Hair dyeing method based on ribozyme catalysis of natural phenolic compounds

Abstract

The invention discloses a ribozyme catalyzed hair dyeing method based on natural phenolic compounds, which comprises the following steps: dissolving DNA solid powder in a buffer solution, heating, cooling to room temperature, adding chlorhematin, incubating the obtained mixed solution in a shake incubator, and obtaining heme / DNA enzyme after incubation; uniformly mixing heme / DNA enzyme, a natural phenolic compound and an alkaline solution to obtain dye liquor; and soaking the hair sample in the dye liquor for hair dyeing. The heme / DNA enzyme synthesized by the method is simple and convenient in synthesis method and low in cost, polymerization of natural phenolic compounds such as dopamine, dopa, tannic acid and ethyl gallate can be remarkably accelerated by the aid of peroxidase activity of the enzyme, and the heme / DNA enzyme is applied to hair dyeing, so that hair dyeing time can be remarkably shortened. The dyeing method provided by the invention is completely from natural compounds, so that the use of irritant chemical substances is avoided, and the safety is high.

Description

Technical Field

[0001] The invention belongs to the field of hair dyes and relates to a hair dyeing method based on ribozyme catalysis of natural phenolic compounds. Background Art

[0002] With the development of social economy, people's requirements for external image are also increasing. The younger generation wants to try different hair colors, and the elderly have the need to cover gray hair. Therefore, hair dye products will have huge market potential. However, the hair dyes on the market are mainly oxidative hair dyes, and their main ingredients are aniline small molecules, which have potential carcinogenicity and sensitization, seriously threatening people's life and health. In terms of hair dyes, there is an urgent need for a hair dye with safe and healthy ingredients. In recent years, people's research has increasingly focused on natural pigment precursors and their biomimetic polymerization.

[0003] As the main component of natural melanin, polydopamine (PDA) has good adhesion and excellent biocompatibility as well as safety and low toxicity. It has great potential for use in hair dyes. In recent years, there have been more and more reports on the use of polydopamine for hair dyeing. Dopamine can self-polymerize under alkaline and oxygen conditions with oxygen as an oxidant. The polymerization conditions are mild, but the polymerization rate is slow. In addition, due to the hydrophobic effect on the surface of the hair, the binding force between dopamine and the hair is poor. Using dopamine alone for hair dyeing is time-consuming and has poor coloring, which limits its function and application. To address this problem, researchers have tried different means to solve it, such as through metal ions. [1] , strong oxidants [2] , alkaline environment [3] and enzyme catalysis [4] Methods such as fluoroquinolone esters and chloroquine esters are used to promote the polymerization and deposition of polydopamine on the hair surface, but the high concentration of potentially toxic heavy metal ions, strong oxidative conditions and high cost of proteases involved in these methods have prevented them from becoming an effective hair dyeing method.

[0004] Similar to dopamine, other naturally occurring phenolic compounds such as tannic acid and ethyl gallate also have the problem of slow polymerization when used in hair dyeing, which limits the application of these natural dyes in hair dyeing. Summary of the invention

[0005] In view of the problems in the prior art, the purpose of the present invention is to provide a hair dyeing method based on natural phenolic compounds and catalyzed by ribozymes. The present invention synthesizes low-cost heme / DNA enzymes through a simple process, fully utilizes the peroxidase activity of the enzyme, accelerates the polymerization of natural phenolic compounds, and applies them in hair dyeing, which can significantly shorten the hair dyeing time.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] A hair dyeing method based on ribozyme catalysis of natural phenolic compounds comprises the following steps:

[0008] Synthesis of heme / DNA enzyme: Dissolve the solid DNA powder in a buffer (50mM Tris-HCl, 150mM NH4Cl, 0.03% Triton X-100), heat it in a 95℃ water bath for 10min, slowly cool it to room temperature, then add hemin chloride to the above solution (the mass ratio of hemin chloride to DNA is 1:3), place it in a shaking incubator, and shake it slowly for 20-40min at room temperature. After incubation, the heme / DNA enzyme is obtained and stored in a 4℃ refrigerator for later use. The sequence of the DNA enzyme in the present invention is shown in SEQ ID NO.1 or SEQ ID NO.2; wherein: SEQ ID NO.1: 5′-TGGGGGCAGGGTGGGTGGGA-3′; SEQ ID NO.2: 5′-ATGGGGGCAGGGTGGGTGGGATATAGTCTCTGTGTGCGCCAGAGACACTGGGG CAGATATGGGCCAGCACAGAATGAGGCCC-3′, SEQ ID NO.2 is a nucleic acid aptamer sequence for introducing dopamine recognition on the basis of DNA enzyme catalysis, so that dopamine is enriched in the reaction center and the reaction efficiency is improved by 20%.

[0009] Hair dyeing: Evenly mix heme / DNA enzyme, natural phenolic compound and alkaline solution to obtain dye solution; soak the hair sample in the dye solution at 37-40°C for 1-2 hours to complete the hair dyeing. Preferably, the natural phenolic compound is at least one of dopamine, tannic acid, ethyl gallate, dopa and tyrosine; the alkaline solution is ammonia water or Tris buffer; the dye solution may also contain H2O 2， .

[0010] The present invention has the following beneficial effects:

[0011] The heme / DNA enzyme synthesized by the present invention is a deoxyribozyme, and its synthesis method is simple, low in cost, and high in purity. The peroxidase activity of the enzyme is utilized to significantly accelerate the polymerization of natural phenolic compounds such as dopamine, tannic acid, and ethyl gallate. The application of the enzyme in hair dyeing can significantly shorten the hair dyeing time. The dyeing mechanism of the present invention mainly occurs through the deposition of nanoparticles, which will not penetrate into the cortex of the hair, and can successfully dye without affecting the internal components and structure of the hair; in addition, the dyeing method provided by the present invention avoids the use of irritating chemicals and has high safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1It is the UV absorption detection diagram of different dopamine polymerization modes;

[0013] Figure 2 It is the particle size distribution diagram of different dopamine polymerization modes;

[0014] Figure 3 The color of PDA solution changes with time under different conditions;

[0015] Figure 4 Photos and SEM images of hair samples before and after PDA dyeing under different conditions;

[0016] Figure 5 The UV absorption monitoring diagrams of the polymerization of tannic acid (a) and ethyl gallate (b) under different conditions;

[0017] Figure 6 The color of tannic acid solution and ethyl gallate solution changes with time under different conditions;

[0018] Figure 7 Photos of yak hair samples before and after dyeing with tannic acid or ethyl gallate. DETAILED DESCRIPTION

[0019] The present invention will be further described below in conjunction with examples so that those skilled in the art can better understand the present invention and can implement it, but the examples are not intended to limit the present invention. In addition, the preparation processes in the following examples are conventional means in the prior art unless otherwise specified, and therefore, will not be described in detail.

[0020] Synthesis of heme / DNA enzyme: Dissolve the solid DNA powder in a buffer solution (50mM Tris-HCl, 150mM NH4Cl, 0.03% Triton X-100), heat it in a 95°C water bath for 10 minutes, slowly cool it to room temperature, then add hemin chloride to the above solution (the mass ratio of hemin chloride to DNA is 1:3), place it in a shaking incubator, and shake it slowly at 25°C for 30 minutes. After incubation, heme / DNA enzyme (hereinafter referred to as DNAzyme) is obtained, which is placed in a 4°C refrigerator for standby use. The sequence of DNA enzyme is 5′-TGGGGGCAGGGTGGGTGGGA-3′.

[0021] The synthesis process of polydopamine is simple, the conditions are mild, and no complicated instruments are required. Monomer dopamine can self-polymerize under alkaline conditions (pH>7.5) with oxygen as an oxidant. Considering the hair dyeing time and the irritation of hair dyeing ingredients, it is determined that ammonia and Tris buffer provide an alkaline environment for dopamine polymerization, and then heme / DNA enzyme is introduced. The following comparison and hair dyeing process are carried out.

[0022] Comparative Example 1

[0023] 3% ammonia water is used to provide the alkaline conditions required for dopamine polymerization. The concentration of dopamine in the ammonia water is 5 mg / mL. Dopamine can undergo polymerization reaction in an air environment.

[0024] Example 1

[0025] The difference between this embodiment and the comparative example is that in embodiment 1, 0.1 uM H2O2 and 1 uM DNAzyme are added to the reaction system, so that dopamine undergoes polymerization reaction in the presence of DNAzyme.

[0026] Example 2

[0027] The only difference between Example 2 and Example 1 is that 3% ammonia water is replaced by 0.5M Tris buffer (pH=10), and other conditions are the same as those of Example 1. That is, Example 2 uses Tris buffer to provide an alkaline environment for dopamine polymerization.

[0028] Example 3

[0029] The only difference between Example 3 and Example 1 is that dopamine is replaced by DOPA, and other conditions are the same as those of Example 1.

[0030] First, the UV changes of PDA were monitored in real time by using an ELISA reader. The parameters of the ELISA reader were set as follows: the plate type was a 96-well transparent microplate, the temperature was 40°C, the running time was 2 hours, the detection interval was 2 minutes, the detection wavelength was 450 nm, and the concentration of dopamine was 5 mg / mL. The test results are as follows: Figure 1 shown. Figure 1 It shows that DNAzyme accelerates the polymerization of dopamine, but the reaction rate of Tris buffer in the presence of DNAzyme is still lower than the reaction rate of 3% NH4OH in the absence of DNAzyme. Since the polymerized product PDA is insoluble, the UV-vis absorbance of dopamine polymerized with only 3% NH4OH begins to decrease after 1 hour. Figure 2 The particle size distribution diagram of different dopamine polymerization methods in the comparative example and the example. Through DLS analysis, it can be seen that the particle size of PDA using 3% NH4OH in the comparative example exceeds 10uM; after adding DNAzyme in Example 1, the particle size of PDA is significantly reduced by at least one order of magnitude, and the particle size is less than 100nm; Example 2 uses 0.5M Tris to provide an alkaline environment, and the particle size of the resulting PDA is mainly distributed in 1uM; After using dopa to replace dopamine in Example 3, the particle size of PDA does not become smaller. In summary, the use of 3% NH4OH and DNAzyme for dopamine polymerization in Example 1 is the best. The changes in solution color in each time period in the comparative example and Example 1 were recorded by taking pictures, and the results are shown as follows: Figure 3 As shown, it can be clearly seen by comparison that when 3% NH4OH is used, the solution immediately turns light brown as soon as DNAzyme is added, and the solution turns dark brown in about 10 minutes. The time required without adding enzyme is about 20 minutes. The addition of enzyme substantially accelerates the production of polydopamine.

[0031] Hair Coloring

[0032] Hair samples (about 2 cm) were added to the reaction systems of the comparative example, Example 1 and Example 2 respectively in an environment of 37-40° C. to completely immerse the hair samples in the solution. The hair samples were immersed in the systems of the comparative example and Example 1 for 1 hour, and in the system of Example 2 for 2 hours. After dyeing, the hair samples were washed with water and dried in air.

[0033] Figure 4 The following are photos and SEM images of hair samples before and after PDA dyeing under different conditions. Figure a shows the photos of hair samples before and after PDA dyeing, and Figure b shows the SEM images of the hair surface. The upper row: 50um, the lower row: 10um. It can be seen from the figure that PDA has been deposited on the hair surface. By comparison, it can be seen that the introduction of DNAzyme makes the PDA nanoparticle size on the hair surface smaller, which is consistent with the DLS analysis results. The dyeing mechanism mainly occurs through the deposition of nanoparticles and does not penetrate into the cortex of the hair. It can be successfully dyed without affecting the internal composition and structure of the hair.

[0034] Example 4

[0035] The only difference between Example 4 and Example 1 is that dopamine is replaced by tannic acid, and other conditions are the same as those of Example 1.

[0036] Comparative Example 2

[0037] The difference between Comparative Example 2 and Example 4 is that no DNAzyme is added, and other conditions are the same as those of Example 4.

[0038] Example 5

[0039] The only difference between Example 5 and Example 1 is that dopamine is replaced by ethyl gallate, and other conditions are the same as those in Example 1.

[0040] Comparative Example 3

[0041] The difference between Comparative Example 3 and Example 5 is that no DNAzyme is added, and other conditions are the same as those of Example 5.

[0042] The reaction systems in Example 4, Comparative Example 2, Example 5 and Comparative Example 3 were monitored by ultraviolet light using an enzyme marker. The results are as follows: Figure 5 As shown, from Figure 5 The introduction of DNAzyme can be clearly observed, and the initial polymerization rate and UV absorption peak of tannic acid and ethyl gallate are increased. It can be known that DNAzyme can accelerate the polymerization of tannic acid and ethyl gallate when ammonia water provides an alkaline environment. The acceleration of the polymerization reaction is also verified by visual observation of the color change of the reaction solution. The results are as follows Figure 6 , Figure 6 Figures a and b in the middle are the color changes of tannic acid solution without and with DNAzyme, respectively. Figures c and d are the color changes of ethyl gallate solution without and with DNAzyme, respectively.

[0043] White yak hair was used as a sample to observe the coloring of the two pigment molecules, tannic acid and ethyl gallate. In order to improve the dyeing effect, the concentration of the pigment molecules was increased. The concentration of tannic acid was 50mM and the concentration of ethyl gallate was 100mM. By adding a small amount of Tris to improve its solubility, the white yak hair was successfully dyed light brown and yellow. The results are as follows: Figure 7 shown.

[0044] Obviously, the described embodiments are only some embodiments of the present invention, but not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

Claims

1. A hair dyeing method based on ribozyme catalysis of natural phenolic compounds, characterized in that: The following steps are involved: The DNA solid powder is dissolved in a buffer solution, and after heating, it is cooled to room temperature, and then hemin is added, and the obtained mixed solution is placed in a shaking incubator for incubation, and after the incubation, hemin / DNA enzyme is obtained; The heme / DNA enzyme, the natural phenolic compound and the alkaline solution are uniformly mixed to obtain a dye solution; the hair sample is immersed in the dye solution to complete the hair dyeing.

2. The hair dyeing method according to claim 1, characterized in that: The incubation temperature is room temperature, and the incubation time is 20-40 minutes.

3. The hair dyeing method according to claim 1, characterized in that: The natural phenolic compound is at least one of dopamine, dopa, tyrosine, tannic acid and ethyl gallate.

4. The hair dyeing method according to claim 1, characterized in that: The alkaline solution is ammonia water or Tris buffer.

5. The hair dyeing method according to claim 1, characterized in that: The dye solution also includes H2O2.

6. The hair dyeing method according to claim 1, characterized in that: The temperature of the dye liquor is 37-40°C.

7. The hair dyeing method according to claim 1, characterized in that: The reaction time is 1 h.

Images