinant clones were selected for enzyme cutting and sequencing identification to obtain GV492 / Flag-MPZL3 and GV492 / Flag-MPZL-E33A vectors.

[0103] The construction of the GV230 / GFP-EGFR vector includes: connecting the synthetic EGFR gene sequence with the linearized GV230 vector, selecting the recombinant clones for restriction digestion and sequencing identification, and obtaining the GV230 / GFP-EGFR vector (also called EGFR-GFP plasmid).

[0104] Among them, the MPZL3-E33A sequence is the MPZL3 sequence with Gene ID: 196264NP_938016.1, in which the 33rd position E is mutated to A.

[0105] Figure 5 The results of A in Figure 1 show that after the MPZL3 protein E33A site mutation, its ability to bind to EGFR is weakened.

[0106] Furthermore, immunoprecipitation experiments were used to determine the effects of two small molecule drugs, saquinavir and cefoperazone, on the binding of EGFR and MPZL3.

[0107] The EGFR-GFP plasmid and MPZL3-Flag plasmid prepared above were transfected into HEK293 cells by liposome transfection reagent, and 20 μM saquinavir and 100 μM cefoperazone were added, and the cell lysate was collected after 24 hours of treatment. Anti-DDDDK-tag mAb-agnetic Beads were incubated with cell lysate at 4°C overnight, and the proteins on the magnetic beads were collected and the expression of each protein was detected by Western blot.

[0108] Figure 5 The results in B show that saquinavir can significantly inhibit the binding of EGFR and MPZL3, but cefoperazone cannot inhibit the binding of EGFR and MPZL3.

[0109] Example 4

[0110] 4.1 Saquinavir has an in vitro inhibitory effect on tumor proliferation

[0111] The in vitro antitumor activity of saquinavir (SQV) and cefoperazone (Cef) was determined using an in vitro cell proliferation assay: H1975 lung adenocarcinoma cells in a good logarithmic growth phase were cultured at 1×10 3 The cells were densely seeded in a 96-well culture plate. After H1975 cells adhered to the wall, medium without any drugs (denoted as NC group), 20 μM saquinavir (denoted as SQV group) and 100 μM cefoperazone (denoted as Cef group) were added and cultured for 24, 48, 72, 96 and 120 h. Then, 10 μL CCK-8 solution was added to each well of each group. After incubation for 2 h, the OD value at a wavelength of 450 nm was detected by a microplate reader. Finally, the cell proliferation rate after drug treatment was calculated using GraphPadPrism 7.0.

[0112] The results are as follows Figure 6 As shown in A, saquinavir can inhibit the proliferation of H1975 cells, while cefoperazone has no significant inhibitory effect on the proliferation of H1975 cells.

[0113] 4.2 1000 H1975 cells were seeded in a six-well plate. After adherence, each well was treated with 20 μM saquinavir and 100 μM cefoperazone for 14 days. The cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet and photographed using an inverted microscope.

[0114] The results are as follows Figure 6 As shown in B, saquinavir can inhibit the colony formation of H1975 cells, while cefoperazone cannot inhibit the colony formation of H1975 cells.

[0115] 4.3H1975 cells were cultured at 1.5×10 4 Each slide was inoculated with cells in a 24-well plate, and each well was treated with 20 μM saquinavir and 100 μM cefoperazone, respectively. After culturing for 24 h, 10 μM Edu medium was added, and the cells were removed and fixed with 4% paraformaldehyde for 20 min, and then incubated with 0.5% TritonX-100-PBS at room temperature for 20 min to break the membrane, and then stained with an EdU kit for 30 min. The EdU kit was purchased from Ruibo Bio.

[0116] The results are as follows Figure 6 As shown in Figure C, saquinavir can inhibit the replication of H1975 cells, while cefoperazone cannot inhibit the replication of H1975 cells.

[0117] 4.4 In vivo antitumor activity of saquinavir

[0118] The present invention uses a nude mouse tumor-bearing experiment to determine the in vivo antitumor activity of saquinavir: H1975 cells were inoculated subcutaneously in the right axilla of balb / c nude mice, and the tumors were grown to 100 mm. 3 The animals were then randomly divided into a blank control group and a treatment group. The treatment group was injected with 0.2 mL of saquinavir at a concentration of 5 mg / kg, and the blank control group was injected with an equal volume of normal saline. The drug was intraperitoneally injected once every 2 days. The body weight and tumor volume of the mice were measured daily after administration to dynamically observe the anti-tumor effect of the compound. After 7 doses, the mice were killed, the tumor mass was surgically removed and weighed, and the relative tumor volume V (mm 3 ).

[0119] Figure 7 and 8 The results showed that saquinavir could significantly inhibit the growth of H1975 in nude mice and had good anti-tumor activity in vivo.

[0120] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An application of a reagent for inhibiting the binding between EGFR and MPZL3 protein, characterized in that: Include at least one of the following: (1) Application in the preparation of drugs for treating tumors; (2) Application in the preparation of drugs for reversing tumor resistance.

2. The use according to claim 1, characterized in that: The tumor includes lung cancer.

3. The use according to claim 2, characterized in that: The lung cancer includes lung adenocarcinoma.

4. The use according to any one of claims 1 to 3, characterized in that: The reagent includes saquinavir; the drug has a reagent that inhibits the binding between EGFR and MPZL3 protein as the only active ingredient.

5. A method for screening drugs for treating tumors and / or reversing tumor resistance, characterized in that: The following steps are involved: (1) The candidate drug interacting with the receptor cells containing EGFR protein and MPZL3 protein is used as the test group, and the medium without any drug interacting with the receptor cells containing EGFR protein and MPZL3 protein is set as the control group; (2) When the binding ability of EGFR protein and MPZL3 protein in the test group is weakened compared with the control group, and tumor proliferation is inhibited, the candidate drug can be determined as a drug for treating tumors and / or reversing tumor resistance.

6. The method according to claim 5, characterized in that The recipient cells include HEK293 cells.

7. The method according to claim 5, characterized in that The method for preparing the receptor cells containing EGFR protein and MPZL3 protein comprises: transfecting the EGFR protein plasmid and the MPZL3 protein plasmid into the receptor cells.

8. The method according to claim 5, characterized in that The tumor includes lung cancer.

9. A drug for treating tumors and / or reversing tumor drug resistance, characterized in that: The medicine comprises an agent for inhibiting the binding between EGFR and MPZL3 protein and a pharmaceutically acceptable auxiliary material.

10. The drug according to claim 8, characterized in that The agent that inhibits the binding between EGFR and MPZL3 protein includes saquinavir.

Images