Droplet sorting and magnetic microsphere technology-based DNA tag library construction method
The DNA tag library is constructed through droplet sorting and magnetic microsphere technology, which solves the problems of insufficient label diversity and complex operation in traditional technology, and achieves high diversity, high accuracy and low cost DNA tag production, suitable for large-scale High-precision analysis requirements such as scale single-cell sequencing.
Patent Information
- Application Number
- CN202411637717.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-15
- Publication Date
- 2025-02-14
AI Technical Summary
Traditional DNA tag technology faces the problems of limited label diversity, complex operation, time-consuming and insufficient labeling accuracy, which is difficult to meet the needs of large-scale single-cell analysis.
Using DNA tag library construction methods based on droplet sorting and magnetic microsphere technology, the DNA tag template sequence fragments, dilution and PCR amplification were synthesized, and magnetic microspheres were used to capture and achieve high purity and high diversity through droplet sorting system. DNA tags for sex.
It significantly improves the diversity of labels to hundreds of millions of types, improves sample resolution capabilities, avoids label duplication and collision, improves the resolution and accuracy of high-throughput sequencing, and simplifies the operation process and reduces experimental costs.
Smart Images
Figure CN119432834A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of biotechnology, and in particular to a method for constructing a DNA tag library based on droplet sorting and magnetic microsphere technology. Background Art
[0002] With the rapid development of molecular biology, sequencing technology has entered a new stage. Tag technology plays a vital role in many cutting-edge sequencing fields, including single-cell sequencing, spatiotemporal transcriptomics, in situ sequencing, alternative splicing analysis, chromatin accessibility sequencing, epigenome sequencing, microbiome analysis, virus and pathogen sequencing, single microbial sequencing, and single microbial cross-species cross-omics sequencing. These technologies rely on high-resolution and high-precision tags to ensure accurate analysis of complex samples and diverse data.
[0003] However, traditional DNA labeling technology faces major bottlenecks. The label diversity of existing methods is usually only a few million, which can easily lead to label duplication and collision problems when dealing with large sample sizes. For example, in single-cell sequencing, label duplication may lead to data confusion and affect the analysis of intercellular heterogeneity; in virus sequencing, limited label diversity is not enough to cope with the labeling of a large number of virus particles, which may lead to virus mutations and errors in tracking transmission pathways. To meet the increasingly complex and diverse needs of biological research and to push sequencing technology to a higher level, it is urgent to develop a labeling technology that can provide higher accuracy and diversity.
[0004] The existing mainstream single-cell sequencing DNA tag production technology usually connects primers to the support carrier, then anneals the primers to form double-stranded DNA, phosphorylates the protruding base ends, and finally uses a ligase to connect the DNA tag sequence to the phosphorylated ends. To increase the diversity of tags, this process is usually repeated 2-4 times, ultimately generating about 3.8 million different DNA tags, which are suitable for diverse single-cell sequencing needs. Another traditional method is to use a specific DNA sequence as a template, and perform multiple rounds of PCR amplification by designing primers paired with the template to extend the DNA tag and increase its diversity.
[0005] Although these technologies have played an important role in advancing the field of single-cell sequencing, they also face the following challenges:
[0006] 1. Limited label diversity: Although diversity can be increased through ligase connection, the number of generated labels is still only about 3.8 million, which is difficult to meet the needs of large-scale single-cell analysis and easily leads to data conflicts and duplications.
[0007] 2. Complex and time-consuming operations: These methods all involve complex operations, including precise temperature control and multi-step chemical treatment, which increases the difficulty and time cost of the operation.
[0008] 3. Insufficient labeling accuracy: Due to the errors that may occur during multiple connections and annealing, existing methods cannot guarantee the uniqueness and accuracy of the DNA label sequence on each gel ball. This limits the resolution and accuracy of single-cell sequencing to a certain extent, and affects the accuracy of subsequent data analysis.
[0009] Therefore, developing a new tagging technology to improve accuracy, increase diversity and reduce costs has become an urgent issue. This technology will provide stronger support for current and future biological research and push sequencing technology to a higher level. Summary of the invention
[0010] In order to solve at least one of the above technical problems, the present application provides a method for constructing a DNA tag library based on droplet sorting and magnetic microsphere technology, comprising the following steps:
[0011] 1) Synthesizing DNA tag template sequence fragments to form DNA tag template suspension A;
[0012] 2) diluting the DNA tag template suspension A in step 1) to form a diluted DNA tag template suspension B;
[0013] 3) The suspension B, PCR amplification buffer, primer reagent and magnetic microsphere solution are divided into several equal parts respectively, and 1 part of the suspension B, 1 part of the PCR amplification buffer, 1 part of the primer reagent and 1 part of the magnetic microsphere solution are respectively taken and mixed to form oil-in-water droplets, until several oil-in-water droplets are formed, and the several oil-in-water droplets are dispersed in a solvent, and PCR reactions are performed in different droplets respectively to form PCR amplification magnetic microsphere reaction solution C, wherein the magnetic microspheres are used to capture the DNA tag sequence generated after PCR amplification;
[0014] 4) Purify the reaction solution C to obtain the DNA tag library.
[0015] The number of equal parts needs to be determined based on the separated and purified DNA tag template suspension B. It is only used here to describe the operation process of the technical solution, rather than to express a specific numerical value, and does not constitute a limitation on the technical solution of this application.
[0016] In some technical solutions of the present application, the method of synthesizing the DNA tag template sequence fragment in the above step 1) can be synthesized by a common synthesis method in the art, for example, the following method can be used for synthesis:
[0017] First, a DNA fragment containing a specified primer sequence and a random tag sequence is synthesized using solid phase synthesis technology. Then, the yield is increased through liquid phase reaction and purified. Finally, the synthesized DNA fragment is dissolved to form a DNA tag template suspension for subsequent experimental use.
[0018] 1. Solid-phase synthesis technology: In this process, each nucleotide of DNA is gradually added to a solid matrix (usually tiny glass or plastic beads). Each addition step will undergo a specific chemical reaction to ensure that the previous nucleotide is fully combined before proceeding to the next step of synthesis. This method can strictly control the reaction conditions, thereby ensuring high fidelity and low error rate.
[0019] 2. Liquid-phase synthesis combination: Based on solid-phase synthesis, liquid phase synthesis is used to increase the throughput and efficiency of synthesis. Liquid-phase synthesis can carry out more complex chemical reactions, including the synthesis of random sequences. It is very effective in synthesizing short DNA fragments (such as the random sequence of part b) on a larger scale. By combining the advantages of solid phase and liquid phase, the platform can achieve high-throughput and customized DNA synthesis, generating diverse sequences containing specific a, b, and c structures.
[0020] 3. Generation of random sequences: For the random label sequence of part b, it can be achieved through the "diversified base mixture" technology in liquid phase synthesis. Specifically, mixed nucleotides are used in the synthesis process to ensure that the generated DNA fragments are random in part b. At the same time, these platform synthesis methods can also adjust the length and base ratio of the random sequence to meet specific experimental requirements.
[0021] 4. High-throughput parallel synthesis: The synthesis platform is capable of synthesizing millions of different DNA sequences in parallel, and these synthesis processes are usually automated. Modern platforms use robotic operations and computer control to process samples, greatly improving efficiency and ensuring the synthesis quality and accuracy of each DNA sequence.
[0022] Through the above-mentioned label template synthesis method, the diversity of random sequences can theoretically reach 4 to the power of n, where n represents the number of bases in the label. The final number of synthesized labels can reach more than 100 million. Compared with traditional label generation methods, it greatly enriches the diversity of labels and can adapt to diverse single-cell sequencing needs.
[0023] In some technical solutions of the present application, the PCR amplification buffer in step 3) contains a nucleic acid dye.
[0024] In some technical solutions of the present application, the nucleic acid dye is selected from SYBR Green, SYTO-13, SYTO-82 and SYBR Gold.
[0025] Nucleic acid dyes bind tightly to double-stranded DNA, but hardly bind in a single-stranded state. After the droplet PCR is completed, the target tag exists in a double-stranded form, one of which is connected to the magnetic microspheres through a specific marker, and the other complementary chain is not connected to the magnetic microspheres. During the sorting and purification process, the droplets are treated with oil breaking, the double-stranded DNA is melted and annealed, one DNA chain connected to the magnetic microspheres is retained, and the other complementary chain and impurities such as unbound primers and nucleic acid dyes are thoroughly cleaned. In the end, a single-stranded DNA tag connected to the magnetic microsphere is obtained.
[0026] In this way, after separation and purification, the target DNA chain will maintain a high purity, ensuring the accuracy and reliability of subsequent experiments.
[0027] In some technical solutions of the present application, the primer reagent in step 3) contains a fluorescent group.
[0028] In some technical solutions of the present application, the fluorescent group in step 3) is selected from TaqMan probe.
[0029] In some technical solutions of the present application, the fluorescent reporter group on the TaqMan probe is selected from FAM, VIC, HEX, TET, JOE, ROX, CY3 and CY5, and the fluorescent quencher group is selected from BHQ and TAMRA.
[0030] The TaqMan probe contains two fluorescent dyes and a quencher, which are usually located at both ends of the probe. When the probe is not cut, the distance between the fluorescent dye and the quencher is very close, causing the quencher to absorb the fluorescence emitted by the fluorescent dye, making the signal almost invisible. During the PCR amplification process, Taq polymerase has 5' to 3' exonuclease activity, which can cut the TaqMan probe complementary to the template DNA. This cutting causes the fluorescent dye and quencher to separate, thereby releasing a fluorescent signal. As the PCR reaction proceeds, as the target DNA is amplified, the probe is continuously cut, releasing more fluorescent signals, and the amount of target DNA can be quantitatively analyzed by monitoring the changes in fluorescence intensity in real time.
[0031] In some technical schemes of the present application, the DNA tag template sequence fragment in step 1) comprises three parts, a, b and c, wherein part a is an upstream primer pairing sequence comprising 6-30 bases, part b is a random DNA tag sequence comprising 15-20 bases, and part c is a downstream primer pairing sequence comprising 6-30 bases.
[0032] In some technical solutions of the present application, the dilution principle in step 2) is to ensure that, among all the generated droplets, the droplets containing the DNA tag template sequence fragments satisfy the Poisson distribution λ=0.01-0.6.
[0033] In some technical solutions of the present application, the Poisson distribution λ is any value between 0.01-0.1, 0.1-0.2, 0.2-0.3, 0.3-0.4, 0.4-0.5, and 0.5-0.6. Preferably, the λ is any value between 0.01-0.1, 0.1-0.2, and 0.2-0.3. Further preferably, the λ is 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19 or 0.2.
[0034] By using the above-mentioned dilution principle, different labels can be dispersed as much as possible, so that each droplet contains at most one specific DNA label template sequence, and then a large number of specific DNA label template sequences can be obtained in the subsequent PCR reaction in the droplet.
[0035] In some technical solutions of the present application, the dilution buffer used in step 2) is TE buffer (Tris-EDTA) for maintaining the stability of DNA.
[0036] In some technical solutions of the present application, the surface of the magnetic microspheres in step 3) is modified with the same sequence as that in part c.
[0037] In some technical solutions of the present application, the surface of the above-mentioned magnetic microspheres is modified with a large number of sequences with the same c part, for example, any sequence between 10,000 and 100,000, any sequence between 100,000 and 1,000,000, or any sequence between 1,000,000 and 10,000,000.
[0038] By adopting the above technical method, magnetic microspheres modified with a large number of sequences can capture a large number of DNA tag sequences after PCR amplification, so that the same tag sequences can be enriched and purified.
[0039] In some technical schemes of the present application, the primer reagent in step 3) comprises an upstream primer a1 and a downstream primer c1, wherein the upstream primer a1 is complementary to part a in the DNA tag template sequence fragment, and the downstream primer c1 is complementary to part c in the DNA tag template sequence fragment.
[0040] In some technical solutions of the present application, the molar concentration ratio of the upstream primer a1 and the downstream primer c1 is 1-50:1, for example, it can be any ratio between 1-10:1, 10-20:1, 20-30:1, 30-40:1 or 40-50:1.
[0041] By adopting the above technical solution, in the initial stage, primers a1 and c1 act simultaneously to perform exponential amplification. When c1 is exhausted, the reaction turns into linear amplification, which mainly relies on primer a1. At this time, a large number of fragments with exposed c sequences will be generated. The label sequence generated by amplification will bind to the complementary sequence modified on the surface of the magnetic microsphere through the exposed c sequence and be fixed on the gel ball through PCR or ligase reaction.
[0042] In some technical solutions of the present application, the method of capturing the DNA tag sequence with the magnetic microspheres in step 3) is to complementarily pair the modified sequence on the surface of the magnetic microspheres with the DNA tag sequence amplified by PCR.
[0043] In some technical solutions of the present application, the amplification buffer in step 3) contains components required for PCR amplification, including DNA polymerase, dNTPs (200 μM each), MgCl 2 (1~2mM).
[0044] In some technical solutions of the present application, the method of forming a plurality of water-in-oil droplets in step 3) comprises the following steps:
[0045] 1) placing the diluted DNA tag template suspension B, PCR amplification buffer, primer reagent and magnetic microsphere solution in the reagent well slot of the microfluidic chip, placing the cutting oil in the cutting oil well slot, the well slots are independently provided with microfluidic channels, and finally all the microfluidic channels are gathered into a mainstream channel;
[0046] 2) Apply appropriate pressure to each well to ensure that each well can allow liquid to enter the microfluidic channel at a set flow rate;
[0047] 3) After the DNA tag template suspension, primer reagent, PCR amplification buffer and magnetic microsphere solution are merged in the mainstream channel, they are segmented by cutting oil to obtain a number of water-in-oil droplets, which are collected in the collection well.
[0048] In some technical solutions of the present application, each droplet contains at most one DNA tag template sequence fragment.
[0049] In some technical solutions of the present application, each droplet contains at most one magnetic microsphere.
[0050] In some technical solutions of the present application, each droplet contains a certain concentration of substances a1 / c1 and an amplification buffer.
[0051] By adopting the above technical solution, in the process of oil-water generation of droplets, due to the randomness of droplet generation, it is impossible to ensure that each droplet contains exactly one magnetic microsphere and one template DNA. Therefore, the following situations may occur:
[0052] 1.0 magnetic microspheres, 0 droplets of template DNA
[0053] 2.1 magnetic microsphere, 0 template DNA droplet
[0054] 3.0 magnetic microspheres, 1 droplet of template DNA
[0055] 4. 1 magnetic microsphere, 1 droplet of template DNA (droplet that meets the requirements).
[0056] By adopting the above technical solution, it is helpful to identify droplets that meet the requirements in the subsequent fluorescence identification and magnetic field screening process, thereby improving the purification effect and efficiency.
[0057] In some technical solutions of the present application, the above-mentioned microfluidic chip contains 1, 2, 3 or 4 reagent wells, preferably contains 2, 3 or 4 reagent wells.
[0058] When the microfluidic chip has two reagent wells, the PCR amplification buffer, the primer reagent and the DNA tag template suspension are preferentially mixed to obtain a mixed solution, and then the mixed solution and the magnetic microsphere solution are placed in the two reagent wells respectively.
[0059] When the microfluidic chip has three reagent wells, the PCR amplification buffer and the primer reagent are preferentially mixed to obtain a mixed solution, and then the DNA label template suspension B, the mixed solution and the magnetic microsphere solution are respectively placed in the three reagent wells.
[0060] When the microfluidic chip is filled with 4 reagent wells, the diluted DNA tag template suspension B, PCR amplification buffer, primer reagent and magnetic microsphere solution are placed in the 4 reagent wells of the microfluidic chip respectively.
[0061] In some technical solutions of the present application, the pressure in the appropriate pressure applied to each hole is usually selected from 10mBar-500mBar, ensuring that each hole can allow the liquid to enter the microfluidic channel at a set flow rate.
[0062] In some technical solutions of the present application, in step 3), a plurality of water-in-oil droplets are dispersed in a dispersion medium, and the dispersion medium is selected from cutting oil.
[0063] By adopting the above technical solution, oil-in-water droplets are dispersed in the cutting oil, and the oil-in-water droplets are in the dispersion medium. During the intra-droplet PCR process and the subsequent separation and purification process, the oil-in-water droplets can remain stable and independent of each other, which can not only realize large-scale PCR reactions, but also ensure that each specific DNA tag has a single and stable environment during the PCR process.
[0064] In some technical solutions of the present application, the PCR reaction conditions in the droplet in step 3) are set as follows:
[0065] Thermal Cycling Program:
[0066] 1. Pre-denaturation at 95°C for 3 minutes
[0067] 2. Denature at 95°C for 30 seconds
[0068] 3. Anneal at 60℃ for 30 seconds
[0069] 4.72℃ for 1 minute, cycle 30-35 times
[0070] 5. Final extension at 72°C for 5 minutes
[0071] In some technical solutions of the present application, the purification method in step 4) includes fluorescent recognition and magnetic screening.
[0072] In some technical solutions of the present application, the purification method in step 4) comprises the following steps:
[0073] 1) placing the PCR amplification magnetic microsphere reaction solution C in the main hole slot of the microfluidic chip, setting a mainstream pipeline under the main hole slot, and applying appropriate pressure to the main hole slot to stabilize the flow rate of the fluid in the mainstream pipeline;
[0074] 2) A fluorescence detection module is provided at an appropriate position of the mainstream channel, and a branch pipeline is provided at a downstream position of the fluorescence detection module, and a magnetic field module is provided at the branch;
[0075] 3) Perform fluorescence detection on each droplet after PCR amplification. If there is a fluorescence signal, the magnetic field module is activated to make the droplet containing the magnetic microsphere turn and enter the branch channel, and then enter the DNA tag sequence collection container through the branch channel. When no fluorescence signal is detected in the droplet, the magnetic field module is not activated, the direction of the droplet does not change, and the droplet continues to enter the recovery container through the mainstream channel;
[0076] 4) The oil-in-water droplets in the DNA tag sequence collection container are broken to release the magnetic microspheres and then subjected to magnetic cleaning to obtain the purified DNA tag sequence.
[0077] By adopting the above technical solution, the amplified DNA tags are captured by magnetic microspheres and combined with a droplet sorting system to ensure that the DNA tags in each droplet are unique and accurate. The system removes useless droplets through a dual screening mechanism of magnetic field and fluorescence, ensuring that the recovered DNA tags have extremely high purity and accuracy, which is particularly suitable for single-cell sequencing and other high-precision analysis needs.
[0078] The second aspect of the present application provides a DNA tag library obtained by the above technical solution.
[0079] The third aspect of the present application provides an application of a DNA tag library, wherein the application is selected from single-cell sequencing, spatiotemporal transcriptomics, in situ sequencing, alternative splicing analysis, chromatin accessibility sequencing, epigenome sequencing, microbiome analysis, virus and pathogen sequencing, single-microorganism sequencing, and single-microorganism cross-species cross-omics sequencing, preferably single-cell sequencing.
[0080] Beneficial Effects
[0081] 1. Extremely high label diversity: Traditional DNA labeling technology has limitations in generating diversity. It can usually only generate about a few million labels, which is difficult to adapt to the needs of large-scale samples and easily leads to label duplication and collision, affecting the accuracy of the experiment. This technical solution controls droplet generation through a microfluidic system and adjusts the DNA template concentration in combination with Poisson distribution to ensure that there is only one template DNA in each droplet. By combining random sequence design, the generated label diversity can reach hundreds of millions, significantly improving the sample resolution ability, effectively avoiding label duplication or collision, and thus improving the resolution and accuracy of high-throughput sequencing.
[0082] 2. High precision and purity: In traditional methods, multiple templates may be mixed into droplets during the labeling process, affecting the accuracy of experimental results. This solution uses magnetic microspheres to capture amplified DNA labels and combines them with a droplet sorting system to ensure that the DNA labels in each droplet are unique and accurate. The system uses a dual screening mechanism of magnetic field and fluorescence to remove useless droplets, ensuring that the recovered DNA labels have extremely high purity and accuracy, which is particularly suitable for single-cell sequencing and other high-precision analysis needs.
[0083] 3. Simplified operation process and high efficiency: Traditional DNA labeling technology involves multi-step operations, which are complicated and time-consuming. This solution simplifies the labeling process by combining droplet microfluidics technology and magnetic microspheres. Template introduction, PCR amplification, colloid capture and sorting are completed in one system, which significantly reduces the operation steps and experimental time. This automated operation process not only reduces the complexity of the operation, but also reduces potential operation errors, and improves the consistency and success rate of the experiment.
[0084] 4. Reduce experimental costs: In traditional methods, multiple PCR amplifications and complex chemical treatments require a large number of expensive reagents, especially in large-scale high-throughput experiments, the cost increases significantly. This technical solution reduces the use of reagents and consumables by reducing the amplification steps and using magnetic microspheres and droplet microfluidics to complete efficient screening. By simplifying the experimental process and equipment requirements, the overall experimental cost is significantly reduced, which is suitable for large-scale, high-throughput applications. BRIEF DESCRIPTION OF THE DRAWINGS
[0085] Figure 1 : is a schematic diagram of a microfluidic chip 1 used in the droplet formation process of the present application;
[0086] a: a schematic diagram of a microfluidic chip 1 (2 reagent wells) used in the droplet formation process of the present application; b: a schematic diagram of a microfluidic chip (3 reagent wells) used in the droplet formation process of the present application; c: a schematic diagram of a microfluidic chip (4 reagent wells) used in the droplet formation process of the present application;
[0087] Figure 2 : is a schematic diagram of the microfluidic chip 2 used in the purification process of this application;
[0088] Figure 3 : Schematic diagram of the purification process of this application. DETAILED DESCRIPTION
[0089] The present application is described in detail below through examples, but it is not intended to limit the present application in any adverse way. The present application has been described in detail herein, and its specific embodiments are also disclosed. It will be obvious to those skilled in the art that various changes and improvements can be made to the specific embodiments of the present application without departing from the spirit and scope of the present application.
[0090] Example 1 Construction of DNA tag library
[0091] 1. Experimental Reagents
[0092] 1) Dilution buffer: TE buffer
[0093] 2) Amplification buffer see Table 1
[0094] Table 1 Amplification buffer composition
[0095] Components concentration DNA polymerase 0.05U / μl dNTPs 0.5mM each MgCl2 2.5mM NaCl 30mM Tris-HCl pH 8.3 25mM SYBR Green dye 20μmol / L
[0096] 3) Primer reagents see Table 2
[0097] Table 2 Primer reagent composition
[0098] Components concentration Upstream primer a1: CTGACGTGTGCTCTTCCGAACT 6μM Downstream primer c1: ATGTCTCGTGGGCTCGGTAC 0.3μM
[0099] 4) Magnetic microsphere solution
[0100] Carboxyl magnetic beads (commercially available: BeyoMag TM Carboxyl Magnetic Beads (500 nm) were activated with EDC and NHS to couple the upstream primer a1 to obtain a magnetic microsphere solution.
[0101] 2. DNA tag library construction steps
[0102] 1) Synthesizing DNA tag template sequence fragments to form DNA tag template suspension A;
[0103] 2) diluting the DNA tag template suspension A in step 1) to form a diluted DNA tag template suspension B;
[0104] 3) Place the diluted DNA tag template suspension B, PCR amplification buffer, primer reagent and magnetic microsphere solution on the microfluidic chip 1 (see attached Figure 1 a), placing cutting oil in the cutting oil wells, each well independently setting a microfluidic pipeline, and finally all the microfluidic pipelines are gathered into a mainstream pipeline;
[0105] 4) Apply appropriate pressure to each well to ensure that each well can allow liquid to enter the microfluidic channel at a set flow rate;
[0106] 5) After the diluted DNA tag template suspension A, primer reagent, PCR amplification buffer and magnetic microsphere solution are merged in the mainstream channel, they are segmented by cutting oil to obtain a plurality of water-in-oil droplets, and the droplets are collected in a collection well, wherein the collection well contains cutting oil as a dispersion medium;
[0107] 6) performing PCR reaction in different droplets respectively to form PCR amplification magnetic microsphere reaction solution C;
[0108] 7) Return the PCR amplification magnetic microsphere reaction solution C to the microfluidic chip 2 (see the attached manual). Figure 2 In the main hole groove (shown in FIG. 1 ), a mainstream pipeline is arranged under the main hole groove, and appropriate pressure is applied to the main hole groove to stabilize the flow rate of the fluid in the mainstream pipeline;
[0109] 8) Performing fluorescence detection on each droplet in the PCR amplification magnetic microsphere reaction solution C. If a fluorescence signal is present, the magnetic field module is activated to make the droplet containing the magnetic microsphere turn and enter the branch channel, and then enter the DNA tag sequence collection container through the branch channel. When no fluorescence signal is detected in the droplet, the magnetic field module is not activated, the direction of the droplet does not change, and the droplet continues to enter the recovery container through the mainstream channel;
[0110] 9) The water-in-oil droplets in the DNA tag sequence collection container are broken to release the magnetic microspheres and then subjected to magnetic cleaning to obtain the purified DNA tag sequence.
Claims
1. A method for constructing a DNA tag library based on droplet sorting and magnetic microsphere technology, characterized in that: The steps include: 1) Synthesizing DNA tag template sequence fragments to form DNA tag template suspension A; 2) diluting the DNA tag template suspension A in step 1) to form a diluted DNA tag template suspension B; 3) The suspension B, PCR amplification buffer, primer reagent and magnetic microsphere solution are divided into several equal parts respectively, and 1 part of the suspension B, 1 part of the PCR amplification buffer, 1 part of the primer reagent and 1 part of the magnetic microsphere solution are respectively taken and mixed to form oil-in-water droplets, until several oil-in-water droplets are formed, and the several oil-in-water droplets are dispersed in a dispersion medium, and PCR reactions are performed in different droplets respectively to form a PCR amplification magnetic microsphere reaction solution C, wherein the magnetic microspheres are used to capture the DNA tag sequence generated after PCR amplification; 4) Purify the reaction solution C to obtain the DNA tag library.
2. The method for constructing a DNA tag library according to claim 1, characterized in that: The PCR amplification buffer in step 3) contains a nucleic acid dye, or the primer reagent in step 3) contains a fluorescent group.
3. The method for constructing a DNA tag library according to claim 1, characterized in that: The DNA tag template sequence fragment in step 1) comprises three parts: a, b and c, wherein part a is an upstream primer pairing sequence comprising 6-30 bases, part b is a random DNA tag sequence comprising 15-20 bases, and part c is a downstream primer pairing sequence comprising 6-30 bases.
4. The method for constructing a DNA tag library according to claim 1, characterized in that: The dilution principle in step 2) is to ensure that, among all the generated droplets, the droplets containing the DNA tag template sequence fragments satisfy the Poisson distribution λ=0.01-0.
6.
5. The method for constructing a DNA tag library according to claim 1, characterized in that: The surface of the magnetic microspheres in step 3) is modified with the same sequence as in part c.
6. The method for constructing a DNA tag library according to claim 1, characterized in that: The primer reagent in step 3) comprises an upstream primer a1 and a downstream primer c1, wherein the upstream primer a1 is complementary to part a of the DNA tag template sequence fragment, and the downstream primer c1 is complementary to part c of the DNA tag template sequence fragment.
7. The method for constructing a DNA tag library according to claim 6, characterized in that: The molar concentration ratio of the upstream primer a1 to the downstream primer c1 is 1 to 50:
1.
8. The method for constructing a DNA tag library according to claim 1, characterized in that: The method of forming a plurality of water-in-oil droplets in step 3) comprises the following steps: 1) placing the diluted DNA tag template suspension B, PCR amplification buffer, primer reagent and magnetic microsphere solution in the reagent well slot of the microfluidic chip, placing the cutting oil in the cutting oil well slot, the well slots are independently provided with microfluidic channels, and finally all the microfluidic channels are gathered into a mainstream channel; 2) Apply appropriate pressure to each well to ensure that each well can allow liquid to enter the microfluidic channel at a set flow rate; 3) After the DNA tag template suspension, primer reagent, PCR amplification buffer and magnetic microsphere solution are merged in the mainstream channel, they are segmented by cutting oil to obtain a number of water-in-oil droplets, which are collected in the collection well.
9. The method for constructing a DNA tag library according to claim 1, characterized in that: The purification method in step 4) includes fluorescence recognition and magnetic adsorption.
10. The method for constructing a DNA tag library according to claim 1, characterized in that: The purification method in step 4) comprises the following steps: 1) placing the PCR amplification magnetic microsphere reaction solution C in the main hole slot of the microfluidic chip, setting a mainstream pipeline under the main hole slot, and applying appropriate pressure to the main hole slot to stabilize the flow rate of the fluid in the mainstream pipeline; 2) A fluorescence detection module is provided at an appropriate position of the mainstream channel, and a branch pipeline is provided at a downstream position of the fluorescence detection module, and a magnetic field module is provided at the branch; 3) Perform fluorescence detection on each droplet after PCR amplification. If there is a fluorescence signal, the magnetic field module is activated to make the droplet containing the magnetic microsphere turn and enter the branch channel, and then enter the DNA tag sequence collection container through the branch channel. When no fluorescence signal is detected in the droplet, the magnetic field module is not activated, the direction of the droplet does not change, and the droplet continues to enter the recovery container through the mainstream channel; 4) The oil-in-water droplets in the DNA tag sequence collection container are broken to release the magnetic microspheres and then subjected to magnetic cleaning to obtain the purified DNA tag sequence.