Cyclic peptide mutant, application of cyclic peptide mutant in preparation of coronavirus inhibitor and product

Abstract

The invention provides a cyclopeptide mutant, application of the cyclopeptide mutant in preparation of a coronavirus inhibitor and a product, and belongs to the technical field of cyclopeptide drugs. Optimization is carried out on the basis of the cyclopeptide 6L3-3P11R, the obtained cyclopeptide mutant can resist the enzyme digestion effect of pancreatin, the antiviral activity of the cyclopeptide mutant is further improved, and the cyclopeptide mutant has important significance in expanding the antiviral application of cyclopeptide drugs.

Description

Technical Field

[0001] The present invention belongs to the technical field of cyclic peptide drugs, and in particular relates to cyclic peptide mutants and their application and products for preparing coronavirus inhibitors. Background Art

[0002] Coronavirus is the cause of many diseases and is very prone to mutation. Taking SARS-CoV-2 (hereinafter referred to as the new coronavirus, COVID-19) as an example, the development and promotion of broad-spectrum drugs and universal vaccines are key measures to deal with SARS-CoV-2. Currently approved anti-COVID-19 drugs mainly target the main protease and RNA-dependent RNA polymerase targets, and their safety and effectiveness still need more verification.

[0003] Cyclic peptide drugs have the advantages of structural diversity, strong biological activity, target specificity, biological stability, low drug resistance and strong customizability. Therefore, using the unique structural characteristics of cyclic peptides to discover and develop drugs has become an important research direction in recent years.

[0004] As recorded in the invention patent with application number 202311261559.5, the 6L3-3P11R cyclic peptide is a cyclic peptide that can bind to the receptor binding domain (RBD) on the SARS-CoV-2 spike protein (S) and inhibit infection of various SARS-CoV-2 mutant strains including Omicron.

[0005] However, analysis found that trypsin is widely distributed in the human body, and 6L3-3P11R contains arginine, and its antiviral activity is easily affected by trypsin digestion, so its actual use is limited. Summary of the invention

[0006] The previously discovered cyclic peptide 6L3-3P11R can inhibit the infection of various new coronavirus pseudoviruses. However, 6L3-3P11R is sensitive to trypsin treatment, and trypsin is widely distributed in the human body. Therefore, the purpose of the present invention is to provide an optimized new coronavirus cyclic peptide inhibitor that can resist the enzymatic cleavage of trypsin, and at the same time optimize the cyclic peptide to have a better inhibitory effect.

[0007] In one aspect, the present invention provides a cyclic peptide mutant.

[0008] The cyclic peptide mutant before mutation is:

[0009]

[0010] Ac=acetyl;

[0011] L Y = L-tyrosine;

[0012] The cyclic peptide mutant includes amino acid modification, which occurs at any one or more amino acid sites. The amino acid modification enables the cyclic peptide mutant to have the property of resisting trypsin cleavage.

[0013] Preferably, the cyclic peptide mutant includes amino acid modifications, and the amino acid modifications include at least one modification type of adding a carbon atom.

[0014] Specifically, the increased number of carbon atoms may be n, where n is an integer; preferably, the increased number of carbon atoms is 1.

[0015] In some specific embodiments, the amino acid modification includes but is not limited to: (1) cysteine ​​methylation; or (2) arginine replacement with homoarginine.

[0016] The cysteine ​​methylation is a methyl substitution relative to cysteine, which adds one carbon atom;

[0017] The homoarginine and arginine are a pair of homologous amino acids, and the homoarginine has one more carbon atom than arginine. When not a component of a peptide chain, the molecular formula of homoarginine is C7H 16 N4O2, the molecular formula of arginine is C6H 14 N4O2.

[0018] Based on the aforementioned amino acid modification, the amino acid modification may also selectively include: (3) L-tyrosine is replaced by L-phenylalanine.

[0019] Specifically, the cyclic peptide mutant is selected from any one of the following:

[0020] 1)6L3-3P11R12 Me The C sequence is:

[0021]

[0022] Ac=acetyl;

[0023] L Y = L-tyrosine;

[0024] Me C = methylated cysteine;

[0025] Among them, Ac and L The amino group at the N-terminus of Y is connected, and the hydroxyl group in the carboxyl group of the last amino acid G at the C-terminus of the polypeptide chain is replaced by the amino group -NH2 to form an amide;

[0026] 2) The sequence of 6L3-3P11hR is:

[0027]

[0028] Ac=acetyl;

[0029] L Y = L-tyrosine;

[0030] hR = homoarginine;

[0031] Among them, Ac and L The amino group at the N-terminus of Y is connected, and the hydroxyl group in the carboxyl group of the last amino acid G at the C-terminus of the polypeptide chain is replaced by the amino group -NH2 to form an amide;

[0032] The 6L3-1F3P11hR sequence is:

[0033]

[0034] Ac=acetyl;

[0035] L F = L-phenylalanine;

[0036] hR = homoarginine;

[0037] Among them, Ac and L The hydroxyl group in the carboxyl group of the last amino acid G at the C-terminus of the polypeptide chain is replaced by the amino group -NH2 to form an amide.

[0038] On the other hand, the present invention provides the use of the aforementioned cyclic peptide mutant in the preparation of coronavirus inhibitors.

[0039] Preferably, the coronavirus is Sabei coronavirus.

[0040] The Sabei coronavirus includes but is not limited to SARS-CoV-2 or a coronavirus with a homology of more than 85% with SARS-CoV-2, which can be more than 90% or more than 95%, or more than 90.1% or 96.9%.

[0041] For example, the coronaviruses with more than 85% homology to SARS-CoV-2 include bat coronavirus RaTG13 or pangolin coronavirus GD / 1 / 2019.

[0042] Prior art document "Niu S, Wang J, Bai B, Wu L, Zheng A, Chen Q, Du P, Han P, ZhangY, Jia Y, Qiao C, Qi J, Tian WX, Wang HW, Wang Q, Gao GF. Molecular basis of cross-species ACE2 interactions with SARS-CoV-2-like viruses of pangolinorigin. EMBO J. 2021Aug 16;40(16):e107786.doi:10.15252 / embj.2021107786.Epub2021Jun 8.Erratumin:EMBO J.2022Jan 4;41(1):e109962.doi:10.15252 / embj.2021109962.Erratumin:EMBO J.2022Jan04;41(1):EMBJ2021109962.doi:10.15252 / embj.2021109962.PMID:34018203;PMCID:PMC8209949." It records that the homology of the RBD amino acid sequence of RaTG13 and the new coronavirus reaches 90.1%.

[0043] Prior art document "Niu S, Wang J, Bai B, Wu L, Zheng A, Chen Q, Du P, Han P, ZhangY, Jia Y, Qiao C, Qi J, Tian WX, Wang HW, Wang Q, Gao GF. Molecular basis of cross-species ACE2 interactions with SARS-CoV-2-like viruses of pangolinorigin. EMBO J. 2021Aug 16;40(16):e107786.doi:10.15252 / embj.2021107786.Epub2021Jun 8.Erratumin:EMBO J.2022Jan 4;41(1):e109962.doi:10.15252 / embj.2021109962.Erratumin:EMBO J.2022Jan04;41(1):EMBJ2021109962.doi:10.15252 / embj.2021109962.PMID:34018203;PMCID:PMC8209949." It records that the amino acid sequence homology between GD / 1 / 2019 and the RBD of the new coronavirus reached 96.9%.

[0044] Preferably, the coronavirus includes any one or more of the SARS-CoV-2 prototype strain or variant strain.

[0045] The mutant strains include but are not limited to any one or more of Delta B.1.617.2, Omicron BA.1, OmicronBA.2, Omicron BA.4 / 5, Omicron BF.7, Omicron BQ.1, Omicron BQ.1.1, Omicron XBB, OmicronXBB.1.5, Omicron CH.1.1 and Omicron BA.2.86.

[0046] On the other hand, the present invention provides the use of the aforementioned cyclic peptide mutant in the preparation of a product for alleviating the symptoms of infection caused by coronavirus.

[0047] The symptoms of infection caused by the coronavirus include, but are not limited to, any one or more of respiratory tract infection symptoms, fever, muscle pain, diarrhea, joint pain, hypoxemia, general weakness, conjunctival congestion, tearing, dry and itchy eyes, increased eye secretions, nausea and vomiting, loss of appetite, chest tightness, and palpitations.

[0048] The respiratory tract infection symptoms include, but are not limited to, any one or more of dry throat, sore throat, cough, nasal congestion, runny nose, pneumonia, and dyspnea.

[0049] In yet another aspect, the present invention provides a drug comprising the aforementioned cyclic peptide mutant.

[0050] The drug at least includes the aforementioned cyclic peptide mutant as an active ingredient, and may also selectively include other active ingredients.

[0051] Preferably, the dosage form of the drug includes, but is not limited to, gastrointestinal administration, injection administration, respiratory tract administration, and ocular administration.

[0052] The medicine may also include pharmaceutical excipients.

[0053] The pharmaceutical excipients include, but are not limited to, any one or more of excipients, buffers, emulsifiers, stabilizers, diluents, adhesives, preservatives and lubricants.

[0054] Specifically, the excipient is selected from at least one of microcrystalline cellulose, lactose, pregelatinized starch, cyclodextrin, carboxymethyl cellulose and mannitol.

[0055] Specifically, the buffer is selected from at least one of sodium dihydrogen phosphate, sodium bicarbonate, ammonium bicarbonate, sodium acetate, citrate, histidine, and succinate.

[0056] Specifically, the emulsifier is selected from at least one of magnesium stearate, zinc stearate, calcium stearate, glyceryl stearate, sorbitan isostearate, sorbitan oleate, glyceryl oleate, and polyglycerol 3 polyricinoleate.

[0057] Specifically, the stabilizer is selected from at least one of acacia gum, agar, alginic acid, cellulose ether, and carboxymethyl chitosan.

[0058] Specifically, the diluent is selected from at least one of erythritol, mannitol, sorbitol, xylitol, lactose, sucrose, corn starch, potato starch, calcium phosphate, calcium citrate, and crystalline cellulose.

[0059] Specifically, the adhesive is selected from at least one of ethanol, starch slurry, syrup, hydroxypropyl methylcellulose, sodium carboxymethyl cellulose, sodium alginate, and polyvinyl pyrrolidone.

[0060] Specifically, the preservative is selected from at least one of methyl paraben, propyl paraben, methyl paraben, ethyl paraben, propyl paraben, chlorobutanol, thimerosal, mercuric cyanide, phenoxyethanol, chlorhexidine, benzoic acid, sodium benzoate, chlorocresol, benzalkonium bromide, benzalkonium chloride, and ethyl paraben.

[0061] Specifically, the lubricant is selected from at least one of magnesium stearate, stearic acid, sodium chloride, sodium oleate, sodium lauryl sulfate, and poloxamer.

[0062] The present invention also provides a genetic engineering product for expressing, producing or delivering the aforementioned cyclic peptide mutant.

[0063] According to the general knowledge of those skilled in the art, the genetic engineering product may include any form such as nucleic acid molecules, expression vectors, genetically engineered cells, etc.

[0064] Beneficial effects of the present invention:

[0065] The present invention is based on the previously discovered 6L3-3P11R cyclic peptide and further optimizes it. The resulting cyclic peptide mutant has improved resistance to common trypsin in the human body and further enhanced its antiviral activity, which is of great significance for improving the antiviral application of cyclic peptide drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 For 6L3-3P11R12 Me Chromatographic analysis of C-ring peptide.

[0067] Figure 2 For 6L3-3P11R12 Me Mass spectrum of the C-loop peptide.

[0068] Figure 3 This is the chromatographic analysis diagram of 6L3-3P11hR cyclic peptide.

[0069] Figure 4 This is the mass spectrum of 6L3-3P11hR cyclic peptide.

[0070] Figure 5 This is the chromatographic analysis diagram of 6L3-1F3P11hR cyclic peptide.

[0071] Figure 6 This is the mass spectrum of 6L3-1F3P11hRc cyclic peptide.

[0072] Figure 7 The neutralization effect of 6L3-3P11R on BF.7 coronavirus pseudovirus in the presence of trypsin.

[0073] Figure 8 In the presence of trypsin, 6L3-3P11R12 Me C. Neutralizing effect of 6L3-3P11hR and 6L3-1F3P11hR cyclic peptides on BF.7 novel coronavirus pseudovirus.

[0074] Fig. 9The neutralizing effect of 6L3-3P11hR and 6L3-1F3P11hR on different new coronavirus pseudoviruses.

[0075] Fig.10 Verification of the thermal stability of 6L3-3P11hR and 6L3-1F3P11hR cyclic peptides. DETAILED DESCRIPTION

[0076] The present invention will be further described in detail below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention. The experimental methods used in the following examples are generally conventional, unless otherwise specified, and the materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.

[0077] The present invention transforms the 6L3-3P11R cyclic peptide. The 6L3-3P11R cyclic peptide can refer to the disclosure of the invention patent with application number 202311261559.5. After the transformation, 6L3-3P11R12 Me C, 6L3-3P11hR cyclic peptide and 6L3-1F3P11hR cyclic peptide. Each cyclic peptide was synthesized and purified by Anhui Guoping Pharmaceutical Co., Ltd.

[0078] 6L3-3P11R12 Me The C sequence is:

[0079]

[0080] Ac=acetyl;

[0081] L Y = L-tyrosine;

[0082] Me C = methylated cysteine;

[0083] Among them, Ac and L The amino group at the N-terminus of Y is connected, and the hydroxyl group in the carboxyl group of the last amino acid G at the C-terminus of the polypeptide chain is replaced by an amino group (-NH2) to form an amide.

[0084] The sequence of 6L3-3P11hR is:

[0085]

[0086] Ac=acetyl;

[0087] L Y = L-tyrosine;

[0088] hR = homoarginine;

[0089] Among them, Ac andL The amino group at the N-terminus of Y is connected, and the hydroxyl group in the carboxyl group of the last amino acid G at the C-terminus of the polypeptide chain is replaced by an amino group (-NH2) to form an amide.

[0090] The 6L3-1F3P11hR sequence is:

[0091]

[0092] Ac=acetyl;

[0093] L F = L-phenylalanine;

[0094] hR = homoarginine;

[0095] Among them, Ac and L The hydroxyl group in the carboxyl group of the last amino acid G at the C-terminus of the polypeptide chain is replaced by an amino group (-NH2) to form an amide.

[0096] The structural formulas of the cyclic peptides are as follows:

[0097] 6L3-3P11R12 Me The structural formula of C-cyclic peptide is as follows:

[0098]

[0099] The structural formula of 6L3-3P11hR cyclic peptide is as follows:

[0100]

[0101] The structural formula of 6L3-1F3P11hR cyclic peptide is as follows:

[0102]

[0103] Example 1 Preparation and Identification of Cyclic Peptides

[0104] The synthesis of the cyclic peptide was carried out according to the standard fluorenylmethoxycarbonyl (Fmoc) solid phase peptide synthesis (SPPS) protocol, and the peptide synthesis was carried out from the C-terminus to the N-terminus according to the sequence.

[0105] (1) 0.5 g of Rink Amide MBHA resin was treated with a dimethylformamide (DMF) solution containing 20% ​​piperidine to remove the Fmoc protecting group. Subsequently, 10 ml of a DMF solution containing 0.3 mmol of Fmoc-Gly-OH (or Fmoc-Cys(Trt)-OH), 0.3 mmol of 1-hydroxybenzotriazole (HOBT) and 5% diisopropylcarbodiimide (DIC) was added to the resin and reacted for 1.5 hours under nitrogen bubbling conditions. The resin was then fully washed three times with DMF and dichloromethane (DCM), respectively, and the Fmoc protecting group was removed with a DMF solution containing 20% ​​piperidine.

[0106] (2) To couple the subsequent amino acid, the resin was reacted with a freshly prepared 10 ml DMF solution containing 0.9 mmol Fmoc-AA-OH (the subsequent amino acid), 0.9 mmol HOBT and 9% DIC under nitrogen bubbling for 1 hour. The above Fmoc removal and coupling steps were repeated until the desired peptide sequence and length were synthesized.

[0107] (3) Use bromoacetic acid to couple with the free amino group at the N-terminus of the polypeptide (tyrosine at the N-terminus) to obtain the N-terminal bromoacetyl group.

[0108] (4) The peptide was then cut off from the resin, precipitated with ether (Et2O), redissolved in dimethyl sulfoxide (DMSO), and incubated at pH 8.0 for thioether cyclization for 1 hour. Finally, trifluoroacetic acid (TFA) was added to acidify the solution and purified using reversed-phase high performance liquid chromatography (RP-HPLC) with a mobile phase of 0.1% trifluoroacetic acid in water and 0.1% trifluoroacetic acid in acetonitrile (MeCN; mobile phase B). The synthesized cyclic peptide was detected by mass spectrometry using electrospray mass spectrometry (ESI-MS), and its purity was confirmed by analytical HPLC.

[0109] 6L3-3P11R12 Me C. Chromatography and mass spectra of 6L3-3P11hR cyclic peptide and 6L3-1F3P11hR Figure 1-Figure 6 According to the preparation method, chromatogram and mass spectrum, the structural formulas of the above three cyclic peptides can be determined as described above.

[0110] Example 2 Inhibitory effect of cyclic peptide 6L3-3P11R on novel coronavirus pseudovirus in the presence of pancreatic enzymes

[0111] (1) One day before the experiment, trypsin was used to harvest the Vero cells in the logarithmic growth phase, counted, and re-seeded in a 96-well plate. After 18-24 hours, when the cell density reached 80-100%, it could be used for the experiment.

[0112] (2) On the day of the experiment, BF.7 pseudovirus was taken out from -80℃ (described in "Tong Z, Tong J, Lei W, Xie Y, Cui Y, Jia G, Li S, Zhang Z, Cheng Z, Xing X, Ma H, Deng L, Zhang R, Zhao X, Liu K, Wang Q, Qi J, Huang H, Song R, Su Z, Wu G, Lou J, Gao GF. Deciphering areliable synergistic bispecific strategy of rescuing antibodies for SARS-CoV-2 escape variants, including BA.2.86, EG.5.1, and JN.1. Cell Rep. 2024Jun 25; 43(6): 114338. doi: 10.1016 / j.celrep.2024.114338. Epub 2024Jun 8.PMID:38850530.", which is available to the public from the applicant and can only be used to repeat the experiments of the present invention and cannot be used for other purposes), and the pseudovirus was thawed on ice, and then the pseudovirus was diluted to 1000TU / 50μL / well with complete culture medium (DMEM culture medium, 10% FBS).

[0113] (3) Diluting the cyclic peptide (initial concentration was 6.25 μM, 2 replicates, 4-fold dilution of the 6L3-3P11R cyclic peptide, 11 gradients).

[0114] (4) Add trypsin to the diluted cyclopeptide solution to a final concentration of 4 μg / mL, mix the solution, and incubate at 37°C for 30 min.

[0115] (5) Pour the diluted BF.7 pseudovirus into a 10 cm cell culture dish, add it to a 96-well plate (1:1 volume with cyclopeptide, i.e. 60 μL of trypsin-treated cyclopeptide + 60 μL of pseudovirus per replicate well), and mix once. Incubate the 96-well plate at 37°C for 1 hour; after the incubation time reaches 40-50 minutes, take out the Vero cells prepared in advance in the incubator, discard the cell supernatant, and add 100 μL of the mixture of cyclopeptide and virus. After incubation at 37°C for 15 hours, detect green fluorescence using the CQ1 microscope reading method, take pictures, and count.

[0116] A blank control with only culture medium added and a challenge control with an equal amount of pseudovirus but no cyclic peptide were set up.

[0117] (6) Data analysis: Calculate the EC of the cyclic peptide using GraphPad 50(Half maximum effect concentration, i.e., the concentration of the test substance that can cause 50% of the maximum effect in the efficacy experiment) The calculation method is inhibition rate = 1-(fluorescence number of the experimental group-fluorescence number of the blank control group) / (fluorescence number of the challenge control group-fluorescence number of the blank control group)*100(%).

[0118] 2. Results and Analysis

[0119] The experimental results are as follows Figure 7 As shown, the cyclic peptide 6L3-3P11R has a neutralizing effect on BF.7 pseudovirus, EC 50 The value is 2731nM, which is significantly lower than the effect in the absence of pancreatic enzymes, with a decrease of more than 500 times.

[0120] Example 3 Cyclic Peptide 6L3-3P11R12 Me C. Inhibitory effects of 6L3-3P11hR and 6L3-1F3P11hR on SARS-CoV-2 pseudovirus in the presence of pancreatic enzymes

[0121] (1) One day before the experiment, trypsin was used to harvest the Vero cells in the logarithmic growth phase, counted, and re-seeded in a 96-well plate. After 18-24 hours, when the cell density reached 80-100%, it could be used for the experiment.

[0122] (2) On the day of the experiment, BF.7 pseudovirus was taken out from -80℃ (described in "Tong Z, Tong J, Lei W, Xie Y, Cui Y, Jia G, Li S, Zhang Z, Cheng Z, Xing X, Ma H, Deng L, Zhang R, Zhao X, Liu K, Wang Q, Qi J, Huang H, Song R, Su Z, Wu G, Lou J, Gao GF. Deciphering areliable synergistic bispecific strategy of rescuing antibodies for SARS-CoV-2 escape variants, including BA.2.86, EG.5.1, and JN.1. Cell Rep. 2024Jun 25; 43(6): 114338. doi: 10.1016 / j.celrep.2024.114338. Epub 2024Jun 8.PMID:38850530.", which is available to the public from the applicant and can only be used to repeat the experiments of the present invention and cannot be used for other purposes), and the pseudovirus was thawed on ice, and then the pseudovirus was diluted to 1000TU / 50μL / well with complete culture medium (DMEM culture medium, 10% FBS).

[0123] (3) Dilute the cyclic peptide (initial concentration was 6.25 μM, 2 replicates, cyclic peptide 6L3-3P11R12 Me C, 6L3-3P11hR and 6L3-1F3P11hR were diluted 4-fold, 11 gradients).

[0124] (4) Add trypsin to the diluted cyclopeptide solution to a final concentration of 4 μg / mL, mix the solution, and incubate at 37°C for 30 min.

[0125] (5) Pour the diluted BF.7 pseudovirus into a 10 cm cell culture dish, add it to a 96-well plate (1:1 volume with cyclopeptide, i.e. 60 μL of trypsin-treated cyclopeptide + 60 μL of pseudovirus per replicate well), and mix once. Incubate the 96-well plate at 37°C for 1 hour; after the incubation time reaches 40-50 minutes, take out the Vero cells prepared in advance in the incubator, discard the cell supernatant, and add 100 μL of the mixture of cyclopeptide and virus. After incubation at 37°C for 15 hours, detect green fluorescence using the CQ1 microscope reading method, take pictures, and count.

[0126] A blank control with only culture medium added and a challenge control with an equal amount of pseudovirus but no cyclic peptide were set up.

[0127] (6) Data analysis: Calculate the EC of each cyclic peptide using GraphPad 50 (Half maximum effect concentration, i.e., the concentration of the test substance that can cause 50% of the maximum effect in the efficacy experiment) The calculation method is inhibition rate = 1-(fluorescence number of the experimental group-fluorescence number of the blank control group) / (fluorescence number of the challenge control group-fluorescence number of the blank control group)*100(%).

[0128] 2. Results and Analysis

[0129] The experimental results are as follows Figure 8 As shown, in the presence of pancreatin, the cyclic peptide 6L3-3P11R12 Me C. 6L3-3P11hR and 6L3-1F3P11hR have a neutralizing effect on BF.7 pseudovirus, EC 50 They were 56.5nM, 2.71nM and 1.3nM respectively, showing better inhibitory effects than the cyclic peptide 6L3-3P11R (2731nM).

[0130] Example 4 Neutralization experiment of cyclic peptides 6L3-3P11hR and 6L3-1F3P11hR with SARS-CoV-2 pseudovirus

[0131] 1. Experimental Methods

[0132] 1. Preparation of fake viruses

[0133] The present invention prepares the following 12 pseudoviruses: SARS-CoV-2 prototype strain (SARS-CoV-2-PT) and 11 variant strains - Delta (B.1.617.2), Omicron (BA.1), Omicron (BA.2), Omicron (BA.4 / 5), Omicron (BF.7), Omicron (BQ.1), Omicron (BQ.1.1), Omicron (XBB), Omicron (XBB.1.5), Omicron (CH.1.1) and Omicron (BA.2.86) pseudoviruses.

[0134] Among them, the pseudoviruses of the SARS-CoV-2 prototype strain (SARS-CoV-2-PT) and variant strains Delta (B.1.617.2), Omicron (BA.1, BA.2, BA.4 / 5, BF.7, BQ.1.1, XBB, XBB.1.5, BA.2.86) are recorded in "Tong Z, Tong J, Lei W, Xie Y, Cui Y, Jia G, Li S, Zhang Z, Cheng Z, Xing X, Ma H, Deng L, Zhang R, Zhao X, Liu K, Wang Q, Qi J, Huang H, Song R, Su Z, Wu G, Lou J, Gao GF. Deciphering a reliable synergistic bispecific strategy of rescuing antibodies for SARS-CoV-2 escape variants, including BA.2.86, EG.5.1, and JN.1. Cell Rep. 2024 Jun. 25;43(6):114338.doi:10.1016 / j.celrep.2024.114338.Epub2024Jun 8.PMID:38850530." is available to the public from the applicant and can only be used to repeat the experiments of the present invention and cannot be used for other purposes.

[0135] The pseudoviruses of SARS-CoV-2 variant strains BQ.1 and CH.1.1 are recorded in the article “Liu C, Xu S, Zheng Y, Xie Y, Xu K, Chai Y, Luo T, Dai L, Gao GF. Mosaic RBD nanoparticle elicits immunodominantantibody responses across sarbecoviruses. Cell Rep. 2024May28;43(5):114235.doi:10.1016 / j.celrep.2024.114235.Epub 2024May 14.PMID:38748880.”, which can be obtained by the public from the applicant and can only be used for repeating the experiments of the present invention and may not be used for other purposes.

[0136] 2. Neutralization experiment

[0137] (1) One day before the experiment, trypsin was used to harvest the Vero cells in the logarithmic growth phase, counted, and re-seeded in a 96-well plate. After 18-24 hours, when the cell density reached 80-100%, it could be used for the experiment.

[0138] (2) On the day of the experiment, each pseudovirus packaged in step 1 was taken out from -80°C and thawed on ice. The pseudovirus was then diluted with complete culture medium (DMEM medium, 10% FBS) to 1000 TU / 50 μL / well.

[0139] (3) Dilution of the cyclic peptide (initial concentration was 100 μM, 2 replicates, 4-fold dilution of the two cyclic peptides 6L3-3P11hR and 6L3-1F3P11hR, 14 gradients).

[0140] (4) Pour each diluted pseudovirus into a 10 cm cell culture dish, add to a 96-well plate (1:1 volume with cyclopeptide, i.e. 60 μL diluted cyclopeptide + 60 μL pseudovirus per replicate well), and mix once. Incubate the 96-well plate at 37°C for 1 hour; after the incubation time reaches 40-50 minutes, take out the Vero cells prepared in advance in the incubator, discard the cell supernatant, and add 100 μL of the mixture of cyclopeptide and virus. After incubation at 37°C for 15 hours, detect green fluorescence using the CQ1 microscope reading method, take pictures, and count.

[0141] A blank control with only culture medium added and a challenge control with an equal amount of pseudovirus but no cyclic peptide were set up.

[0142] (5) Data analysis: Calculate the EC of each cyclic peptide using GraphPad 50(Half maximum effect concentration, i.e., the concentration of the test substance that can cause 50% of the maximum effect in the efficacy experiment) The calculation method is inhibition rate = 1-(fluorescence number of the experimental group-fluorescence number of the blank control group) / (fluorescence number of the challenge control group-fluorescence number of the blank control group)*100(%).

[0143] 2. Results and Analysis

[0144] The experimental results are as follows Fig. 9 As shown, the cyclic peptides 6L3-3P11hR and 6L3-1F3P11hR had good neutralizing effects on pseudoviruses of PT, Delta, BA.1, BA.2, BA.4 / 5, BF.7, BQ.1, BQ.1.1, XBB, XBB.1.5, CH.1.1, and BA.2.86 strains, and EC 50 The value is between 1.1nM-1.1μM.

[0145] Example 5 Affinity determination of cyclic peptides 6L3-3P11hR and 6L3-1F3P11hR with RBD

[0146] The surface plasmon resonance phenomenon was used to detect the intermolecular interaction, which was completed on the biomacromolecule interaction analysis system Biacore 8K produced by GE Healthcare Group. The protein A chip (Cytiva, 29127555) was used to capture the expressed RBD supernatant (containing the expressed RBD-Fc protein) as the stationary phase, and the mobile phase was the cyclic peptide to be detected. The kinetic parameters were then analyzed and plotted using the BIAevaluation software. The analysis was performed at a constant temperature of 25°C.

[0147] Experimental steps:

[0148] (1) Expression of viral RBD-Fc protein and fixation on chip

[0149] The viral RBD-Fc proteins to be expressed in the present invention involve the following sources: PT RBD, Delta RBD, OmicronBA.2RBD, Omicron BQ.1.1RBD, Omicron XBB.1.5RBD, Omicron JN.1RBD, RaTG13 RBD, and GD / 1 / 2019RBD.

[0150] For expression plasmids and their construction methods for expressing PT RBD, Omicron BA.2RBD, RaTG13 RBD, GD / 1 / 2019RBD and Fc fusion proteins, please refer to “Liu H, Wu L, Liu B, Xu K, Lei W, Deng J, Rong X, Du P, Wang L, Wang D, Zhang X, Su C, Bi Y, Chen H, Liu WJ, Qi J, Cui Q, Qi S, Fan R, Jiang J, Wu G, Gao GF, Wang Q. Two pan-SARS-CoV-2 nanobodies and their multivalent derivatives effectively prevent Omicron infections in mice. Cell Rep Med. 2023 Feb 21; 4(2): 100918. doi: 10.1016 / j.xcrm.2023.100918. Epub 2023.02.02.03.0 2023Jan12.PMID:36702124;PMCID:PMC9834170." The expression plasmids used to express the remaining viral RBD-Fc proteins were prepared in the same manner, with the only difference being that the viral RBD sequences were replaced. The BQ.1.1RBD sequence is shown in SEQ ID No.1, the XBB.1.5RBD sequence is shown in SEQ ID No.2, and the JN.1RBD sequence is shown in SEQ ID No.3.

[0151] SEQ ID No.1:

[0152] AGAGTGCAGCCTACAGAATCCATCGTGCGGTTCCCTAACATCACCAACCTCTGTCCTTTCGACGAGGTGTTCAACGCCACCACCTTCGCCTCCGTGTACGCCTGGAATAGAAAAAGAATCAGCAATTGTGTGGCCGATTACAGCGTGCTGTACAACTTCGCTCCATTTTTCGCCTTCAAGTGTTACGGAGTGTCCCCAACCAAGCTGAACGACCTGTGCTTCACCAACGTGTACGCCGATTCTTTTGTGATTAGAGGCAACGAGGTGTCTCAGATCGCCCCCGGCCAAACAGGAAATATCGCTGATTATAACTACAAGCTGCCTGACGACTTCACCGGCTGCGTGATCGCCTGGAACAGCAACAAACTGGACAGCACCGTGGGCGGCAACTATAATTACCGCTACCGGCTGTTCCGGAAGAGCAAACTGAAGCCTTTTGAGCGGGACATCAGCACCGAGATCTACCAGGCCGGCAACAAGCCCTGCAACGGCGTTGCTGGAGTTAACTGCTACTTCCCCCTGCAGAGCTACGGCTTCAGACCTACCTACGGCGTGGGCCACCAGCCCTACAGAGTGGTGGTCCTGAGCTTTGAACTGCTGCACGCCCCTGCCACAGTGTGCGGCCCTAAGAAGTCTACAAATCTGGTGAAGAACAAATGCGTGAACTTC;

[0153] SEQ ID No.2:

[0154] AGAGTGCAGCCTACAGAAAGCATCGTGAGATTCCCAAACATCACCAACCTGTGCCCCTTTCACGAGGTGTTCAACGCTACCACATTCGCCAGCGTGTACGCCTGGAATAGAAAGAGAATCTCCAACTGCGTGGCCGACTACAGCGTTATCTACAACTTCGCCCCTTTCTTCGCTTTTAAGTGCTACGGAGTGTCCCCTACAAAGCTGAACGACCTGTGTTTCACCAACGTGTACGCCGATAGCTTCGTGATCCGCGGAAACGAGGTCTCTCAAATCGCCCCTGGCCAGACCGGCAATATTGCTGATTACAATTATAAACTGCCTGACGACTTCACCGGCTGTGTGATCGCCTGGAACAGCAACAAGCTGGATAGCAAGCCCAGCGGCAACTACAACTACCTGTACAGACTGTTCAGAAAGTCTAAGCTGAAACCATTTGAGCGGGACATCAGCACAGAAATCTACCAGGCCGGCAACAAGCCCTGCAACGGCGTGGCCGGACCTAATTGTTACAGCCCTCTGCAGAGCTACGGCTTTCGGCCTACCTATGGCGTGGGCCACCAGCCCTACAGAGTGGTGGTGCTGTCCTTCGAGCTGCTGCACGCCCCTGCTACCGTGTGCGGCCCTAAGAAGAGCACCAACCTGGTCAAGAACAAATGCGTGAATTTC;

[0155] SEQ ID No.3:

[0156] .

[0157] After obtaining the expression plasmids for expressing the viral RBD-Fc protein, protein expression and chip fixation were performed as follows: the expression plasmid for expressing the viral RBD-Fc protein was mixed with PEI in a ratio of 1:3 and transfected into 293T cells. After 2 days, the supernatant was collected, filtered, and fixed on the Protein A chip (Cytiva, 29127555) according to the preset capture program. The buffer used was PBST solution (PBS buffer containing 0.05% Tween 20, volume percentage).

[0158] (2) The cyclic peptides 6L3-3P11hR and 6L3-1F3P11hR were dissolved in DMSO and prepared into a 10 mM stock solution. Referring to the GE Healthcare Life Science Procedure 29264621AA method, 1.05×PBST (1.05×PBS buffer containing 0.05% Tween 20, volume percentage) and 5% DMSO PBST solution (1×PBS buffer containing 0.05% Tween 20, 5% DMSO volume percentage) were used to dilute the peptides stepwise, and the volume of each concentration was 100 μL.

[0159] (3) Using the single-cycle kinetics method, the sample position was displayed according to the pre-set program, the sample was added to the 96-well plate, the test solution flowed through the chip in sequence, and the real-time response value was recorded. The data was processed by BIAevaluation Version 4.1 (GE Healthcare) software, and the affinity of the cyclic peptides 6L3-3P11hR and 6L3-1F3P11hR with the RBD-Fc protein was calculated.

[0160] The results of surface plasmon resonance experiments to detect its binding affinity (nM) are as follows:

[0161] PT Delta BA.2 BO.1.1 XBB.1.5 JN.1 RaTG13 GD / 1 / 2019 6L3-3P11hR 45500 47800 4.07 3.17 4.69 4.73 65200 35100 6L3-1F3P11hR 30500 31900 3.55 1.81 3.05 3.15 45900 31500

[0162] The affinity constant of cyclic peptide 6L3-3P11hR and SARS-CoV-2PT RBD protein is 45500nM; the affinity constant of cyclic peptide 6L3-3P11hR and SARS-CoV-2Delta The affinity constant of the RBD protein is 47800nM; the affinity constant of the cyclic peptide 6L3-3P11hR and SARS-CoV-2BA.2RBD protein is 4.07nM; the affinity constant of the cyclic peptide 6L3-3P11hR and SARS-CoV-2BQ.1.1RBD protein is 3.17nM; the affinity constant of the cyclic peptide 6L3-3P11hR and SARS-CoV-2XBB.1.5RBD protein is 4.69nM; the affinity constant of the cyclic peptide 6L3-3P11hR and SARS-CoV-2JN.1RBD protein is 4.73nM; the affinity constant of the cyclic peptide 6L3-3P11hR and bat coronavirus RaTG13 is 4. The affinity constant of RBD protein is 65200nM, and the affinity constant of cyclic peptide 6L3-3P11hR and pangolin coronavirus GD / 1 / 2019RBD protein is 35100nM.

[0163] The affinity constant of cyclic peptide 6L3-1F3P11hR and SARS-CoV-2PT RBD protein is 30500nM; the affinity constant of cyclic peptide 6L3-1F3P11hR and SARS-CoV-2Delta The affinity constant of the RBD protein is 31900nM; the affinity constant of the cyclic peptide 6L3-1F3P11hR and SARS-CoV-2BA.2RBD protein is 3.55nM; the affinity constant of the cyclic peptide 6L3-1F3P11hR and SARS-CoV-2BQ.1.1RBD protein is 1.81nM; the affinity constant of the cyclic peptide 6L3-1F3P11hR and SARS-CoV-2XBB.1.5RBD protein is 3.05nM; the affinity constant of the cyclic peptide 6L3-1F3P11hR and SARS-CoV-2JN.1RBD protein is 3.15nM; the affinity constant of the cyclic peptide 6L3-1F3P11hR and bat coronavirus RaTG13 The affinity constant of RBD protein is 45900nM, and the affinity constant of cyclic peptide 6L3-1F3P11hR and pangolin coronavirus GD / 1 / 2019RBD protein is 31500nM.

[0164] The above data show that the cyclic peptides 6L3-3P11hR and 6L3-1F3P11hR have a strong affinity with the RBD of various variants of SARS-CoV-2. At the same time, the cyclic peptides have the ability to bind to bat coronavirus and pangolin coronavirus.

[0165] Example 6 Cyclic peptide tolerance to high temperature evaluation experiment

[0166] (1) One day before the experiment, trypsin was used to harvest the Vero cells in the logarithmic growth phase, counted, and re-seeded in a 96-well plate. After 18-24 hours, when the cell density reached 80-100%, it could be used for the experiment.

[0167] (2) On the day of the experiment, the Omicron (BF.7 pseudovirus) was taken out from -80°C and thawed on ice. The pseudovirus was then diluted to 1000 TU / 50 μL / well with complete culture medium (DMEM medium, 10% FBS).

[0168] (3) The cyclic peptide was heated at 160°C for 10 min, then taken out and diluted (initial concentration was 6.25 μM, 2 replicates, 4-fold dilution of 6L3-3P11hR and 6L3-1F3P11hR cyclic peptides, 11 gradients).

[0169] (4) Pour the diluted pseudovirus into a 10 cm cell culture dish, add it to a 96-well plate (1:1 with the cyclopeptide volume, i.e. 60 μL of diluted cyclopeptide + 60 μL of pseudovirus per replicate well), and mix once. Incubate the 96-well plate at 37°C for 1 hour; after the incubation time reaches 40-50 minutes, take out the Vero cells prepared in advance in the incubator, discard the cell supernatant, and add 100 μL of the mixture of cyclopeptide and virus. After incubation at 37°C for 15 hours, use the CQ1 microscope reading method to detect green fluorescence, take pictures, and count.

[0170] A blank control with only culture medium added and a challenge control with an equal amount of pseudovirus but no cyclic peptide were set up.

[0171] (5) Data analysis: Calculate the EC of each cyclic peptide using GraphPad 50 (Half maximum effect concentration, i.e., the concentration of the test substance that can cause 50% of the maximum effect in the efficacy experiment) The calculation method is inhibition rate = 1-(fluorescence number of the experimental group-fluorescence number of the blank control group) / (fluorescence number of the challenge control group-fluorescence number of the blank control group)*100(%).

[0172] The experimental results are as follows Fig.10 As shown in Figure 2, after heating at 160°C for 10 min, the cyclic peptides 6L3-3P11hR and 6L3-1F3P11hR both had good neutralizing activity against the pseudovirus of the BF.7 virus strain, and the EC 50 The results show that the thermal stability of cyclic peptides 6L3-3P11hR and 6L3-1F3P11hR is better than that of cyclic peptides 6L3-3P11hR and 6L3-1F3P11hR.

Claims

1. A cyclic peptide mutant, characterized in that: The cyclic peptide mutant before mutation is: Ac=acetyl; L Y = L-tyrosine; The cyclic peptide mutant includes amino acid modification, which occurs at any one or more amino acid sites. The amino acid modification enables the cyclic peptide mutant to have the property of resisting trypsin cleavage.

2. The cyclic peptide mutant according to claim 1, characterized in that The amino acid modification includes at least one modification type of adding carbon atoms, and the number of added carbon atoms is preferably 1.

3. The cyclic peptide mutant according to claim 2, characterized in that The amino acid modification includes: (1) cysteine ​​methylation; or (2) arginine replacement with homoarginine.

4. The cyclic peptide mutant according to claim 3, characterized in that The amino acid modification also includes: (3) L-tyrosine is replaced by L-phenylalanine.

5. The cyclic peptide mutant according to claim 4, characterized in that: The cyclic peptide mutant is selected from any one of the following: 1)6L3-3P11R12 Me The C sequence is: Ac=acetyl; L Y = L-tyrosine; Me C = methylated cysteine; Among them, Ac and L The amino group at the N-terminus of Y is connected, and the hydroxyl group in the carboxyl group of the last amino acid G at the C-terminus of the polypeptide chain is replaced by the amino group -NH2 to form an amide; 2) The sequence of 6L3-3P11hR is: Ac=acetyl; L Y = L-tyrosine; hR = homoarginine; Among them, Ac and L The amino group at the N-terminus of Y is connected, and the hydroxyl group in the carboxyl group of the last amino acid G at the C-terminus of the polypeptide chain is replaced by the amino group -NH2 to form an amide; The 6L3-1F3P11hR sequence is: Ac=acetyl; L F = L-phenylalanine; hR = homoarginine; Among them, Ac and L The hydroxyl group in the carboxyl group of the last amino acid G at the C-terminus of the polypeptide chain is replaced by the amino group -NH2 to form an amide.

6. Use of the cyclic peptide mutant according to any one of claims 1 to 5 in the preparation of coronavirus inhibitors.

7. The use according to claim 6, characterized in that: The coronavirus is a Sabei coronavirus; the Sabei coronavirus includes SARS-CoV-2 or a virus with a homology of more than 85% with SARS-CoV-2.

8. The use according to claim 7, characterized in that: The coronaviruses with more than 85% homology to SARS-CoV-2 include bat coronavirus RaTG13 or pangolin coronavirus GD / 1 / 2019.

9. The use according to claim 7, characterized in that: The coronavirus includes any one or more of the SARS-CoV-2 prototype strain or variant strain.

10. The use according to claim 9, characterized in that: The mutant strains include any one or more of Delta B.1.617.2, Omicron BA.1, Omicron BA.2, Omicron BA.4 / 5, Omicron BF.7, OmicronBQ.1, OmicronBQ.1.1, Omicron XBB, Omicron XBB.1.5, Omicron CH.1.1 and Omicron BA.2.

86.

11. Use of the cyclic peptide mutant according to any one of claims 1 to 5 in the preparation of a product for alleviating symptoms of infection caused by coronavirus.

12. The use according to claim 11, characterized in that: The symptoms of infection caused by the coronavirus include any one or more of respiratory tract infection symptoms, fever, muscle pain, diarrhea, joint pain, hypoxemia, general weakness, conjunctival congestion, tearing, dry and itchy eyes, increased eye secretions, nausea and vomiting, loss of appetite, chest tightness, and palpitations.

13. The use according to claim 12, characterized in that: The respiratory tract infection symptoms include any one or more of dry throat, sore throat, cough, nasal congestion, runny nose, pneumonia, and dyspnea.

14. A drug comprising the cyclic peptide mutant according to any one of claims 1 to 5.

15. The drug according to claim 14, characterized in that The dosage form of the drug includes gastrointestinal administration, injection administration, respiratory tract administration, and eye administration according to the administration method.

16. The drug according to claim 15, characterized in that The medicine also includes pharmaceutical excipients.

17. The drug according to claim 16, characterized in that The pharmaceutical excipients include any one or more of excipients, buffers, emulsifiers, stabilizers, diluents, adhesives, preservatives and lubricants.

18. A genetically engineered product for expressing, producing or delivering the cyclic peptide mutant according to any one of claims 1 to 5.

19. The genetically engineered product according to claim 18, characterized in that: Including nucleic acid molecules, expression vectors or genetically engineered cells.

Images