Method for detecting staphylococcus aureus in food

Abstract

The invention discloses a method for detecting staphylococcus aureus in food, which comprises the following steps: step 1, mixing and incubating a staphylococcus aureus aptamer solution and a colloidal gold solution, then adding a NaCl solution, uniformly mixing and reacting to obtain a mixed solution; step 2, mixing and incubating the mixed solution and a to-be-detected sample solution, then adding a silicon-coated CsPbBr3 quantum dot solution, and uniformly mixing and reacting to obtain a determination precursor solution; and 3, measuring a fluorescence signal of the measurement precursor solution. According to the method, detection can be realized by using a fluorescence spectrometer, the detection range is 1-106 CFU / mL, and the detection limit is 0.56 CFU / mL. According to the invention, the silicon-coated perovskite quantum dot material is used as a fluorescence signal unit for the first time, the detection sensitivity is greatly improved, the method is suitable for a water system, and the limitation of sample types is broken through. In addition, the method does not need strain culture and has the advantages of short time consumption, simplicity and convenience in operation and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of biosensors, and in particular relates to a method for detecting Staphylococcus aureus in food. Background Art

[0002] Staphylococcus aureus is a common foodborne pathogen that can produce a variety of virulence factors, such as enterotoxins, membrane-damaging toxins, and invasive enzymes. These toxic substances enter the human body through food and cause acute gastroenteritis, vomiting, diarrhea, and other symptoms. Therefore, the detection of Staphylococcus aureus is of great significance for preventing its harm.

[0003] At present, the main detection methods for Staphylococcus aureus include enrichment culture method, immunological method, molecular biological method, etc. These methods have the disadvantages of slow response speed, long operation time, poor sensitivity and specificity, and rely on pre-culture and pre-processing, which is not conducive to the instant and rapid detection of food. Therefore, a detection method with high sensitivity, strong specificity and simple operation is needed to solve the limitations of existing methods. Summary of the invention

[0004] In view of the defects and shortcomings in the prior art, the purpose of the present invention is to provide a new method for detecting Staphylococcus aureus using a fluorescence spectrometer. The method utilizes the adsorption characteristics of colloidal gold and the fluorescence characteristics of perovskite quantum dots to achieve convenient and quick detection of Staphylococcus aureus. At the same time, the method utilizes silicon to encapsulate perovskite quantum dots, which solves the defect that perovskite has poor water stability and is difficult to be applied to food detection.

[0005] To achieve the above object, the technical solution of the present invention is as follows:

[0006] A method for detecting Staphylococcus aureus in food comprises the following steps: step 1: mixing and incubating a Staphylococcus aureus aptamer solution with a colloidal gold solution, then adding a NaCl solution for mixing and reaction to obtain a mixed solution; step 2: mixing and incubating the mixed solution with a sample solution to be tested, then adding a silicon-encapsulated CsPbBr3 quantum dot solution for mixing and reaction to obtain a measurement precursor solution; step 3: measuring the fluorescence signal of the measurement precursor solution.

[0007] In some embodiments of the present invention, the detection is a quantitative detection, and the detection method further comprises the steps of preparing a standard curve and performing quantitative analysis according to the standard curve.

[0008] In some embodiments of the present invention, the steps of preparing a standard curve and performing quantitative analysis according to the standard curve specifically include: preparing standard solutions of Staphylococcus aureus with different concentrations, mixing and incubating the mixed solution with standard solutions of different concentrations, then adding a silicon-encapsulated CsPbBr3 quantum dot solution for mixing and reaction, detecting the fluorescence intensity of the solution after the reaction, and establishing a standard curve based on the linear relationship between the fluorescence intensity and the concentration of Staphylococcus aureus; substituting the fluorescence intensity of the measured precursor solution into the standard curve to calculate the content of Staphylococcus aureus in the sample solution to be tested.

[0009] In some embodiments of the present invention, the concentration of the colloidal gold solution in step 1 is 1.0-20.0 μM, the concentration of the aptamer solution is 1.0-30.0 nM, and the concentration of the NaCl solution is 10.0-100.0 mM.

[0010] In some embodiments of the present invention, the concentration of the silicon-encapsulated CsPbBr3 quantum dot solution in step 2 is 5.0-10.0 mM.

[0011] In some embodiments of the present invention, when forming the assay precursor solution, the volume ratio of the colloidal gold solution, the aptamer solution, the NaCl solution, the sample solution to be tested and the silicon-encapsulated CsPbBr3 quantum dot solution is (200-400):(0.5-1.5):(100-200):(5-20):(20-40).

[0012] In some embodiments of the present invention, the temperature of the mixed incubation in step 1 and step 2 is 25-50° C., and the time is 2-30 min, respectively.

[0013] In some embodiments of the present invention, the temperature of the mixing reaction in step 1 and step 2 is 25-50° C., and the time is 2-30 min.

[0014] In some embodiments of the present invention, the preparation method of the silicon-encapsulated CsPbBr3 quantum dots is: cesium bromide, lead bromide, oleylamine, oleic acid and ammonia water are mixed and dissolved in a DMF solution to obtain a mixed solution, the mixed solution is added to a mixture of TEOS and toluene, and the reaction is carried out at room temperature for 2 hours, the product is collected and washed and dried to obtain the silicon-encapsulated CsPbBr3 quantum dots.

[0015] In some embodiments of the present invention, the mass ratio of the cesium bromide to the lead bromide is (1-2):(3-4).

[0016] In some embodiments of the present invention, the volume ratio of the oleylamine, the oleic acid and the ammonia water is (1-3):(3-6):(1-2).

[0017] In some embodiments of the present invention, the volume ratio of the TEOS to the toluene is 1:(120-150).

[0018] In some embodiments of the present invention, the food comprises milk and beverages.

[0019] Beneficial effects:

[0020] The present invention proposes a new method for detecting Staphylococcus aureus in food, which can be detected by using a fluorescence spectrometer with a detection range of 1 to 10 6 CFU / mL, and the detection limit is 0.56 CFU / mL. This method uses silicon-encapsulated perovskite quantum dot materials as fluorescent signal units for the first time, which greatly improves the detection sensitivity and is applicable to water systems, breaking through the limitations of sample types. In addition, this method can detect Staphylococcus aureus without the need for bacterial culture, and has the advantages of short time consumption and simple operation. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is a schematic diagram of the detection method of Staphylococcus aureus of the present invention.

[0022] Figure 2 1 is a transmission electron microscope image of the colloidal gold prepared in Example 1, wherein A is a high-magnification image and B is a low-magnification image.

[0023] Figure 3 This is the ultraviolet absorption spectrum of colloidal gold.

[0024] Figure 4 This is a transmission electron microscope image of the silicon-encapsulated perovskite quantum dots prepared in Example 1.

[0025] Figure 5 It is the fluorescence spectrum of the silicon-encapsulated perovskite quantum dots prepared in Example 1, wherein A is the fluorescence absorption spectrum and B is the fluorescence emission spectrum.

[0026] Figure 6 It is the fluorescence performance curve of silicon-encapsulated perovskite and perovskite materials in aqueous solution.

[0027] Figure 7 Zeta potential diagram of silicon-coated perovskite, colloidal gold, and colloidal gold combined with aptamer.

[0028] Figure 8 This is the detection of different concentrations of standard Staphylococcus aureus liquid in Example 2, wherein A is the detection fluorescence spectrum and B is the standard detection curve.

[0029] Fig. 9 This is Example 3 for the detection of Staphylococcus aureus in milk.

[0030] Fig.10This is Example 4 for the detection of Staphylococcus aureus in carbonated beverages. DETAILED DESCRIPTION

[0031] The following is a more detailed description of the present invention in conjunction with the following embodiments. It should be understood that the implementation of the present invention is not limited to the following embodiments, and any modifications and / or changes made to the present invention will fall within the scope of protection of the present invention.

[0032] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application may be combined with each other.

[0033] In the following examples, unless otherwise specified, the reagents, materials and equipment used can be purchased from commercial sources, or prepared by conventional methods, or commonly used in the industry. Unless otherwise specified, all percentages are in mass units.

[0034] Staphylococcus aureus, as a foodborne pathogen, can cause food contamination and food poisoning at any stage from food production to consumption. Accurate and rapid detection of Staphylococcus aureus is the basis for guiding patients to receive appropriate treatment in the early stages of infection and preventing the spread of Staphylococcus aureus. Traditional detection methods, such as enrichment culture, immunological methods, molecular biological methods, etc., have the disadvantages of slow response speed, long operation time, poor sensitivity and specificity, and rely on pre-culture and pre-treatment, which is not conducive to the immediate and rapid detection of food. Fluorescent biosensors based on fluorescent materials have become a detection tool that has attracted much attention in recent years due to their advantages of high sensitivity, selectivity, real-time monitoring and visualization. In the bacterial liquid environment, traditional fluorescent materials such as rhodamine will directly bind to bacterial proteins or DNA for staining and cannot be effectively detected. The biggest problem of some commonly used inorganic quantum dot materials such as carbon quantum dots, cadmium telluride quantum dots, and silicon quantum dots is that the fluorescence is easily affected by salt solutions, resulting in the limitation of applicable food samples. In addition, nanomaterials such as carbon quantum dots, cadmium telluride quantum dots, and silicon quantum dots also have the defects of requiring high temperature conditions for reaction and complex synthesis operations. In addition, some fluorescent materials cannot exist stably in aqueous solutions. Since food matrices generally contain a lot of water, they cannot be used for the detection of food samples.

[0035] Based on this, the present application provides a method for detecting Staphylococcus aureus in food, aiming to solve the problems of cumbersome operation, low sensitivity and inability to be applied to food samples of traditional detection methods. The present invention cuts into two aspects: the selection of fluorescent materials and the improvement of the water stability of fluorescent materials, and develops a new fluorescent biosensor detection method that can be used for food sample detection.

[0036] The following is a more detailed description of the detection method in the example.

[0037] The present application provides a method for detecting Staphylococcus aureus in food, comprising the following steps:

[0038] Step 1: Mix the Staphylococcus aureus aptamer solution and the colloidal gold solution for incubation, then add the NaCl solution for mixing and reaction to obtain a mixed solution;

[0039] Step 2: The mixed solution is mixed with the sample solution to be tested and incubated, and then the silicon-encapsulated CsPbBr3 quantum dot solution is added and mixed to obtain a test precursor solution;

[0040] Step 3: Measure the fluorescence signal of the assay precursor solution.

[0041] Specifically, please combine Figure 1 The detection principle of the present invention is: when there is no target, the aptamer combines with colloidal gold to protect the colloidal gold, so that the colloidal gold is dispersed in the NaCl solution, and electrostatic adsorption occurs between the colloidal gold and the silicon-encapsulated CsPbBr3 quantum dots, causing the fluorescence of the silicon-encapsulated CsPbBr3 quantum dots to be quenched; when there is a target, the target specifically binds to the aptamer, pulling the aptamer on the colloidal gold away, and under the action of NaCl, the surface charge of the colloidal gold that loses protection is affected to form aggregates, and the formed aggregates will not electrostatically adsorb with the silicon-encapsulated CsPbBr3 quantum dots, the fluorescence quenching ability is weakened, and the fluorescence is enhanced. The change in fluorescence intensity can be used to determine whether Staphylococcus aureus is present in the sample.

[0042] The present invention creatively uses the fluorescence characteristics of perovskite CsPbBr3 quantum dots and the high selectivity of aptamers to the target to achieve high sensitivity and high specificity detection of Staphylococcus aureus. Compared with traditional inorganic semiconductor quantum dots, perovskite quantum dots have higher fluorescence quantum efficiency (PLQY), wider adjustable emission wavelength range, simple synthesis, low cost and other advantages, which greatly improves the detection sensitivity and reduces the detection cost. In addition, perovskite quantum dots will not bind to the protein or DNA of the bacteria to dye, ensuring the applicability and accuracy of the detection. Furthermore, the present invention uses silicon to encapsulate CsPbBr3 quantum dots, so that the modified perovskite quantum dots can be stably present in aqueous solution, so that they can be applied to the detection of food samples such as milk and beverages. The fluorescent material used in the present invention comprehensively considers the source of fluorescence signals in the bacterial liquid environment and the salt ion environment, and takes the characteristics of the food sample into consideration, providing a simple, fast, efficient and accurate detection scheme for Staphylococcus aureus in food.

[0043] Further, in some embodiments of the present invention, the sequence of the aptamer is CCCCCCAGTCCGTCCTCCCAGCCTCACACCAAAAAAAAA, and the aptamer can specifically bind to Staphylococcus aureus and identify Staphylococcus aureus in the sample. The amount of the aptamer coated on the colloidal gold surface has a specific relationship with the fluorescence value. Specifically, the fewer Staphylococcus aureus in the sample, the more nanogold in a dispersed state in the NaCl solution, and the more nanogold electrostatically adsorbed with silicon-encapsulated CsPbBr3 quantum dots, the more obvious the fluorescence quenching, and vice versa. Among them, the aptamer is diluted to a specific concentration with Tris-HCl buffer when used.

[0044] In some embodiments of the present invention, the detection is quantitative detection, and the detection method further includes the steps of preparing a standard curve and performing quantitative analysis according to the standard curve. The present invention uses the relationship between the concentration of Staphylococcus aureus bacterial solution and the detection signal to achieve quantitative analysis of the target bacteria, which is the key to constructing a new detection method. Silicon-encapsulated CsPbBr3 quantum dots can be used as a good converter to convert the bacterial solution concentration into a fluorescent signal output, thereby achieving highly sensitive quantitative detection.

[0045] Specifically, in some embodiments of the present invention, the steps of preparing a standard curve and performing quantitative analysis according to the standard curve include:

[0046] Prepare standard solutions of Staphylococcus aureus with different concentrations, mix and incubate the mixed solutions with standard solutions with different concentrations, then add silicon-encapsulated CsPbBr3 quantum dot solution to mix and react, detect the fluorescence intensity of the solution after the reaction, and establish a standard curve based on the linear relationship between the fluorescence intensity and the concentration of Staphylococcus aureus;

[0047] The fluorescence intensity of the assay precursor solution is substituted into the standard curve to calculate the content of Staphylococcus aureus in the sample solution to be tested.

[0048] Specifically, in some embodiments of the present invention, the established standard curve regression equation is Y=105.99logC+1215.35, wherein Y is the fluorescence intensity value of the solution, and C is the concentration of Staphylococcus aureus in the sample.

[0049] In some embodiments of the present invention, the concentration of the colloidal gold solution in step 1 is 1.0-20.0 μM, more preferably 8.5 μM, the concentration of the aptamer solution is 1.0-30.0 nM, more preferably 10.0 nM, and the concentration of the NaCl solution is 10.0-100.0 mM, more preferably 50.0 mM.

[0050] In some embodiments of the present invention, the concentration of the silicon-encapsulated CsPbBr3 quantum dot solution in step 2 is 5.0-10.0 mM.

[0051] In some embodiments of the present invention, when forming the assay precursor solution, the volume ratio of the colloidal gold solution, the aptamer solution, the NaCl solution, the sample solution to be tested and the silicon-encapsulated CsPbBr3 quantum dot solution is (200-400):(0.5-1.5):(100-200):(5-20):(20-40).

[0052] In some embodiments of the present invention, the temperature of the mixed incubation in step 1 and step 2 is 25-50° C., more preferably 37° C., and the time is 2-30 min, more preferably 10 min.

[0053] In some embodiments of the present invention, the mixing reaction temperature in step 1 and step 2 is 25-50° C., more preferably 37° C., and the time is 2-30 min, more preferably 10 min.

[0054] In some embodiments of the present invention, the preparation method of silicon-encapsulated CsPbBr3 quantum dots is: cesium bromide, lead bromide, oleylamine, oleic acid and ammonia water are mixed and dissolved in a DMF solution to obtain a mixed solution, the mixed solution is added to a mixture of TEOS and toluene, and the reaction is carried out at room temperature for 2 hours, the product is collected and washed and dried to obtain the silicon-encapsulated CsPbBr3 quantum dots.

[0055] In the present invention, silicon is used to encapsulate the perovskite, and the silane reagent can be polymerized under ammonia conditions to form a film on the surface of the perovskite material.

[0056] In some embodiments of the present invention, the mass ratio of cesium bromide to lead bromide is (1-2):(3-4).

[0057] In some embodiments of the present invention, the volume ratio of oleylamine, oleic acid and aqueous ammonia is (1-3):(3-6):(1-2).

[0058] In some embodiments of the present invention, the volume ratio of TEOS to toluene is 1:(120-150).

[0059] In some embodiments of the present invention, the colloidal gold solution is prepared by heating a tetrachloroauric acid solution to boiling, then adding sodium citrate to the boiling solution, reacting at 130° C. to 150° C. for 15 minutes, and cooling to room temperature to obtain a colloidal gold solution.

[0060] In some embodiments of the present invention, the mass fraction of the tetrachloroauric acid solution is 1% w / w, the concentration of sodium citrate is 38.8 mM, the volume ratio is (3-4):10, and the boiling temperature is 110°C-130°C.

[0061] In some embodiments of the present invention, the food comprises milk and beverages.

[0062] The implementation process of the present invention is described in detail below through embodiments.

[0063] Example 1

[0064] This embodiment provides a method for preparing colloidal gold and silicon-encapsulated CsPbBr3 quantum dots.

[0065] Preparation of colloidal gold: Sodium citrate reduction method was used to synthesize colloidal gold with high negative charge. Add water to 3.4 mL of 1% w / w HAuCl4 solution to make up to 100 mL, stir on a magnetic stirrer and heat to 120°C for boiling. Quickly add 10 mL of 38.8 mmol / L sodium citrate solution to the boiling solution, and continue heating and stirring for 15 minutes. Stop heating, continue stirring and wait for the solution to cool to room temperature, collect the solution in a light-proof brown bottle, and store in a refrigerator at 4°C for later use.

[0066] Preparation of silicon-encapsulated CsPbBr3 quantum dots: CsPbBr3 perovskite nanocrystals were prepared by the antisolvent method. 0.4mM CsBr and 0.4mM PbBr2 were dissolved in DMF solution, followed by the addition of 80μL oleylamine, 240μL oleic acid and 20μL ammonia water and stirring for 2 hours to form a precursor solution. 0.2mL of the precursor solution was added to 2mL of toluene solution containing 15μL silane reagent, stirred at room temperature for 2h to obtain an orange-yellow perovskite solution, the resulting solution was centrifuged and washed 3 times, dried in an oven to obtain a solid powder, and placed in a 4°C refrigerator for use.

[0067] Figure 2 The transmission electron microscopy image of the colloidal gold prepared in this example shows that the prepared colloidal gold is in a monodisperse state with an average particle size of 12.2nm; Figure 3 The ultraviolet absorption spectrum of colloidal gold shows that colloidal gold has an ultraviolet characteristic absorption peak at 520nm; Figure 4 This is a transmission electron microscope image of the prepared silicon-encapsulated perovskite quantum dots, which shows that the prepared material is in a square shape with an average particle size of 15.00nm. A 1nm silicon thin layer exists on the surface of the material, confirming the silicon-encapsulated state; Figure 5 The fluorescence absorption and emission spectra of silicon-encapsulated perovskite quantum dots show that the optimal fluorescence absorption wavelength of the prepared silicon-encapsulated perovskite quantum dots is 267nm, and the optimal emission wavelength is 550nm, providing basic test conditions for fluorescence numerical measurement; Figure 6 The fluorescence water stability curves of silicon-wrapped perovskite and perovskite materials reflect that quantum dots can be stably present in aqueous solution for a certain period of time after silicon wrapping; Figure 7The Zeta potential diagrams of colloidal gold, silicon-encapsulated perovskite quantum dots, and the complex of colloidal gold and aptamer reflect that the silicon-encapsulated perovskite material is highly positively charged, the colloidal gold is highly negatively charged, and the complex of colloidal gold and aptamer is lowly negatively charged, providing an electrostatic adsorption basis for the reaction between colloidal gold and quantum dots and verifying the feasibility of the method.

[0068] Example 2

[0069] This embodiment provides a method for detecting Staphylococcus aureus.

[0070] (1) Standard bacterial solution preparation: The concentration of the cultured bacterial solution was determined using an ELISA instrument, and the original bacterial solution was diluted in a gradient manner to obtain 10 6 CFU / mL, 10 5 CFU / mL, 10 4 CFU / mL, 10 3 CFU / mL, 10 2 CFU / mL, 10CFU / mL concentration of bacterial solution.

[0071] (2) Fluorescence sensing detection: 1.5 μL of Staphylococcus aureus aptamer solution was added to 200 μL of colloidal gold solution and 200 μL of sterile water, and the mixture was incubated at 37°C for 10 min. 100 μL of NaCl solution was added to the incubation solution and reacted at 37°C for 10 min to obtain a mixed solution. 10 μL of standard solutions of different concentrations were added to the mixed solution, and the mixture was incubated at 37°C for 10 min. Then 30 μL of quantum dot solution was added and the mixture was reacted for 10 min to form a measurement precursor solution. The measurement precursor solution was measured using a fluorescence spectrometer and the fluorescence intensity value at 550 nm was recorded.

[0072] Figure 8 The fluorescence spectrum and standard curve measured by standard bacterial solution. It can be seen that this method can produce fluorescence response changes for bacterial solutions of different concentrations. The relationship between the fluorescence value at 550nm and the bacterial solution concentration is Y = 105.99logC + 1215.35, R 2 =0.9986, indicating that this method has good detection accuracy.

[0073] Example 3

[0074] This embodiment provides a method for detecting Staphylococcus aureus in milk.

[0075] (1) Sample pretreatment: Weigh 25 g of solid sample and place it in 225 mL of sterile water and homogenize it for 2 min to prepare a 1:10 sample solution, and add a bacterial suspension of appropriate concentration; take 25 mL of liquid sample and mix it thoroughly with 225 mL of sterile water to prepare a 1:10 sample solution, and add a bacterial suspension of appropriate concentration to form the sample solution to be tested.

[0076] (2) Fluorescence sensing detection: 1.5 μL of Staphylococcus aureus aptamer solution was added to 200 μL of colloidal gold solution and 200 μL of sterile water, incubated at 37°C for 10 min, 100 μL of NaCl solution was added to the incubation solution and reacted at 37°C for 10 min to obtain a mixed solution; 10 μL of the sample solution to be tested was added to the above mixed solution, incubated at 37°C for 10 min, and then 30 μL of quantum dot solution was added. After reacting for 10 min, a measurement precursor solution was formed, and the measurement precursor solution was measured with a fluorescence spectrometer, and the fluorescence intensity value at 550 nm was recorded. The Staphylococcus aureus content in the sample was calculated based on the fluorescence intensity value and the standard curve.

[0077] For comparison, the sample homogenate was measured by the traditional plate culture method.

[0078] Fig. 9 The results of the detection of Staphylococcus aureus in actual milk samples show that this method can detect Staphylococcus aureus in 10 2 , 10 4 , 10 6 The concentration of Staphylococcus aureus detected by gradient concentration was close to the actual concentration of the added bacterial solution, and the detection effect was better than the traditional plate culture result, which verified the accuracy and feasibility of this method in milk samples.

[0079] Example 4

[0080] This embodiment provides a method for detecting Staphylococcus aureus in carbonated beverages.

[0081] The sample processing method was carried out according to Example 3. The detection method was carried out according to Example 3, and the sample homogenate was measured by the traditional plate culture method.

[0082] Fig.10 The results of the detection of Staphylococcus aureus in actual carbonated beverage samples show that this method is 2 , 10 4 , 10 6 The gradient concentration test of Staphylococcus aureus deviated slightly from the actual concentration of the added bacterial solution. The traditional plate culture method was time-consuming, and the antibacterial effect of carbonated beverages was obvious, so the detection value deviation was relatively large. The comparison verified the real-time detection performance of this method in food samples.

[0083] Comparative Example 1

[0084] Staphylococcus aureus in milk was detected according to the method of Example 3, except that the fluorescent material used was silicon-encapsulated Cs3Bi2I9 perovskite. The preparation method of silicon-encapsulated Cs3Bi2I9 perovskite is as follows:

[0085] 57 mmol CsI and 38 mmol BiI3 were placed in a quartz tube under vacuum at room temperature and then evacuated to a vacuum degree of 1.4×10 -4 mbar, and then seal the quartz tube in a muffle furnace. Adjust the temperature of the muffle furnace so that the temperature inside the furnace rises from room temperature to 670°C, and keep the temperature constant for about 6 hours to allow the raw materials to melt and react fully. After cooling to room temperature, polycrystalline raw materials are obtained. First, put the polycrystalline material into a quartz tube with a seed crystal bag and evacuate it to a vacuum degree of 1.4×10 -4 mbar and then sealed, the quartz tube was placed in a tubular growth furnace and a single crystal was grown using a melt method to obtain a Cs3Bi2I9 perovskite single crystal.

[0086] After grinding the Cs3Bi2I9 perovskite single crystal, weigh 0.1g and add 0.25ml of a mixed solution of ethyl orthosilicate and 0.25ml of ethanol, and heat and stir at 100°C, then add 40 microliters of hydrochloric acid to initiate the polymerization reaction. After the reaction, continue to heat at 200°C until the polymer is dry to obtain the silica-coated Cs3Bi2I9 perovskite.

[0087] The experimental results show that this method can 2 , 10 4 , 10 6 The gradient concentration of Staphylococcus aureus detected deviates greatly from the actual concentration of the added bacterial solution, and the detection sensitivity is poor. This may be because the fluorescence intensity of silicon-encapsulated Cs3Bi2I9 perovskite is significantly lower than that of silicon-encapsulated CsPbBr3 quantum dots, resulting in poor detection effect.

[0088] Comparative Example 2

[0089] Staphylococcus aureus in milk was detected according to the method of Example 3, except that the fluorescent material used was TiO2 encapsulated CsPbBr3 quantum dots. The preparation method of TiO2 encapsulated CsPbBr3 quantum dots is as follows:

[0090] CsPbBr3 perovskite nanocrystals were prepared by anti-solvent method. 0.4mM CsBr and 0.4mM PbBr2 were dissolved in DMF solution, followed by addition of 80μL oleylamine, 240μL oleic acid and 20μL ammonia water and stirring for 2 hours to form a precursor solution. The titanium source solution was added dropwise to the CsPbBr3 nanocrystal precursor solution, stirred at room temperature and then hydrothermally treated. After treatment, the solid powder was washed and dried to obtain a solid powder, which was placed in a 4℃ refrigerator for use.

[0091] The experimental results show that this method can 2 , 10 4 , 10 6The gradient concentration of Staphylococcus aureus detected has a large deviation from the actual concentration of the added bacterial solution, and the detection sensitivity is poor. This may be because the fluorescence intensity of TiO2-encapsulated CsPbBr3 quantum dots is significantly lower than that of silicon-encapsulated CsPbBr3 quantum dots, resulting in poor detection effect.

[0092] Comparative Example 3

[0093] Staphylococcus aureus in milk was detected according to the method of Example 3, except that the fluorescent material used was bisamino polyethylene glycol encapsulating CsPbBr3 quantum dots. The preparation method of bisamino polyethylene glycol encapsulating CsPbBr3 quantum dots is as follows:

[0094] CsPbBr3 perovskite nanocrystals were prepared by the anti-solvent method. 0.4mM CsBr and 0.4mM PbBr2 were dissolved in DMF solution, and then 80μL oleylamine, 240μL oleic acid and 20μL ammonia water were added and stirred for 2 hours to form a precursor solution. At room temperature, the precursor solution and the deionized water solution of bisamino polyethylene glycol were fully mixed in a mass ratio of 1:1, stirred for 1h, and a mixed solution was obtained. The mixed solution was placed in a centrifuge and centrifuged at a speed of 8000rpm for 5min. The supernatant was collected, washed and dried to obtain a solid powder, which was placed in a 4℃ refrigerator for use.

[0095] The experimental results show that this method can 2 , 10 4 , 10 6 The concentration of Staphylococcus aureus detected by gradient concentration is far different from the actual concentration of the added bacterial solution, and the detection sensitivity is poor. This may be because the diamino polyethylene glycol shell has strong hydrophilicity, which leads to poor water stability of the formed CsPbBr3 quantum dots, thus affecting the detection effect.

Claims

1. A method for detecting Staphylococcus aureus in food, characterized in that: The following steps are involved: Step 1: Mixing the Staphylococcus aureus aptamer solution and the colloidal gold solution for incubation, and then adding the NaCl solution for mixing and reaction to obtain a mixed solution; Step 2: The mixed solution is mixed with the sample solution to be tested and incubated, and then the silicon-encapsulated CsPbBr3 quantum dot solution is added and mixed to obtain a test precursor solution; Step 3: Measure the fluorescence signal of the assay precursor solution.

2. The detection method according to claim 1, characterized in that: The detection is a quantitative detection, and the detection method also includes the steps of preparing a standard curve and performing quantitative analysis based on the standard curve.

3. The detection method according to claim 2, characterized in that: The steps of preparing a standard curve and performing quantitative analysis according to the standard curve specifically include: Prepare standard solutions of Staphylococcus aureus with different concentrations, mix and incubate the mixed solutions with standard solutions with different concentrations, then add silicon-encapsulated CsPbBr3 quantum dot solution to mix and react, detect the fluorescence intensity of the solution after the reaction, and establish a standard curve based on the linear relationship between the fluorescence intensity and the concentration of Staphylococcus aureus; The fluorescence intensity of the assay precursor solution is substituted into the standard curve to calculate the content of Staphylococcus aureus in the sample solution to be tested.

4. The detection method according to claim 1, characterized in that: In step 1, the concentration of the colloidal gold solution is 1.0-20.0 μM, the concentration of the aptamer solution is 1.0-30.0 nM, and the concentration of the NaCl solution is 10.0-100.0 mM; and / or, The concentration of the silicon-encapsulated CsPbBr3 quantum dot solution in step 2 is 5.0-10.0 mM.

5. The detection method according to claim 1, characterized in that: When forming the assay precursor solution, the volume ratio of the colloidal gold solution, the aptamer solution, the NaCl solution, the sample solution to be tested and the silicon-encapsulated CsPbBr3 quantum dot solution is (200-400):(0.5-1.5):(100-200):(5-20):(20-40).

6. The detection method according to claim 1, characterized in that: The mixed incubation temperature in step 1 and step 2 is 25 to 50° C. and the time is 2 to 30 minutes respectively; and / or, The temperature of the mixing reaction in step 1 and step 2 is 25 to 50° C., and the time is 2 to 30 minutes.

7. The detection method according to claim 1, characterized in that: The preparation method of the silicon-wrapped CsPbBr3 quantum dots is as follows: Cesium bromide, lead bromide, oleylamine, oleic acid and ammonia water are mixed and dissolved in a DMF solution to obtain a mixed solution, and the mixed solution is added to a mixed solution of TEOS and toluene, and the mixture is reacted at room temperature for 2 hours. The product is collected and washed and dried to obtain the silicon-encapsulated CsPbBr3 quantum dots.

8. The detection method according to claim 7, characterized in that: The mass ratio of the cesium bromide to the lead bromide is (1-2):(3-4); and / or, The volume ratio of the oleylamine, the oleic acid and the aqueous ammonia is (1-3):(3-6):(1-2); and / or, The volume ratio of the TEOS to the toluene is 1:(120-150).

9. The detection method according to any one of claims 1 to 8, characterized in that: The food includes milk and beverages.

Images