SNP (Single Nucleotide Polymorphism) site related to ear type of millet, molecular marker and application of SNP site and molecular marker

Abstract

The invention discloses SNP (Single Nucleotide Polymorphism) sites related to millet glume color, a molecular marker and application thereof, the SNP sites comprise a first SNP site and a second SNP site, the first SNP site is located at the 40326586th site of the eighth chromosome of millet, and the allelic variation of the first SNP site is C / T; the second SNP site is located at the 49237210th site of the ninth chromosome of millet, and the allelic variation of the second SNP site is A / G. The invention provides the SNP site obviously related to the millet glume color character, and the molecular marker related to the millet glume color is developed, so that the genome DNA sequence is associated with the millet glume color character, establishment of a millet molecular marker assisted breeding system is facilitated, and a direction and a basis can be provided for more precise positioning and millet breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of biomolecules, and in particular relates to SNP sites and molecular markers related to millet ear types and applications thereof. Background Art

[0002] Millet (Setaria italica), also known as millet or millet in ancient times, is an annual herbaceous crop native to China. It is one of China's important food crops and plays an irreplaceable role in the sustainable development of dryland agriculture. Millet is drought-resistant and water-saving, and is considered a strategic reserve crop for future drought environments and climate warming. The ear type of millet has a significant impact on yield. The relationship between the ear type and yield of millet is mainly reflected in the number of spikelets on the ear, grain weight, and fruiting rate, which directly affect the final yield of millet. Generally speaking, varieties with higher grain numbers and grain weights, such as panicle types, usually have higher yields. This is because varieties of this type of ear type can provide more grains, thereby increasing yields. In addition, the size of the ear type also affects the nutrient demand, stress resistance, and the difficulty of cultivation and management, which are important factors affecting yield. The ear type of millet is not only related to its yield, but also has a certain relationship with the occurrence of diseases and insect pests. The panicle type of millet has a direct impact on its yield. By selecting the appropriate panicle type and taking effective cultivation and management measures, the yield and pest resistance of millet can be significantly improved. As a diploid self-pollinating crop, millet has a small genome, is easy to operate, has a short reproductive cycle, and is relatively simple in inheritance. It now has a high-quality reference genome sequence, and the publication of the millet SSR genetic linkage map has laid a good foundation for the genetic analysis of millet. Although the whole genome sequence of millet has been sequenced, there are few reports on the genetic association studies of millet panicle type; therefore, it is necessary to develop, utilize, and identify molecular markers for millet panicle type traits in order to breed better varieties. Summary of the invention

[0003] Based on the above background, the present invention provides SNP sites, molecular markers and applications thereof associated with millet panicle type.

[0004] The technical solution of the present invention is:

[0005] The SNP sites associated with millet panicle type include a first SNP site and a second SNP site. The first SNP site is located at position 31676683 of chromosome 8 of millet, and its allele variation is A / C; the second SNP site is located at position 31693050 of chromosome 8 of millet, and its allele variation is A / T.

[0006] Based on the same inventive concept, the present invention also provides the use of a substance for detecting the polymorphism or genotype of SNP in the millet genome in any of the following applications, the application comprising:

[0007] 1) Application in predicting the ear shape of millet;

[0008] 2) Application in the identification or auxiliary identification of ear traits of millet;

[0009] 3) Application in breeding related to improvement of millet ear type or auxiliary breeding.

[0010] The SNP sites include a first SNP site and a second SNP site. The first SNP site is located at position 31676683 of chromosome 8 of millet, and its allele variation is A / C; the second SNP site is located at position 31693050 of chromosome 8 of millet, and its allele variation is A / T.

[0011] Based on the same inventive concept, the present invention also provides a molecular marker related to millet panicle type, the molecular marker includes a first molecular marker and a second molecular marker, the first molecular marker includes the 31676683rd position of chromosome 8 of millet, and the second molecular marker includes the 31693050th position of chromosome 8 of millet;

[0012] The nucleotide sequence of the first molecular marker is shown in SEQ ID No. 1, and the details are as follows:

[0013] TGAGGGCTGGCCTCCAATTTTACAATATGTACTAT[A / C]TACTCCCTCTGTCCTAAATTACTATTCGTTTTGAC, the 36th base is the A / C allele variation;

[0014] The nucleotide sequence of the second molecular marker is shown in SEQ ID No. 2, and is specifically as follows:

[0015] AGCAGAGCTTTACTGATAGATAAAGATCAAAACCC[A / T]AGGGTTAGGATAATTTCATATTTAGCATATTCGGA, the 36th base is an A / T allele variation.

[0016] Based on the same inventive concept, the present invention also provides the use of molecular markers related to millet ear type in any of the following, the application comprising:

[0017] 1) Application in predicting the ear shape of millet;

[0018] 2) Application in the identification or auxiliary identification of ear traits of millet;

[0019] 3) Application in breeding related to improvement of millet ear type or auxiliary breeding.

[0020] Based on the same inventive concept, the present invention also provides a method for predicting the panicle type of millet, using a specific probe or chip for detecting the SNP site to detect the millet genomic DNA of the prediction object, obtain the base situation of the allele variation site of the SNP site, and predict the panicle type of millet according to the base situation;

[0021] Alternatively, the DNA of a single leaf or seed of millet is used as a template, primers corresponding to the molecular markers are used for PCR amplification, the amplified products are sequenced and identified, and the ear type of millet is predicted based on the identification results.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention provides SNP sites significantly correlated with the panicle type traits of millet, and develops molecular markers related to the panicle type of millet, thereby linking the genomic DNA sequence with the panicle type traits of millet, which is conducive to the establishment of a molecular marker-assisted breeding system for millet and can provide direction and basis for more precise positioning and millet breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The millet population structure analysis of Example 1 of the present invention;

[0025] Figure 2 LD attenuation distribution diagram of Example 1 of the present invention;

[0026] Figure 3 The Manhattan plot and QQ-Plot plot of the millet ear type in Example 1 of the present invention, the portion above the dotted line in the figure is the SNP site with significant difference, p<0.01. DETAILED DESCRIPTION

[0027] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with its embodiments; it should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0029] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0030] Example 1: Determination of SNP loci and molecular markers associated with millet ear type

[0031] In this example, 203 millet materials provided by Zhangjiakou Academy of Agricultural Sciences were selected, and the varieties of the millet materials included the following: Xiaofannuo, Sugu, Hongguzi, Dogtail Millet, Huangxu, Longzhuahuang, Xiangyanggu, Huanggu, Dahuanggu, Maomaohuang, Longgu 26, Longgu 30, Longgu 31, Longgu 17, Longgu 18, Longgu 19, Henggu 10, Henggu 11, Henggu 12, Henggu 21 varieties from various provinces across the country, and Liuwahonggu×Henan 4·2SE165. 5·Xiaomaohuang·Xia1f, Chaoxianggu×Xuandasui 5·2SE mixed·8f, Liuwahonggu×Henan 4·2SE1655·Xiaomaohuang·Xia1f, Liuwahonggu×Henan 4·2SE1655·Xiaomaohuang·Xia1f hybrid varieties, 203 millet materials were sown in the experimental field of Zhangjiakou Academy of Agricultural Sciences in mid-May 2023. Field tests were conducted, and each millet material was planted in 2 rows, with a row length of 2m, a row spacing of 50cm, and a plant spacing of 3-5cm. According to local routine management, each material selected millet in the middle of the row (3 plants in total) at maturity to measure field traits.

[0032] DNA samples were extracted from 203 millet materials (leaves). After the DNA quality inspection was qualified, it was quantitatively and qualitatively checked by NanoDropND-2000, Thermo Scientific, and the DNA integrity was tested by gel electrophoresis. According to the conventional method and its standard process, the experimental samples were amplified, fragmented, precipitated, resuspended, hybridized on the chip, and washed according to the standard process of the chip.

[0033] 1) Original millet chip data processing

[0034] First, the raw data obtained by scanning with the GeneTitan system was imported into the software Affymetrix Power Tools, and the raw data was clustered and genotyped using the software. Finally, the PLINK format data was exported through the Affymetrix Power Tools software for subsequent data analysis. The PLINK format data was further converted into SNP VCF format data using the PLINK program, and the VCF format data was further analyzed.

[0035] 2) Conversion of chip SNP data

[0036] The total SNP VCF files above were screened, and the VCF files of SNPs of heading period traits were obtained according to the number of samples with phenotypes at different periods.

[0037] 3) Sample population structure analysis

[0038] ADMIXTURE program was used to perform principal component analysis to obtain the population clustering of the samples.

[0039] 4) Linkage disequilibrium (LD) analysis

[0040] The linkage disequilibrium coefficient (r2) is used to measure the linkage disequilibrium level between SNP sites on chromosomes. When r2 = 0, it means that the population is in linkage equilibrium or has no LD. The larger the r2, the closer the distance between SNP sites. Generally, when r2 is greater than or equal to 0.8, the two sites are considered to be in linkage disequilibrium. The distance between sites corresponding to the decay of r2 to half is used as the linkage disequilibrium decay distance. The VCFtools software is used to calculate the decay value of linkage disequilibrium, and a nonlinear regression model is used to draw a trend graph of the decay of r2 as the physical distance between SNP sites increases.

[0041] 5) GWAS analysis of chip data and prediction of candidate genes

[0042] Based on the customized SNP chip (Affymetrix chip) with 82738 loci, the SNP loci that appeared in at least 95% of the samples were further screened, and a total of 55688 SNP loci were obtained in the mature stage. Entering the formal GWAS analysis, the R package GWASpoly analysis process was used to perform various phenotypic association analyses at different developmental stages. In the 1-dom and additive modes, the mixed linear Q+K algorithm (population structure + kinship) was used to draw QQ-Plot graphs and Manhattan graphs. For the SNPs with significant phenotypic association, the genes within the 10kb range upstream and downstream were found, and the SNP loci were functionally annotated. The results showed that the significant SNPs associated with millet panicle type were located at positions 31676683 and 31693050 on chromosome 8, namely the first SNP locus and the second SNP locus, respectively. The polymorphism of the first SNP locus was A / C, and the polymorphism of the second SNP locus was A / T. The additive of the first SNP locus was 7.43, and the additive of the second SNP locus was 7.43. And by Figure 1 It can be seen that the clustering of ADMIXTURE needs to calculate the CV error (correlation error) under different K values. The trend of K value is to decrease first and then increase ( Figure 1 ), the K value at the beginning of the rise is the number of ancestral groups with the best genetic background. This experiment can be divided into approximately 35 ancestral groups. Figure 2 It can be seen that the LD decay distance of the foxtail millet genome in this embodiment is 9 M. A smaller LD decay distance is beneficial to narrowing the candidate regions for subsequent association analysis and improving the accuracy of the association results.

[0043] Example 2: Based on the above SNP site, this example develops a molecular marker related to the panicle type of millet, the molecular marker includes a first molecular marker and a second molecular marker, the first SNP site is located within the 31676683rd site of chromosome 8 of millet, and the second molecular marker includes the 31693050th site of chromosome 8 of millet;

[0044] The nucleotide sequence of the first molecular marker is shown in SEQ ID No. 1, and the details are as follows:

[0045] TGAGGGCTGGCCTCCAATTTTACAATATGTACTAT[A / C]TACTCCCTCTGTCCTAAATTACTATTCGTTTTGAC, the 36th base is the A / C allele variation;

[0046] The nucleotide sequence of the second molecular marker is shown in SEQ ID No. 2, and is specifically as follows:

[0047] AGCAGAGCTTTACTGATAGATAAAGATCAAAACCC[A / T]AGGGTTAGGATAATTTCATATTTAGCATATTCGGA, the 36th base is an A / T allele variation.

[0048] The above molecular markers can be applied to predict the panicle type of millet. Specifically, according to conventional operations, PrimerPremier is used to design molecular primers corresponding to the molecular markers (this is a conventional technology and will not be described in detail here. It was commissioned to Beijing Compson Biotechnology Co., Ltd.), and the genome of millet is used as a template, specifically the DNA of millet leaves can be used as a template, PCR amplification is performed using primers, the amplification products are sequenced and identified, and the panicle type of millet is predicted based on the identification results.

[0049] Example 3: SNP marker verification

[0050] Statistics were collected on the ear shapes of the 203 materials in Example 1 at maturity, among which 138 materials had conical ear shapes, 34 materials had cylindrical ear shapes, and 31 materials had other shapes.

[0051] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A SNP site associated with millet ear type, characterized in that: The SNP sites include a first SNP site and a second SNP site. The first SNP site is located at position 31676683 of chromosome 8 of millet, and its allele variation is A / C; the second SNP site is located at position 31693050 of chromosome 8 of millet, and its allele variation is A / T.

2. Use of a substance for detecting the polymorphism or genotype of SNP in a millet genome in any of the following, characterized in that: The applications include: 1) Application in predicting the ear shape of millet; 2) Application in the identification or auxiliary identification of ear traits of millet; 3) Application in breeding related to improvement of millet ear type or auxiliary breeding. The SNP sites include a first SNP site and a second SNP site. The first SNP site is located at position 31676683 of chromosome 8 of millet, and its allele variation is A / C; the second SNP site is located at position 31693050 of chromosome 8 of millet, and its allele variation is A / T.

3. A molecular marker associated with millet ear type, characterized in that: The molecular markers include a first molecular marker and a second molecular marker, wherein the first molecular marker includes the 31676683rd position of chromosome 8 of millet, and the second molecular marker includes the 31693050th position of chromosome 8 of millet; The nucleotide sequence of the first molecular marker is shown as SEQ ID No.1; The nucleotide sequence of the second molecular marker is shown as SEQ ID No.

2.

4. Use of the molecular marker associated with millet ear type according to claim 3 in any of the following applications, characterized in that: The applications include: 1) Application in predicting the ear shape of millet; 2) Application in the identification or auxiliary identification of ear traits of millet; 3) Application in breeding related to improvement of millet ear type or auxiliary breeding.

5. A method for predicting millet ear type, characterized in that: Using a specific probe or chip for detecting the SNP site described in claim 1, the millet genomic DNA of the prediction object is detected to obtain the base situation of the allele variation site of the SNP site described in claim 1, and predict the panicle type of the millet according to the base situation; Alternatively, the DNA of a single leaf or seed of millet is used as a template, and the primers corresponding to the molecular marker of claim 4 are used for PCR amplification, and the amplified product is sequenced and identified, and the ear type of millet is predicted according to the identification result.

Images