Amplicon library building primer pool as well as preparation method and application thereof

Abstract

The invention relates to the field of high-throughput sequencing, in particular to an amplicon library building primer pool as well as a preparation method and application thereof. It is found that the uniformity of the sequencing depth value of the corresponding amplicons is improved by adjusting the primer dosage, the uniformity among the amplicons is optimized, and amplification deviation is reduced. Meanwhile, the method is short in consumed time, and does not need to specially design primers, so that the sequencing cost is favorably controlled.

Description

[0001] Cross-reference information

[0002] This application claims priority to Chinese patent application No. 2023109599506 filed on August 1, 2023, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present invention relates to the field of high-throughput sequencing, and in particular to an amplicon library construction primer pool, a preparation method and application thereof. Background Art

[0004] The second generation sequencing technology, also known as high-throughput sequencing technology, can perform sequence analysis on tens of thousands of nucleic acid molecules at the same time. Library construction is the basis of the second generation sequencing technology. The commonly used library construction methods are amplicon library construction and hybrid capture library construction. Amplicon library construction is to use multiple pairs of primers to simultaneously amplify the target sequence in the same reaction. Only two rounds of PCR and two steps of purification are needed to obtain the target region library. The first step of PCR is the combination of primers containing universal sequences with the target sequence, and the second step is to connect the sequencing adapter through PCR reaction for sequencing analysis.

[0005] Compared with the hybridization capture library construction method, the amplicon library construction method has low requirements for the starting amount of nucleic acid; the library construction process is simple to operate, takes a short time, and has strong specificity.

[0006] Since the amplicon library construction is based on multiplex PCR technology, amplification bias is prone to occur in PCR amplification, resulting in poor uniformity between amplicons.

[0007] To reduce amplification bias, PCR or qPCR can be used to quantify each amplicon, and the amount of primers can be adjusted according to the quantitative results to achieve the purpose of amplicon uniformity, but this method is cumbersome and takes a long time to operate. In addition, UMI sequences can be added to both ends of the library to analyze amplification bias, but this method is more expensive. Summary of the invention

[0008] The first purpose of the present invention is to provide a method for preparing a primer pool for amplicon library construction, designing primers for amplification reaction according to a target region, performing an amplification reaction, and sequencing and analyzing the amplified product; adjusting the starting amount of primers added for amplicon library construction based on the sequencing depth value of the amplicon corresponding to the primer, so as to improve the uniformity of the sequencing depth value of the amplicon corresponding to the primer.

[0009] In some embodiments, the above method can use the median ±30% of the sequencing depth value of each primer corresponding to the amplicon as the predetermined sequencing depth value, and adjust the primer amount of the corresponding primer whose sequencing depth value is less than or equal to the predetermined sequencing depth value.

[0010] In some embodiments, the above method can use one of a, b, and c as a reference sequencing depth value; wherein a is the median of the sequencing depth values ​​of the amplicons corresponding to each primer, b is the second third digit of the sequencing depth values ​​of the amplicons corresponding to each primer, and c is a value between a and b, and the reference sequencing depth value is greater than or equal to the predetermined sequencing depth value; the primer amount is adjusted according to the reference sequencing depth value so that the sequencing depth values ​​of the amplicons corresponding to each primer are the same or similar.

[0011] In some embodiments, the above method combines the reference sequencing depth value and the sequencing depth value of the amplicon corresponding to the primer to calculate the theoretical increase multiple of each primer; the primers whose dosage needs to be adjusted are partitioned by one or more partitioning methods selected from the following 1) to 2): 1) using any numerical value greater than or equal to (≥) 0 and less than or equal to (≤) 2000 as the maximum difference of the amplicon sequencing depth value in a primer partition, and partitioning the primers; 2) using any numerical value greater than or equal to 0 (≥) and less than or equal to (≤) 0.5 as the maximum difference of the theoretical increase multiple in a primer partition, and partitioning the primers; in each primer partition, calculating the average value of the theoretical increase multiple of the primers, using it as the actual increase multiple of all primers in the primer partition, and increasing the starting primer amount of each primer by the actual increase multiple.

[0012] In some embodiments, when the average value of the theoretical increase fold in a primer partition is greater than 5, a value less than or equal to (≤) the average value is selected within the range of 5 to 10 as the actual increase fold of each primer in the primer partition.

[0013] In some embodiments, the theoretical increase multiple is calculated using the following formula:

[0014] Theoretical increase factor = 1-sequencing depth value of the amplicon corresponding to the primer / reference sequencing depth value; or,

[0015] Theoretical increase factor = reference sequencing depth value / sequencing depth value of the amplicon corresponding to the primer - 1.

[0016] In some embodiments, the above amplification reaction can be a multiplex amplification reaction; preferably, using Multiplex PCR Master Mix was used for multiplex amplification reactions.

[0017] In some specific embodiments, the number of cycles of the multiplex amplification reaction is 15±3. In some preferred embodiments, the number of cycles of the multiplex amplification reaction is 15.

[0018] The second object of the present invention is to provide an amplicon library construction primer pool, which is prepared by the above-mentioned preparation method.

[0019] The third object of the present invention is to provide a method for improving the uniformity of amplicons, which comprises: preparing an amplicon library construction primer pool by adopting the above-mentioned preparation method.

[0020] Furthermore, the above-mentioned amplicon library construction primer pool can be used to perform amplicon amplification reaction.

[0021] The fourth object of the present invention is to provide a library construction kit, which contains the above-mentioned amplicon library construction primer pool.

[0022] Furthermore, the above kit may also include a multiplex PCR amplification enzyme, a library enrichment polymerase and a library enrichment primer.

[0023] In one embodiment, the multiplex PCR amplification enzyme is Multiplex PCR Master Mix.

[0024] The fifth object of the present invention is to provide a library construction method, which comprises: using the above-mentioned amplicon library construction primer pool or the above-mentioned library construction kit to amplify the target region, purifying the amplified product, and obtaining a purified product.

[0025] Further, the method may include amplifying the purified product using library enrichment primers to obtain an amplicon library, and purifying the amplicon library.

[0026] In some embodiments, the amplification is a multiplex amplification reaction; preferably, the number of cycles of the multiplex amplification reaction is 15±3. In some preferred embodiments, the number of cycles of the multiplex amplification reaction is 15.

[0027] The sixth object of the present invention is to provide a library obtained by the above-mentioned library construction method.

[0028] The seventh object of the present invention is to provide an amplicon library sequencing method, which comprises: using the above-mentioned library construction method to construct an amplicon library, and then sequencing it on a machine.

[0029] The present invention finds that by adjusting the amount of primers used to improve the uniformity of the sequencing depth of the corresponding amplicon, it is beneficial to optimize the uniformity between amplicons and reduce amplification deviation. At the same time, the method is time-consuming, convenient and fast, and does not require special primer design, so it is also beneficial to control sequencing costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 It is a histogram of the sequencing depth of amplicon of the three primer partitioning schemes in the embodiment of the present invention. DETAILED DESCRIPTION

[0032] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0033] Unless otherwise indicated, the meaning of all terms (including technical and scientific terms) used to disclose the present invention is the same as that commonly understood by those of ordinary skill in the art to which the present invention belongs. By way of further guidance, the following definitions are used to better understand the teachings of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0034] As used herein, the terms "comprising", "including" and "comprising" are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements or method steps.

[0035] The term "amplicon library construction primer pool" used in the present invention refers to a primer set used for library construction, which is usually a primer set designed for a target region. By using the amplicon library construction primer pool for PCR amplification, the target region DNA can be enriched, and then an amplicon library can be constructed and high-throughput sequencing can be performed.

[0036] The term "sequencing depth of an amplicon" used in the present invention refers to the number of times each amplicon is tested. In the analysis of the sequencing results of the library, the sequencing depth of the amplicon corresponding to each pair of primers is analyzed to obtain the sequencing depth value of the amplicon corresponding to the primer.

[0037] The terms "theoretical increase fold" and "actual increase fold" used in the present invention are based on the original volume of the corresponding primers in the primer pool.

[0038] The term "median" used in the present invention is also called the median, which is a special term in statistics. It is the number in the middle position of a set of data arranged in order. It represents a value in a sample, population or probability distribution, which can divide the set of values ​​into two equal upper and lower parts.

[0039] The term "second tertile" used in the present invention means that after all the values ​​in the sample are arranged from small to large, the sequence is divided into three equal parts by two tertiles, wherein the second tertile (i.e. the tertile with a relatively larger value) is the second tertile.

[0040] The term "Mean Depth" used in the present invention represents the average sequencing depth of amplicons. "0.2×MeanDepth" represents the proportion of amplicons with a sequencing depth greater than 20% of the average sequencing depth. The larger the 0.2×Mean Depth, the more amplicons have a sequencing depth greater than 20% of the average sequencing depth.

[0041] The term "Fold80" used in the present invention represents the multiple of additional sequencing required to increase 80% of the bases to the average sequencing depth. The closer Fold80 is to 1, the better the uniformity of the amplicon.

[0042] The term "target region" used in the present invention refers to the region to be sequenced, which is often a genomic region related to the research object. Selectively sequencing these regions will significantly reduce the total sequencing cost and also shorten the sequencing time. The amplicon can be determined based on the target region.

[0043] Numerical ranges expressed as endpoints herein include all numbers and fractions subsumed within the range, as well as the recited endpoints.

[0044] The meaning of the numerical values ​​involved in the present invention includes fluctuations within a certain range. For example, it can fluctuate within the corresponding precision range. For example, 1μL can allow fluctuations within the range of ±0.1%. For numerical values ​​that are large or do not require too fine control, their meanings are also allowed to include greater fluctuations. For example, 50μL can allow fluctuations within the range of ±1%, ±2%, ±5%, etc.

[0045] The present invention first provides a method for preparing a primer pool for amplicon library construction, designs primers for amplification reaction according to a target region, performs amplification reaction, and performs sequencing analysis on the amplification product; based on the sequencing depth value of the amplicon corresponding to the primer, the starting amount of primers added for amplicon library construction is adjusted to improve the uniformity of the sequencing depth of the amplicon corresponding to the primer.

[0046] The "improving the uniformity of sequencing depth values ​​of amplicons corresponding to primers" mentioned therein includes but is not limited to: improving the uniformity of sequencing depth values ​​of amplicons corresponding to as many primers as possible (such as 45%, 50%, 75%, 80%, 90%, 95%, 98%, 99%, 100%, etc.) in the primer pool for amplicon library construction; and / or improving the uniformity of sequencing depth values ​​of amplicons corresponding to primers, such as making the difference ±30%, ±20%, ±15%, ±10%, ±5%, ±3%, ±1%, 0, etc.

[0047] In some embodiments, the median of the sequencing depth values ​​of the amplicons corresponding to each primer is ±30% as the predetermined sequencing depth value, and the primer amount of the primer whose sequencing depth value is less than or equal to (≤) the predetermined sequencing depth value is adjusted. The present invention further finds that by only adjusting the uniformity of the sequencing depth values ​​of the amplicons corresponding to the primers within the above range, the amplification deviation can be well reduced, and at the same time, it is beneficial to further improve the preparation efficiency.

[0048] In some embodiments, one of a, b, and c is used as a reference sequencing depth value; wherein a is the median of the sequencing depth values ​​of the amplicon corresponding to each primer, b is the second third digit of the sequencing depth values ​​of the amplicon corresponding to each primer, and c is a value between a and b, and the reference sequencing depth value is greater than or equal to (≥) the predetermined sequencing depth value; the primer amount is adjusted according to the reference sequencing depth value so that the sequencing depth values ​​of the amplicon corresponding to each primer are the same or similar. The present invention further finds that the uniformity of the amplicon is better when the above values ​​are used as the reference sequencing depth value.

[0049] In some embodiments, the theoretical increase multiple of each primer is calculated in combination with the reference sequencing depth value and the sequencing depth value of the amplicon corresponding to the primer; the primers that need to be adjusted in amount are partitioned by one or more partitioning methods selected from the following 1) to 2): 1) using an arbitrary value greater than or equal to 0 and less than or equal to 2000 (preferably greater than or equal to 0 and less than or equal to 1200, more preferably greater than or equal to 0 and less than or equal to 1000) as the maximum difference of the sequencing depth value of the amplicon in a primer partition, the primer is partitioned; 2) using an arbitrary value greater than or equal to 0 and less than or equal to 0.5 as the maximum difference of the theoretical increase multiple in a primer partition, the primer is partitioned; in each primer partition, the average value of the theoretical increase multiple of the primer is calculated, which is used as the actual increase multiple of all primers in the primer partition, and the primer amount of each primer is increased by the actual increase multiple. Through the above method, it is further beneficial to take into account both the amplification effect and the preparation efficiency.

[0050] The "one or more partitioning methods" mentioned above means that the above-mentioned partitioning method 1) or 2) can be used in a primer partitioning scheme; it is also possible to use only method 1) in a primer partitioning scheme, but use multiple different values ​​as the maximum difference in amplicon sequencing depth values ​​in a primer partition, thereby dividing multiple partitions; it is also possible to use only method 2) in a primer partitioning scheme, but use multiple different values ​​as the maximum difference in theoretical increase multiples in a primer partition, thereby dividing multiple partitions; it is also possible to use a combination of method 1) and method 2) in a primer partitioning scheme.

[0051] The situation where the maximum difference in amplicon sequencing depth values ​​in a primer partition is equal to 0 means that the primer partition contains only one primer, or contains more than two primers with the same amplicon sequencing depth value.

[0052] In some embodiments, when the average value of the theoretical increase fold in a primer partition is greater than 5, a value less than or equal to the average value is selected in the range of 5 to 10 as the actual increase fold of each primer in the primer partition.

[0053] In some embodiments, the theoretical increase fold is calculated using the following formula: theoretical increase fold = reference sequencing depth value / sequencing depth value of the amplicon corresponding to the primer - 1; or, theoretical increase fold = reference sequencing depth value / sequencing depth value of the amplicon corresponding to the primer - 1.

[0054] In some embodiments, the amplification reaction is a multiplex amplification reaction; preferably, using Multiplex PCR Master Mix was used for multiplex amplification reactions.

[0055] In some embodiments, the number of cycles of the multiplex amplification reaction is 15±3. In some preferred embodiments, the number of cycles of the multiplex amplification reaction is 15.

[0056] The present invention does not impose any particular limitation on the fixed adapter sequence and the specific primer sequence of each primer in the primer pool for building the amplicon library.

[0057] As a specific implementation scheme, the fixed sequence added to the 5' end of the upstream primer of each primer in the amplicon library primer pool is: ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 1), and the fixed sequence added to the 5' end of the downstream primer is: GTGACTGGAGTTCAGACG TGTGCTCTTCCGATCT (SEQ ID NO: 2).

[0058] In specific implementation, those skilled in the art can select or combine the above-mentioned implementation schemes in combination with common sense to obtain specific examples of the method for preparing the primer pool for amplicon library construction in the present invention.

[0059] The present invention also provides an amplicon library construction primer pool, which is prepared by the above preparation method. The above primer pool for amplicon library construction can be a primer pool after adjusting the starting amount of each primer for amplicon library construction according to the above method.

[0060] The present invention also provides a method for improving the uniformity of amplicon, comprising: preparing an amplicon library primer pool using the above-mentioned preparation method. Further, the amplicon library primer pool can be used to perform an amplicon amplification reaction. The amplification reaction product can also be purified. Further, library enrichment primers can be added to enrich the above-mentioned purified product and further purify it. The purified library is sequenced and analyzed, and the sequencing depth of the amplicon corresponding to each primer in the obtained amplicon library will tend to be consistent, that is, the uniformity of the amplicon is improved.

[0061] The present invention also provides a library construction kit, which contains the above-mentioned amplicon library construction primer pool. In some embodiments, the multiplex PCR amplification enzyme can be Multiplex PCR Master Mix, KAPA 2GFast multiplex, etc. In the present invention, the multiplex PCR amplification enzyme is preferably Multiplex PCRMaster Mix is ​​more conducive to improving amplification results.

[0062] The present invention does not particularly limit other reagents in the library construction kit. Those skilled in the art can further add one or more of library enrichment polymerase, library enrichment primers, and DNA purification magnetic beads to the library construction kit based on common sense.

[0063] In some embodiments, the library construction kit further includes a multiplex PCR amplification enzyme, a library enrichment polymerase, and a library enrichment primer.

[0064] As a specific embodiment, the library construction kit contains the amplicon library construction primer pool, Multiplex PCR Master Mix, GC Enhancer, KAPA HiFi HotStart Ready Mix, library enrichment primers, and DNA purification magnetic beads.

[0065] The present invention also provides a library construction method, which comprises: using the above-mentioned amplicon library construction primer pool or the above-mentioned library construction kit to amplify the target region, purifying the amplified product to obtain a purified product.

[0066] The present invention does not specifically limit other components and their amounts in the multiplex amplification reaction system. Those skilled in the art can add DNA, multiplex PCR amplification enzymes (such as Multiplex PCR Master Mix), GC enhancer and ultrapure water, and adjust the dosage of each component.

[0067] As an example, in a specific embodiment, each 50 μL of the multiplex amplification reaction system contains: 25 μL Multiplex PCR Master Mix, 1-4 μL of the amplicon library construction primer pool (primer concentration is 1-3 μM), 20 ng DNA, 5 μL GC enhancer and ultrapure water.

[0068] In some embodiments, the number of cycles of the multiplex amplification reaction is 15 ± 3. By optimizing the number of cycles of the multiplex amplification reaction, the uniformity of the amplicons can be further improved.

[0069] The present invention does not specifically limit other conditions in the multiple amplification reaction, and those skilled in the art can set the temperature and time of the amplification reaction based on common sense.

[0070] As an example, in a specific embodiment, the conditions of the multiple amplification reaction are: 95°C, 2 min, 1 cycle; 95°C, 30s, 60°C, 4 min, 15 cycles; 72°C, 10 min, 1 cycle.

[0071] The present invention does not particularly limit other steps involved in the library construction method. Those skilled in the art can purify the multiple primer amplification products after the multiple amplification reaction and perform a library enrichment reaction according to common sense, and then purify the library enrichment products.

[0072] The present invention also provides a library, which is obtained by the above-mentioned library construction method.

[0073] The present invention also provides a sequencing method, which comprises: using the above-mentioned library construction method to construct an amplicon library, and then sequencing on a machine.

[0074] The present invention does not particularly limit other steps involved in the sequencing method. Those skilled in the art can confirm the specific operations of sequencing on a machine after constructing an amplicon library based on common sense.

[0075] Embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are preferably referred to the guidance provided in the present invention, and can also be based on the experimental manual or normal conditions in this area, and can also be based on other experimental methods known in the art, or according to the conditions recommended by the manufacturer.

[0076] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0077] The instruments and reagents involved in each example are shown in Table 1.

[0078] Table 1 Instruments and reagents

[0079]

[0080]

[0081] Example 1 Primer design and amplicon homogeneity analysis of primer pool 1

[0082] 1.1 Design and synthesize primer sequences

[0083] The primer sequences were designed using the NGS multiplex amplification primer design online tool https: / / www.genscript.com.cn / multiplex-pcr-oligo.html developed by Nanjing GenScript Biotechnology Co., Ltd., and fixed adapter sequences were added to both ends of the primers. The fixed sequence added to the upstream primer was: ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 1), and the fixed sequence added to the downstream primer was: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQID NO: 2). Each primer consisted of a fixed adapter sequence and a specific primer sequence. The sequences of the 70 pairs of primers designed are shown in Table 2. The primers were purchased from Nanjing GenScript Biotechnology Co., Ltd.

[0084] Table 2 Information of 70 pairs of primers containing fixed adapter sequences in primer pool 1

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091] 1.2 Selection of polymerase for multiplex amplification reactions

[0092] 70 primer pairs were diluted and mixed to a final concentration of 2 μM for each primer to prepare primer pool 1. Multiplex PCR Assay Kit purchased from Takara and Multiplex PCR MasterMix was used for multiplex amplification reaction. The multiplex PCR Assay Kit multiplex amplification system and reaction conditions are shown in Tables 3 and 4. The multiplex PCR Master Mix multiplex amplification system and reaction conditions are shown in Table 5 and Table 6. After the multiplex amplification reaction is completed, the multiplex amplification products are subjected to magnetic bead purification, library enrichment and library purification, respectively, and the specific steps are the same as those in Example 3.

[0093] Table 3 Multiplex PCR Assay Kit multiple amplification reaction system

[0094] Components Amount added per reaction 2×Multiplex PCR Buffer 25μL Primer pool 1 2μL Multiplex PCR Enzyme Mix 0.25μL NA12777 20ng Ultrapure water Make up the volume to 50 μL Total volume 50μL

[0095] Table 4 Multiplex PCR Assay Kit multiple amplification reaction PCR program

[0096]

[0097] Table 5 Multiplex PCR Master Mix

[0098]

[0099] Table 6 Multiplex PCR Master Mix Multiplex PCR Program

[0100]

[0101] The libraries were subjected to next-generation sequencing and bioinformatics analysis to obtain the sequencing depth of the amplicon corresponding to each primer pair. The results are shown in Table 7. The Fold 80 of library 1 and library 2 were 55.87 and 2.76, respectively. The uniformity of the amplicons in Multiplex PCR Master Mix is ​​better. 0.2×Mean Depth indicates the proportion of sequencing depth higher than 20% of the average sequencing depth. The 0.2×Mean Depth of Library 1 and Library 2 are 39.80% and 90.86% respectively. Multiplex PCR MasterMix amplification reactions had more amplicons whose sequencing depths were above 20% of the average sequencing depth.

[0102] Table 7 Library analysis results

[0103]

[0104] The above mixed primer pool 1 was used, KAPA 2G Fast multiplex PCR Kit purchased from KAPA and Multiplex PCR Master Mix was used for multiple amplification reaction. Two cycles of 15 and 19 were selected for amplification reaction. The multiple amplification system and reaction conditions of KAPA 2G Fast multiplex PCR Kit are shown in Tables 8 and 9. The multiplex PCR Master Mix multiplex amplification system and reaction conditions are shown in Table 10 and Table 11. After the multiplex amplification reaction is completed, the multiplex amplification products are subjected to magnetic bead purification, library enrichment and library purification, respectively, in the same steps as in Example 3.

[0105] Table 8 KAPA 2G Fast multiplex PCR Kit multiple amplification reaction system

[0106]

[0107]

[0108] Table 9 KAPA 2G Fast multiplex PCR Kit multiple amplification reaction PCR program

[0109]

[0110] Table 10 Multiplex PCR Master Mix

[0111]

[0112] Table 11 Multiplex PCR Master Mix Multiplex PCR Program

[0113]

[0114]

[0115] The libraries were subjected to next-generation sequencing and bioinformatics analysis to obtain the sequencing depth of the amplicon corresponding to each primer pair. The results are shown in Table 12. When the number of cycles of the multiplex PCR amplification reaction was 15, the Fold 80 of library 3 and library 5 were 5.34 and 2.81, respectively. The uniformity of the amplicons in Multiplex PCR Master Mix was better. The 0.2×MeanDepth of Library 3 and Library 5 were 78.51% and 87.85%, respectively. The amplification reaction of Multiplex PCR Master Mix has more amplicons whose sequencing depth is above 20% of the average sequencing depth. When the number of cycles of the multiplex PCR amplification reaction is 19, the Fold 80 of library 4 and library 6 are 5.70 and 3.38 respectively. The uniformity of the amplicons in Multiplex PCR Master Mix was better. The 0.2×Mean Depth of Library 4 and Library 6 were 75.66% and 85.99%, respectively. The amplification reaction of Multiplex PCR Master Mix had more amplicons whose sequencing depth was above 20% of the average sequencing depth.

[0116] So the following use Multiplex PCR Master Mix is ​​used as the polymerase for multiplex amplification reactions.

[0117] Table 12 Library analysis results

[0118]

[0119] 1.3 Selection of the number of cycles for multiplex amplification reactions

[0120] Pipette 1 μL of the mixed primer pool 1 and use Multiplex PCR Master Mix was used for multiplex PCR amplification reaction, and 15, 19 and 25 were used as the cycle numbers, respectively. The library was constructed and sequenced and analyzed. The library construction steps, sequencing and bioinformatics analysis methods are shown in Example 3, and the bioinformatics analysis results are shown in Table 13. The results show that when the number of cycles of the multiplex amplification reaction increases, Fold 80 increases, that is, the higher the number of cycles, the worse the uniformity. When the number of cycles of the multiplex amplification reaction increases, the lower 0.2×MeanDepth is, that is, the higher the number of cycles, the fewer amplicons above the average sequencing depth of 20%. Therefore, 15 was subsequently selected as the number of cycles for the multiplex amplification reaction.

[0121] Table 13 Library analysis results

[0122] Library ID Number of cycles Fold 80 0.2×Mean Depth(%) Library 5 15 2.81 87.85 Library 6 19 3.38 85.99 Library 7 25 4.65 80.03

[0123] 1.4 Adjust the amount of primers in primer pool 1

[0124] According to the second-generation sequencing and bioinformatics analysis results of library 5, the sequencing depth of the amplicon corresponding to each pair of primers was analyzed, and the sequencing depth of the amplicon corresponding to each pair of primers was arranged from high to low according to Table 14. The concentration of the corresponding primers in the primer pool was adjusted according to the sequencing depth of the amplicon. The median of the sequencing depth of the amplicon of library 5 was 3362.875. The sequencing depth values ​​of the amplicon corresponding to primers 1-41 and 1-25 were 4293.6 (approximately equal to 3362.875×(1+27.68%)) and 2762 (approximately equal to 3362.875×(1-17.87%)) as the predetermined sequencing depth values, and the primer amounts of primers with sequencing depth values ​​less than or equal to the predetermined sequencing depth values ​​were adjusted. In actual operation, the primers that need to be adjusted can be partitioned, and any value from 0 to 1200 is used as the maximum difference in the amplicon sequencing depth value in a primer partition. As shown in Table 14, the amplicon sequencing depth value differences of 145.45 (corresponding to partition B), 295.95 (corresponding to partition C), 311.3 (corresponding to partition A), 392 (corresponding to partition D), 528.7 (corresponding to partition G, J), 819.65 (corresponding to partition H, K), 910.8 (corresponding to partition E, I, L), and 1140.7 (corresponding to partition F) are used respectively. Combined with the selection of the aforementioned predetermined sequencing depth value, the primers that need to be adjusted are divided into three partitioning schemes. As shown in the following table, primer partitioning scheme 1, primer partitioning scheme 2, and primer partitioning scheme 3 start adjusting from the first primer of partition A, partition F, and partition J, i.e., 1-25, 1-41, and 1-25, respectively. The amplicon sequencing depth bar graphs of the three primer partitioning schemes are shown in Figure 1 .

[0125] The calculation of the primer dosage increase multiple can use the median as the reference sequencing depth value, and the median sequencing depth of the amplicon of library 5 is 3362.875. In addition, since the sequencing depth of the amplicon of primers 1-9, 1-19, 1-4, and 1-14 is too low, the primers are divided into three parts in sequence after excluding this region. The sequencing depth value of the 1 / 3 position (i.e., the second third digit) sorted from high to low can also be used as the reference sequencing depth value for adjusting the primer dosage, that is, the sequencing depth of the amplicon corresponding to primers 1-5, 4745.15, is used as a reference for the primer dosage increase multiple. At the same time, the value 3788.47 between the median and the second third digit can also be used as the reference sequencing depth value to adjust the primer dosage.

[0126] In the primer dosage adjustment scheme 1, the primer partitioning scheme 2 is used to increase the primer dosage starting from primers 1-41, and the theoretical increase multiple = 1-sequencing depth of the amplicon / 4745.15.

[0127] In the primer dosage adjustment scheme 2, the primer partitioning scheme 1 is used to increase the primer dosage from primers 1-25, and the theoretical increase factor = 3362.875 / sequencing depth of the amplicon - 1.

[0128] In the primer dosage adjustment scheme 3, the primer partitioning scheme 1 is used to increase the primer dosage from primers 1 to 25, and the theoretical increase factor = 3788.47 / sequencing depth of the amplicon - 1.

[0129] In the primer dosage adjustment scheme 4, the primer partitioning scheme 3 is used to increase the primer dosage from primers 1 to 25, and the theoretical increase factor = 4745.15 / sequencing depth of the amplicon - 1.

[0130] The actual increase factor is the average of the theoretical increase factors of each partition, and the actual increase factor is used to adjust the primer amount of each partition. The actual increase factor of partition E is 40.97, the actual increase factor of partition I is 46.28, and the actual increase factor of partition L is 58.22. Based on experience and test results, increasing the primer according to the actual adjustment factor of the region will lead to excessive adjustment of the primer, so 5 is used as the actual primer increase factor of the partition.

[0131] Table 14 Library analysis results and primer amount adjustment method

[0132]

[0133]

[0134]

[0135] According to the primer adjustment scheme, on the basis of the original primer pool 1, the primers to be adjusted are added respectively, and the increased volume of each pair of primers is: theoretical increase multiple × the volume of the pair of primers in the original primer pool. The primers are added and mixed respectively to prepare a new primer pool, and library construction and sequencing analysis are performed respectively. The library construction and analysis method steps are the same as in Example 3, and the results are shown in Table 15. After adjustment by primer dosage adjustment scheme 1, the Fold80 of library 8 is reduced to 2.22, and 0.2×Mean Depth is increased to 93.47%. After adjustment by primer dosage adjustment scheme 2, the Fold 80 of library 9 is reduced to 1.62, and 0.2×Mean Depth is increased to 96.19%. After adjustment by primer dosage adjustment scheme 3, the Fold 80 of library 10 is reduced to 1.81, and 0.2×Mean Depth is increased to 96.65%. After adjustment using primer dosage adjustment scheme 4, Fold 80 of library 11 was reduced to 1.58, and 0.2×Mean Depth was increased to 96.19%.

[0136] As shown in Table 15, adjusting the primer dosage starting from sequencing depths of 4293.6 and 2762 can effectively improve the uniformity of amplification. Using the median and the second tertile as references for primer adjustment multiples can increase the uniformity of amplicons. In addition, using a value between the median and the second tertile, 3788.47, as a reference sequencing depth value can also increase the uniformity of amplicons.

[0137] Table 15 Library analysis results

[0138] Library ID Primer dosage adjustment plan Fold 80 0.2×Mean Depth(%) Library 8 Solution 1 2.22 93.47 Library 9 Solution 2 1.62 96.19 Library 10 Solution 3 1.81 96.65 Library 11 Solution 4 1.58 96.19

[0139] Example 2 Primer design and amplicon homogeneity analysis of primer pool 2

[0140] To further optimize the amplicon uniformity method, the primer sequences were designed using the NGS multiplex amplification primer design online tool https: / / www.genscript.com.cn / multiplex-pcr-oligo.html developed by Nanjing GenScript Biotechnology Co., Ltd. Fixed adapter sequences were added to both ends of the primers. The fixed sequence added to the upstream primer was: ACACTCTTTCCCTACACGACGCTCTTCCGATCT, and the fixed sequence added to the downstream primer was: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT. Each primer consisted of a fixed adapter sequence and a specific primer sequence. The sequences of the 64 pairs of primers are shown in Table 16. The primers were purchased from Nanjing GenScript Biotechnology Co., Ltd.

[0141] Table 16 64 pairs of primer sequences containing fixed linker sequences

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148] 2.1 Analysis of amplicon homogeneity of primer pool 2

[0149] Dilute and mix 64 pairs of primers to a final concentration of 2 μM for each primer to prepare primer pool 2. Pipette 1 μL of primer pool 2 and use Multiplex PCR Master Mix was used for multiple amplification reaction, and the multiple primer amplification system and reaction conditions are shown in Tables 21 and 22. The multiple primer amplification products were subjected to magnetic bead purification, library enrichment and library purification, respectively, and the specific steps were as described in Example 3. The obtained library was subjected to sequencing analysis and bioinformatics analysis (the analysis method refers to Example 3), and the results are shown in Table 17 for Library 12. The Fold 80 of primer pool 2 was 2.70, and the 0.2×Mean Depth was 89.77%.

[0150] Table 17 Library analysis results

[0151] Library ID Fold 80 0.2×Mean Depth(%) Library 12 2.70 89.77

[0152] 2.2 Adjust the primer amount of primer pool 2

[0153] According to the results of the second-generation sequencing and bioinformatics analysis of library 12, the sequencing depth of the amplification region corresponding to each pair of primers was analyzed, and the sequencing depth of the amplification region corresponding to each pair of primers was arranged from high to low according to Table 18. Primer pool 2 was analyzed using primer adjustment scheme 2 of primer pool 1, the median of the sequencing depth of the amplicon of primer pool 2 was calculated, and the theoretical increase multiple of each pair of primers was calculated using the median. Theoretical increase multiple = median sequencing depth / sequencing depth of the amplicon-1. The maximum difference in the sequencing depth value of the amplicon within a primer partition was controlled to be less than or equal to 2000, and the maximum difference in the theoretical increase multiple of the primer was less than or equal to 0.5. Each partition used the actual increase multiple to adjust the primer dosage of the partition, and the actual increase multiple was the average of the theoretical increase multiple of each partition. Since the adjustment multiples of partition H' to partition L' differed greatly, according to experience and test results, in order to avoid excessive adjustment, 5 times, 8 times or 10 times were selected to adjust the primers in this region, respectively, as shown in the primer adjustment scheme in the following table.

[0154] Table 18 Library analysis results and primer amount adjustment method

[0155]

[0156]

[0157]

[0158] The mixed primers were diluted according to the primer adjustment scheme, and 2 μL was taken from each primer pool for library construction and sequencing analysis. The library construction steps and analysis methods were the same as those in Example 3. The library sequencing results are shown in Table 19. Compared with before adjustment, the Fold 80 of library 13 was reduced to 1.83, and the 0.2× Mean Depth was increased to 98.28%, and the Fold 80 of library 16 was reduced to 1.90, and the 0.2× Mean Depth was increased to 99.89%. The primer dosage adjustment method can effectively increase the uniformity of the amplicon and improve the sequencing depth of the amplicon.

[0159] Table 19 Library analysis results

[0160] Library ID Primer adjustment scheme Fold 80 0.2×Mean Depth(%) Library 13 Solution 1 1.83 98.28 Library 16 Solution 2 1.90 99.89

[0161] Example 3 Multiplex PCR library construction steps

[0162] 3.1 Amplicon library construction kit

[0163] Table 20 Kit components

[0164]

[0165] 3.2 Multiplex amplification reaction

[0166] Take out the primer pool mixture, thaw it on ice, shake and mix, and centrifuge it instantaneously;

[0167] Will Multiplex PCR Master Mix and GC Enhancer were taken out in advance and thawed on ice, mixed by vortexing, and centrifuged briefly;

[0168] Prepare the multiple amplification system according to Table 21, shake and mix, and centrifuge briefly;

[0169] Table 21 Multiplex amplification reaction system

[0170]

[0171]

[0172] Place in a PCR instrument and run the program in Table 22 (heat cover temperature is set to 105°C);

[0173] Table 22 Multiplex amplification reaction program

[0174]

[0175] 3.3 Purification after multiple primer amplification

[0176] Remove the magnetic beads and place them at room temperature for at least 30 minutes to equilibrate. Meanwhile, calculate and prepare the required 80% ethanol according to the number of reactions. Each reaction requires 450 μL of freshly prepared 80% ethanol.

[0177] Oscillate the magnetic beads until they are fully mixed;

[0178] After the PCR reaction is completed, take out the amplified product and add 50 μL of magnetic beads to each reaction tube;

[0179] Vortex to mix, and incubate at room temperature for 10-15 minutes;

[0180] Place the centrifuge tube on a magnetic stand until the liquid becomes clear;

[0181] Use a pipette to aspirate the supernatant and discard it, being careful not to aspirate the magnetic beads;

[0182] Keep the centrifuge tubes on the magnetic rack, add 200 μL 80% ethanol to each centrifuge tube, incubate at room temperature for 30 seconds, aspirate the supernatant with a pipette and discard it, being careful not to aspirate the magnetic beads;

[0183] Keep the centrifuge tubes on the magnetic rack, add 200 μL 80% ethanol to each centrifuge tube, incubate at room temperature for 30 seconds, aspirate the supernatant with a pipette and discard it, being careful not to aspirate the magnetic beads;

[0184] Keep the centrifuge tube on the magnetic rack and place it at room temperature until the surface of the magnetic beads is dry;

[0185] Remove the centrifuge tubes from the magnetic rack and add 22 μL of ultrapure water to each centrifuge tube;

[0186] Vortex to mix, and incubate at room temperature for 5 minutes;

[0187] Place the centrifuge tube on a magnetic stand until the liquid becomes clear;

[0188] Transfer 20 μL to a new centrifuge tube, making sure not to aspirate the magnetic beads.

[0189] 3.4 Library enrichment reaction

[0190] Take out KAPA HiFi HotStart Ready Mix and place it on ice to thaw, shake and mix, and centrifuge briefly;

[0191] The library enrichment primers were taken out and placed on ice to melt, vortexed to mix, and centrifuged instantaneously; the library enrichment primers were purchased from Nanjing GenScript Biotechnology Co., Ltd., the upstream primer sequence was: CAAGCAGAAGACGGCA TACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGT (SEQ ID NO: 271) sequence, and the downstream primer sequence was: AATGATACGGCGACCACCGAGATCTACACXXXXX XXXACACTCTTTCCCTACACGAC (SEQ ID NO: 272), where XXXXXXXX is the sample tag sequence.

[0192] Place the centrifuge tube on ice and prepare the library enrichment mixture according to Table 23;

[0193] Table 23 Library enrichment reaction system

[0194] Components Amount added per reaction KAPA HiFi HotStart Ready Mix 25μL Library enrichment primer F (10 μM) 2.5μL Library enrichment primer R (10 μM) 2.5μL Magnetic bead-purified DNA 20μL Total volume 50μL

[0195] Mix by shaking and centrifuge briefly;

[0196] Place the centrifuge tube in a PCR instrument and run the PCR amplification program in Table 24 below (the temperature of the hot cover of the PCR instrument is set to 105° C.):

[0197] Table 24 Library enrichment reaction conditions

[0198]

[0199]

[0200] 3.5 Library purification after enrichment

[0201] Remove the magnetic beads and place them at room temperature for at least 30 minutes to equilibrate. Meanwhile, calculate and prepare the required 80% ethanol according to the number of reactions. Each reaction requires 450 μL of freshly prepared 80% ethanol.

[0202] Oscillate the magnetic beads until fully mixed;

[0203] After the PCR reaction is completed, take out the amplified product and add 50 μL of magnetic beads to each reaction tube;

[0204] Vortex to mix, and incubate at room temperature for 10-15 minutes;

[0205] Place the centrifuge tube on a magnetic stand until the liquid becomes clear;

[0206] Use a pipette to aspirate the supernatant and discard it, being careful not to aspirate the magnetic beads;

[0207] Keep the centrifuge tubes on the magnetic rack, add 200 μL 80% ethanol to each centrifuge tube, incubate at room temperature for 30 seconds, aspirate the supernatant with a pipette and discard it, being careful not to aspirate the magnetic beads;

[0208] Keep the centrifuge tubes on the magnetic rack, add 200 μL 80% ethanol to each centrifuge tube, incubate at room temperature for 30 seconds, aspirate the supernatant with a pipette and discard it, being careful not to aspirate the magnetic beads;

[0209] Keep the centrifuge tube on the magnetic rack and place the magnetic beads at room temperature until the surface of the magnetic beads is dry;

[0210] Remove the centrifuge tubes from the magnetic rack and add 22 μL of ultrapure water to each centrifuge tube;

[0211] Vortex to mix, and incubate at room temperature for 5 minutes;

[0212] Place the centrifuge tube on a magnetic stand until the liquid becomes clear;

[0213] Transfer 20 μL of supernatant to a new centrifuge tube, and be careful not to absorb the magnetic beads. The obtained library can be used for subsequent second-generation sequencing analysis and bioinformatics analysis, align the obtained reads to the reference gene, and analyze the sequencing depth of each amplicon.

[0214] From the results of the above embodiments of the present invention, at least the following conclusions can be drawn:

[0215] Amplicon uniformity can be optimized by adjusting the primer amount;

[0216] Taking the median ±30% of the sequencing depth value of the amplicon corresponding to each primer as the predetermined sequencing depth value, adjusting the primer amount of the primer whose sequencing depth value is less than or equal to the predetermined sequencing depth value can effectively increase the uniformity of the amplicon;

[0217] The median, the second third and the value between the median and the second third can be used as a reference for primer increase fold, which can effectively improve the uniformity of the amplicon;

[0218] The primer partitions can be adjusted in sections, and the amplicon sequencing depth can be used as the basis for adjustment. Any value greater than or equal to 0 and less than or equal to 2000 is used as the maximum difference of the amplicon sequencing depth value in a primer partition. The primers are partitioned to take into account both the amplification effect and the adjustment efficiency.

[0219] The primer partitions can be adjusted in sections, and the theoretical increase multiple can be used as the basis for adjustment. Any value greater than or equal to 0 and less than or equal to 0.5 can be used as the maximum difference of the theoretical increase multiple in a primer partition. The primers can be partitioned to take into account both the amplification effect and the adjustment efficiency.

[0220] Using the average value of primer increase multiples in primer partitioning as the actual primer adjustment multiple can take into account both amplification effect and adjustment efficiency;

[0221] When the average value of the theoretical increase factor in the primer partition is greater than 5, selecting a value less than or equal to the average value in the range of 5 to 10 as the actual increase factor of each primer in the primer partition can effectively increase the uniformity of the amplicon;

[0222] Develop an amplicon library construction kit that can make amplicons more uniform;

[0223] Optimizing the number of cycles in multiplex amplification reactions can make the amplicons more uniform.

[0224] The implementation of the present invention is not limited to the above-mentioned embodiments. Without departing from the spirit and scope of the present invention, ordinary technicians in this field can make various changes and improvements to the present invention in form and detail, and these are considered to fall within the protection scope of the present invention.

Claims

1. A method for preparing a primer pool for amplicon library construction, characterized in that: Primers for amplification reaction are designed according to the target region, amplification reaction is carried out, and sequencing analysis is performed on the amplification products; based on the sequencing depth value of the amplicon corresponding to the primer, the starting amount of primers added to the amplicon library is adjusted to improve the uniformity of the sequencing depth value of the amplicon corresponding to the primer.

2. The method for preparing a primer pool for amplicon library construction according to claim 1, wherein: The median of the sequencing depth value of the amplicon corresponding to each primer is ±30% as the predetermined sequencing depth value, and the primer amount of the corresponding primer whose sequencing depth value is less than or equal to the predetermined sequencing depth value is adjusted.

3. The method for preparing the primer pool for amplicon library construction according to claim 2, wherein: One of a, b, and c is used as a reference sequencing depth value; wherein a is the median of the sequencing depth values ​​of the amplicons corresponding to each primer, b is the second third digit of the sequencing depth values ​​of the amplicons corresponding to each primer, c is a value between a and b, and the reference sequencing depth value is greater than or equal to the predetermined sequencing depth value; The primer amounts are adjusted according to the reference sequencing depth value so that the sequencing depth values ​​of the amplicons corresponding to the primers are the same or similar.

4. The method for preparing the primer pool for amplicon library construction according to claim 3, wherein: The theoretical increase factor of each primer is calculated by combining the reference sequencing depth value and the sequencing depth value of the amplicon corresponding to the primer; Partitioning the primers whose dosages need to be adjusted by one or more partitioning methods selected from the following 1) to 2): 1) using any value greater than or equal to 0 and less than or equal to 2000 as the maximum difference in amplicon sequencing depth values ​​in a primer partition to partition the primers; 2) using any value greater than or equal to 0 and less than or equal to 0.5 as the maximum difference of theoretical increase fold in a primer partition, and partitioning the primers; In each primer partition, the average value of the theoretical increase fold of the primers is calculated and used as the actual increase fold of all primers in the primer partition, and the starting primer amount of each primer is increased by the actual increase fold.

5. The method for preparing a primer pool for amplicon library construction according to claim 4, wherein: When the average value of the theoretical increase fold in the primer partition is greater than 5, a value less than or equal to the average value is selected within the range of 5 to 10 as the actual increase fold of each primer in the primer partition.

6. The method for preparing a primer pool for amplicon library construction according to claim 4 or 5, wherein: The theoretical increase multiple is calculated using the following formula: Theoretical increase factor = 1-sequencing depth value of the amplicon corresponding to the primer / reference sequencing depth value; or, Theoretical increase factor = reference sequencing depth value / sequencing depth value of the amplicon corresponding to the primer - 1.

7. The method for preparing a primer pool for amplicon library construction according to any one of claims 1 to 6, wherein: The amplification reaction is a multiplex amplification reaction; preferably, using Multiplex PCR Master Mix was used for multiplex amplification reactions.

8. The method for preparing a primer pool for amplicon library construction according to claim 7, wherein: The number of cycles for the multiplex amplification reaction was 15 ± 3.

9. A primer pool for amplicon library construction, prepared by the preparation method according to any one of claims 1 to 8.

10. A method for improving amplicon uniformity, comprising: The method according to any one of claims 1 to 8 is used to prepare a primer pool for amplicon library construction.

11. The method for improving amplicon uniformity according to claim 10, further comprising: The amplicon library construction primer pool is used to perform an amplicon amplification reaction.

12. A library construction kit comprising the amplicon library construction primer pool according to claim 9.

13. The library construction kit according to claim 12, further comprising a multiplex PCR amplification enzyme, a library enrichment polymerase and a library enrichment primer.

14. The library construction kit according to claim 12, wherein the multiplex PCR amplification enzyme is Multiplex PCR Master Mix.

15. A library construction method, comprising: The target region is amplified using the amplicon library construction primer pool according to claim 9 or the library construction kit according to any one of claims 12 to 14, and the amplified product is purified to obtain a purified product.

16. The library construction method according to claim 15, further comprising: The purified product is amplified using library enrichment primers to obtain an amplicon library, and the amplicon library is purified.

17. The library construction method according to claim 15 or 16, wherein: The amplification is a multiplex amplification reaction; preferably, the number of cycles of the multiplex amplification reaction is 15±3.

18. A library obtained by the library construction method according to any one of claims 15 to 17.

19. A sequencing method comprising: The amplicon library is constructed by the library construction method described in any one of claims 15 to 17, and then sequenced on a sequencing machine.

Images