Gene OsSK8 for regulating and controlling disease resistance of rice as well as encoding protein and application thereof

Abstract

The invention discloses a gene OsSK8 for regulating and controlling disease resistance of rice as well as an encoding protein and application of the gene OsSK8, the gene is the gene OsSK8, and the sequence of the gene OsSK8 is shown as SEQ ID NO. 1 or SEQ ID NO. 2. A novel rice sheath blight and bacterial blight resistance regulation gene OsSK8 is identified, the OsSK8 gene is subjected to overexpression and knockout, and after resistance identification, it is found that the overexpression of the OsSK8 gene can enhance the resistance of rice to sheath blight and bacterial blight, and the knockout of the gene can reduce the resistance of rice to sheath blight and bacterial blight. The OsSK8 gene positively regulates the resistance level of rice to sheath blight and bacterial blight, so that a new thought and direction are provided for breeding rice varieties with higher disease resistance, and meanwhile, a solid foundation is laid for further exploration in the field of rice disease-resistant breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a rice disease resistance regulating gene OsSK8 and its encoding protein and application. Background Art

[0002] Rice (Oryza sativa L.) is an important food crop in the world. During its life, rice suffers from many diseases. Among them, fungal diseases caused by sheath blight and bacterial diseases caused by bacterial leaf blight are particularly serious, affecting the high and stable yield of rice. Sheath blight mainly harms leaf sheaths and leaves, and has the characteristics of great destructiveness, strong epidemicity and wide host range. Bacterial leaf blight mainly invades rice leaves through wounds or water holes, which can cause rice yield reduction of 20-30%, and even up to 50% in severe cases.

[0003] Resistance gene-mediated disease-resistant breeding is considered an effective measure for preventing and controlling rice diseases in current agricultural production. Although rice transgenic breeding technology is widely used due to its short cycle and high efficiency, and a variety of disease-resistant and high-yield new varieties have been bred, the breeding of resistance to sheath blight has been slow due to the relative scarcity of genetic resources for resistance to sheath blight and the lag in research on disease resistance mechanisms. Therefore, in-depth exploration of new rice disease-resistant genes has important application value for rice disease-resistant breeding, which will provide the necessary genetic resources and theoretical basis for molecular breeding and promote the development and application of new disease-resistant varieties. Summary of the invention

[0004] Purpose of the invention: In view of the deficiencies in the prior art, the present invention provides a rice disease resistance regulating gene OsSK8. The present invention identifies a new rice resistance regulating gene OsSK8. Through the identification of sheath blight and bacterial blight resistance and expression pattern analysis of OsSK8, it is found that overexpression of the gene OsSK8 will enhance the resistance of rice to sheath blight and bacterial blight, while knocking out the gene using CRISPR / Cas9 gene editing technology will reduce the resistance of rice to these two diseases. This shows that OsSK8 positively regulates the resistance level of rice to sheath blight and bacterial blight, and therefore has a good application prospect in breeding disease-resistant rice varieties, and has important application value for improving rice disease resistance and ensuring food security.

[0005] The present invention also provides the protein encoded by the rice disease resistance gene OsSK8 and its application.

[0006] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a gene for regulating rice disease resistance, wherein the gene is OsSK8 gene, and its sequence is shown in SEQ ID NO.1 or SEQ ID NO.2; or a DNA molecule sequence of the gene that has more than 90% similarity with the nucleotide sequence of the OsSK8 gene and can regulate rice disease resistance; or a DNA molecule that can hybridize with the nucleotide sequence of the OsSK8 gene and can regulate rice disease resistance.

[0007] Among them, SEQ ID NO.1 and SEQ ID NO.2 are the full-length and CDS sequences of the OsSK8 gene, respectively, of which the full-length sequence is used for gene editing knockout and the CDS sequence is used for overexpression.

[0008] Wherein, the disease resistance is resistance to sheath blight and bacterial blight.

[0009] The protein encoded by the rice disease resistance regulating gene of the present invention is encoded by SEQ ID NO.2, and its amino acid sequence is shown in SEQ ID NO.3.

[0010] The invention contains the overexpression vector of the rice sheath blight resistance related gene. The overexpression vector is obtained by amplifying the CDS sequence of the OsSK8 gene, connecting it to the overexpression vector pU1301, and extracting the plasmid through transformation to finally obtain the overexpression vector.

[0011] The present invention is based on the gene knockout vector of the rice sheath blight resistance-related gene, and the gene knockout vector comprises a target sequence and a CRISPR / Cas9 vector; the nucleotide sequence of the target sequence is shown in SEQ ID NO.4.

[0012] The invention relates to a recombinant microorganism or a transgenic plant cell line containing the overexpression vector or the gene knockout vector.

[0013] Wherein, the vector may be a plasmid, a cosmid, a phage or a virus vector; the microorganism may be a yeast, a bacterium, an algae or a fungus, such as Agrobacterium; and the transgenic plant cell line does not include propagation materials.

[0014] The rice disease resistance regulating gene or the protein encoded by the rice disease resistance regulating gene or the overexpression vector or the gene knockout vector or the recombinant microorganism or transgenic plant cell line of the present invention is used in regulating rice disease resistance.

[0015] Among them, overexpression of the OsSK8 gene in rice increases resistance to rice sheath blight and bacterial leaf blight, while knocking out the OsSK8 gene reduces resistance to rice sheath blight and bacterial leaf blight.

[0016] The invention relates to the use of the rice disease resistance regulating gene or the protein encoded by the rice disease resistance regulating gene or the overexpression vector or the gene knockout vector or the recombinant microorganism or transgenic plant cell line in cultivating rice germplasm with enhanced resistance to sheath blight and bacterial blight.

[0017] The method for cultivating transgenic rice with improved / reduced resistance to sheath blight and bacterial blight of the present invention comprises enhancing / reducing the expression amount and / or activity of the protein encoded by the OsSK8 gene in the recipient rice to obtain the transgenic rice, wherein the disease resistance of the transgenic rice is higher / lower than that of the recipient rice.

[0018] The disease resistance of the transgenic rice is higher / lower than that of the recipient rice, which is reflected in that the length of the sheath blight lesions of the transgenic rice is lower / higher than that of the recipient rice and the area of ​​the bacterial blight lesions of the transgenic rice is lower / higher than that of the recipient rice.

[0019] Wherein, the method for enhancing or reducing the expression level and / or activity of OsSK8 protein in the recipient rice is achieved by overexpressing or knocking out the gene encoding the OsSK8 protein in the recipient rice.

[0020] Furthermore, the method for cultivating transgenic rice with reduced / increased resistance to sheath blight and bacterial blight described in the present invention is used in creating new rice germplasm with disease resistance.

[0021] The rice variety mentioned above in the present invention may specifically be Zhonghua 11 (ZH11).

[0022] The present invention identifies a gene OsSK8 (LOC_Os11g48030) by reverse genetics, encoding an Oryza Skp1-like protein (OSK), which is located on chromosome 11, has a total length of 3198 bp, has 2 introns, and the coding sequence (CDS) encodes 124 amino acids. The results of the identification of sheath blight resistance show that OsSK8 positively regulates the resistance of rice to sheath blight, that is, knocking out the OsSK8 gene will reduce the resistance of rice to sheath blight, while overexpressing OsSK8 significantly enhances the resistance of rice to sheath blight. The results of the identification of bacterial blight resistance show that OsSK8 positively regulates the resistance of rice to bacterial blight, that is, knocking out the OsSK8 gene will reduce the resistance of rice to bacterial blight, while overexpressing OsSK8 significantly enhances the resistance of rice to bacterial blight. These results indicate that OsSK8, as a positive regulatory gene, has important application potential in rice disease resistance molecular breeding.

[0023] The disease resistance in the application of the present invention may be resistance to sheath blight and / or resistance to bacterial blight; the regulation is specifically embodied in that when the activity and / or content of the OsSK8 protein in the plant is reduced, the resistance of the plant to sheath blight and bacterial blight is reduced; when the activity and / or content of the OsSK8 protein in the plant is increased, the resistance of the plant to sheath blight and bacterial blight is increased. Among them, the plant breeding may specifically be the creation of new rice germplasm resistant to sheath blight and new rice germplasm resistant to bacterial blight.

[0024] In the above method, the main steps of reducing the expression level and / or activity of the OsSK8 gene in the recipient rice are as follows: (1) Obtaining the target gene fragment. In the present invention, the target fragments of all candidate genes are amplified by PCR technology from the genes corresponding to the cDNA of Zhonghua 11. (2) Connecting the target gene fragment to the intermediate (cloning) vector pER8-CAS9-U3 / U6; (3) Selecting positive clones and confirming them by sequencing; Mixing the positive clone plasmid and the final vector plasmid for recombination reaction; (4) PCR and plasmid enzyme digestion to verify the positive clone; (5) Transferring the recombinant positive plasmid into Agrobacterium; (6) Verification and preservation of positive Agrobacterium single clones. During the experimental operation, total RNA was extracted from the whole plant tissue of Zhonghua 11 seedlings at the 4-5 leaf stage (leaves as a plant) according to the Trizol method (Invitrogen); total cDNA was synthesized using the PrimeScript RT reagent KitWith gDNAEraser kit (TaKaRa); and recombinant plasmids were extracted using the EZNATM PlasmidMidi Kit (OMEGA). To enhance the expression and / or activity of the OsSK8 gene in the recipient rice, the CDS sequence of the OsSK8 gene was obtained by amplification with a high-fidelity DNA polymerase, and the target gene was introduced into the overexpression vector pU1301 driven by a strong promoter through KpnⅠ and BamHI.

[0025] The results of real-time quantitative PCR showed that OsSK8 was highly expressed mainly in leaves and leaf sheaths, which is consistent with the characteristics that rice sheath blight mainly harms leaf sheaths and rice bacterial leaf blight mainly harms leaves (e.g. Figure 1 A), and OsSK8 gene was induced to up-regulate expression after sheath blight infection (e.g. Figure 1 B), suggesting that the OsSK8 gene is closely related to rice sheath blight and / or bacterial leaf blight resistance. The identification of sheath blight resistance showed that the length of sheath blight lesions in the transgenic overexpression strain was significantly lower than that in the wild type, and the length of sheath blight lesions in the gene-edited strain was significantly higher than that in the wild type. The identification of bacterial leaf blight resistance showed that the area of ​​bacterial leaf blight lesions in the transgenic overexpression strain was significantly lower than that in the wild type, and the area of ​​bacterial leaf blight lesions in the gene-edited strain was significantly higher than that in the wild type. The above results show that the OsSK8 gene can regulate rice disease resistance.

[0026] The present invention identified the OsSK8 gene specifically expressed in rice leaf sheaths through expression pattern analysis. After infection by sheath blight fungi, it was found that the gene was significantly induced to express, indicating that the OsSK8 gene is closely related to rice sheath blight resistance. The expression of the OsSK8 gene was enhanced by overexpression technology and the OsSK8 gene was knocked out by gene editing technology, confirming that the gene can positively regulate the resistance of rice to sheath blight and bacterial blight, and the resistance traits of sheath blight and bacterial blight of the transgenic line were investigated, obtaining a new rice material with significantly improved resistance to sheath blight and bacterial blight.

[0027] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0028] The present invention identifies a new gene for regulating rice disease resistance, provides new gene resources for improving rice resistance to sheath blight and bacterial leaf blight, and obtains new rice germplasm with enhanced rice disease resistance.

[0029] The present invention identified a gene OsSK8 that regulates rice disease resistance. Knocking out the gene can significantly reduce rice resistance to sheath blight and bacterial leaf blight, while overexpressing the gene enhances rice resistance to sheath blight and bacterial leaf blight, indicating that the gene has important application value in molecular breeding of rice disease resistance. The OsSK8 gene of the present invention positively regulates the resistance level of rice to sheath blight and bacterial leaf blight. This discovery not only provides new ideas and directions for breeding more disease-resistant rice varieties, but also lays a solid foundation for further exploration in the field of rice disease-resistant breeding. Through in-depth research on the function and mechanism of the OsSK8 gene, it is expected that more efficient disease-resistant rice varieties will be cultivated in the future, thereby improving food security and crop production efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The expression patterns of OsSK8 gene in rice. A is the expression pattern of OsSK8 gene in different parts of rice during heading stage; B is the expression pattern of OsSK8 gene in resistant (YSBR) and susceptible (NIP) varieties after being induced by sheath blight.

[0031] Figure 2 A is the detection result of two T4 plants with overexpression of OsSK8 gene. A is the RT-PCR detection result of two T4 plants with overexpression; B is the Western Blot detection result of two T4 plants with overexpression.

[0032] Figure 3The phenotypes of greenhouse sheath blight resistance of the OsSK8 gene overexpression strain and the wild-type control. A is the length of the lesion 14 days after greenhouse live inoculation; B is the phenotype of greenhouse live inoculation; C is the Western detection result of OsSK8 protein before inoculation of the overexpression strain.

[0033] Figure 4 The OsSK8 gene-edited strain and the wild-type control are resistant to greenhouse sheath blight. A is the length of the lesion 14 days after greenhouse live inoculation; B is the greenhouse live inoculation phenotype; C is the greenhouse live inoculation phenotype (potted plant).

[0034] Figure 5 The phenotypes of OsSK8 gene overexpression strain and wild type control in vitro sheath blight resistance in the climate chamber. A is the Western Blot detection result of OsSK8 protein before inoculation of the overexpression strain; B is the phenotype of in vitro inoculation in the climate chamber; C is the length of the lesion 7 days after in vitro inoculation in the climate chamber.

[0035] Figure 6 The OsSK8 gene-edited strain and the wild-type control are resistant to sheath blight in vitro in the climate chamber. A is the genotype of the gene-edited strain; B is the length of the lesion 7 days after inoculation in vitro in the climate chamber; C is the phenotype of inoculation in vitro in the climate chamber.

[0036] Figure 7 The phenotypes of OsSK8 gene-edited strains, overexpression strains and wild-type controls were resistant to bacterial blight in the field. A is the field inoculation phenotype; B is the lesion length 15 days after field inoculation. DETAILED DESCRIPTION

[0037] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0038] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. Experimental methods without specific conditions specified in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0039] The conventional rice varieties in the present invention are ZH11, Nipponbare (NIP) and rice sheath blight resistant germplasm YSBR1 (Zuo Shimin et al., Resistance evaluation of improved new resistance source YSBR1 to rice sheath blight [J]. Acta Agronomica Sinica, 2009, 35(04): 608-614.) provided by Yangzhou University.

[0040] The sheath blight pathogen in the present invention is YN-7, and the bacterial leaf blight pathogen is ZHE-173, both of which are known pathogens and provided by Yangzhou University. Other wild-type sheath blight pathogens and bacterial leaf blight pathogens may also be used.

[0041] The moderately pathogenic Rhizoctonia solanii strain YN-7 is a well-known strain (Comparative genome analyses of four rice-infecting Rhizoctonia solanii solates reveal extensive enrichment of homogalacturonan modification genes. BMC Genomics. 2021Apr 7; 22(1): 242.).

[0042] The pathogen causing bacterial blight is ZHE-173 (Analysis of resistance of major cultivated varieties in China to seven strains of bacterial blight pathogen [J]. Plant Protection, 2016, 42(04): 169-173+183.).

[0043] pCXUN-CAS9 is a well-known vector (application number 2016106398543, a rice efficient transformation vector pCXUN-Cas9-sgRNA and a construction method thereof).

[0044] The overexpression vector pU1301 was purchased directly from the market, and the BioVector plasmid vector strain cell protein antibody gene storage center.

[0045] Example 1

[0046] Cloning of the CDS region of OsSK8 gene

[0047] Zhonghua 11 (ZH11) seeds were cultured into seedlings, and total RNA from leaves of ZH11 seedlings at the 4-5 leaf stage was extracted using the Trizol method (Invitrogen); total cDNA was synthesized using the PrimeScript RT reagent Kit With gDNA Eraser kit (TaKaRa).

[0048] Primers OsSK8-CDS-F: 5′-ATGCTGCGGAAGGGAGAG-3′ and OsSK8-CDS-R: 5′-GGTGTCCAGATAGTTTGCAG-3′ were designed based on the sequence information, and the gene was cloned using the cDNA of ZH11 as a template.

[0049] The nucleotide sequence of the rice OsSK8 gene CDS of the present invention is shown in SEQ ID NO.2, and the amino acid sequence encoded by the CDS is shown in SEQ ID NO.3.

[0050] Cloning of the full-length sequence of OsSK8 gene

[0051] Zhonghua 11 (ZH11) seeds were cultured into seedlings, and gDNA was extracted from leaves of ZH11 seedlings at the 4-5 leaf stage using the CTAB method.

[0052] Primers were designed based on the sequence information: OsSK8-QC-F: 5'-AAGGGATACGATGCTCTAGTCT-3' and OsSK8-QC-R: 5'-AAAAAAACATACCAAGCCGGCC-3', and the full-length sequence of the gene was cloned using the gDNA of ZH11 as a template. The full-length nucleotide sequence of the rice OsSK8 gene of the present invention is shown in SEQ ID NO.1

[0053] Example 2

[0054] Analysis of expression characteristics of OsSK8 gene

[0055] Samples of different organs (root, stem, leaf, leaf sheath, panicle) of rice variety ZH11 at the booting stage were taken and stored in liquid nitrogen. YSBR1 and NIP were cultured under normal conditions until the booting stage. The embedding method (Zuo Shimin et al., Establishment and improvement of field rice sheath blight resistance identification system [J]. Journal of Yangzhou University: Agricultural and Life Sciences Edition. 2007 (27): 57-61) was used to carefully embed a 1 cm long and 2 mm wide piece of wood bark (covered with hyphae) attached with sheath blight fungus YN-7 hyphae into the leaf sheath 1 cm-2 cm below the second leaf of rice. The rice variety was inoculated with sheath blight fungus YN-7 strain, and the rice leaf sheath 1 cm above and below the inoculum was cut before inoculation (0h) and 8h, 16h, 24h, and 32h after inoculation, and stored in liquid nitrogen.

[0056] According to the steps in the manual (Invitrogen), total RNA from each rice sample was extracted with Trizol, and then digested with DNaseI (RNase free, Promega) to remove genomic DNA contamination (see the DNaseI manual for the method), and then reverse transcribed with reverse transcriptase (TaKaRa) to synthesize the first chain of cDNA (see the reverse transcriptase manual for the method). The reaction conditions were: 37°C, 30 min; 85°C, 5 sec; 4°C, forever. Using cDNA as template, rice Actin gene as internal reference gene (Actin gene amplification primers F1: 5'-CTTCATAGGAATGGAAGCTGCGGGTA-3' and R1: 5'-CGACCACCTTGATCTTCATGCTGCTA-3'), OsSK8 gene specific quantitative primers (qRT-OsSK8-F: 5'-GGTCGCTCCACTACTCCAG T-3' and qRT-OsSK8-R: 5'-TCAGGTGTCCAGATAGTTTG-3') were used for real-time quantitative PCR. The reaction conditions were: 95℃ pre-denaturation for 2min, and then entering the following cycle: 95℃15sec, 60℃10sec, 72℃10sec for a total of 40 cycles. The results showed that OsSK8 was expressed in roots, stems, leaves, leaf sheaths, and panicles, and the expression level in leaves and leaf sheaths was relatively high, which is consistent with the main damage sites of sheath blight. 24h and 32h after inoculation, the expression level of OsSK8 in rice varieties NIP and YSBR1 was induced by Rhizoctonia solani and increased, and OsSK8 may be involved in the defense response of rice Rhizoctonia solani ( Figure 1 ).

[0057] Example 3

[0058] Vector construction, genetic transformation and detection

[0059] 1. Steps for constructing CRISPR / Cas9 knockout vector using rice OsSK8 gene:

[0060] Select the target gene site in the full-length sequence of OsSK8 and design primers to select the target site with high knockout efficiency, Target1: 5'-GGAGAGGCGCCGGGGCACCA-3'. Primers OsSK8-CRISPR-F: 5'-GGAGAGGCGCCGGGGCACCAGTTTTAGAGCTAGAAATAGCAAGTTA-3' and OsSK8-CRISPR-R: 5'-TGGTGCCCCGGCGCCTCTCCAACCTGAGCCTCAGCGCAGC-3' were designed for this target site. The forward primer and reverse primer respectively contained the 20nt target sequence (SEQ ID NO.4: GGAGAGGCGCCGGGGCACCA) and a partial sequence on the intermediate vector. At the same time, primers OSU6-F / R were designed. OSU6-F: 5'-CCCCTTTCGCCAGGGGTACCtatgtacagcattacgtagg-3' and OSU6-R: 5'-TACGAATTCGAGCTCGGTACCgatggtgcttactgtttag-3' respectively contained a partial sequence on the rice U6 promoter and the KpnⅠ restriction site on the final vector pCXUN-CAS9. The target sequence was inserted between the OsU6 promoter (amplified from the rice genome and cloned into the vector) and sgRNA (small-guide RNA, under which the Cas9 protein can achieve directional cutting of the target gene) by overlapping extension PCR. A total of three rounds of PCR reactions were required. The first and second rounds of PCR reactions were amplified separately using the intermediate vector OsU6 as a template (SEQ ID NO.5), and OSU6-F / OsSK8-CRISPR-R and OsSK8-CRISPR-F / OSU6-R were used as primers for amplification, respectively. The third PCR reaction PCR3 used the amplified products of PCR1 and PCR2 as templates, and U6-F and U6-R as primers. The reaction products of PCR1 and PCR2 are about 450bp, and the product of PCR3 is about 900bp. rTaq DNA polymerase and general PCR amplification procedures can be used.

[0061] After the product of PCR3 was purified and recovered, the recovered fragment of PCR3 was connected to the pCXUN / CAS9 vector digested with KpnⅠ using a one-step ligation method using a kit (ClonExpress Ultra OneStep Cloning Kit) to obtain the OsSK8 gene knockout vector.

[0062] The ligation product from the previous step was added to DH5α and transformed using the heat shock method. The culture was then shaken at 37°C for 1 hour. Finally, the culture was spread on an LB plate containing kanamycin and cultured at 37°C for 1 day.

[0063] Six single clones were randomly selected from the plate and placed in a 15 mL sterile EP tube. 5 mL of liquid LB containing kanamycin was added and the cells were shaken for 1 day. The plasmid was extracted using the EZNATM Plasmid Midi Kit (OMEGA) and sequenced for verification.

[0064] The recombinant positive plasmid was transferred into Agrobacterium EHA105, the system was 20μl Agrobacterium (EHA105) + 1μL plasmid, ice bath for 5min, liquid nitrogen quick freeze for 5min, 37℃ water bath for 5min, ice bath for 5min. Add 100μl antibiotic-free LB, shake at 28℃ 200rpm for 2h, directly apply on kanamycin + rifampicin plate, and culture at 28℃ for two days.

[0065] Verification of positive Agrobacterium monoclones: Pick a monoclone two days later and place it in a 5ml sterile EP tube. Add 2ml of the corresponding bacterial antibiotics + rifampicin in advance and culture overnight on a shaker. The next day, the bacterial solution was sent for sequencing. After the sequencing feedback was correct, the prepared Agrobacterium pCXUN-Cas9-OsSK8 could be used for the subsequent transformation experiment.

[0066] The callus of conventional japonica rice variety ZH11 was transformed by Agrobacterium-mediated method, and hygromycin was used for screening to obtain transgenic seedlings. Four transgenic lines were selected for sequencing verification and named ossk8-1, ossk8-2, ossk8-3, ossk8-4 ( Figure 4 ).

[0067] 2. The steps for constructing the overexpression vector are as follows:

[0068] Primers were designed based on the total cDNA in Example 1: OsSK8-PU1301-F: 5'-TTACGAACGATAGCCGGTACCATGCTGCGGAAGGGAGAG-3' and OsSK8-PU1301-R: 5'-TTTGCGGACTCTAGAGGATCCGGTGTCCAGATAGTTTGCAG-3', and the cDNA of ZH11 was used as a template to clone the gene. The CDS sequence of OsSK8 was amplified using a high-fidelity DNA polymerase, and its nucleotide sequence is shown in SEQ ID NO.2, and the amino acid sequence is shown in SEQ ID NO.3. The PCR amplification system was: DNA 3 μL, 2×KOD Fx PCR buffer 25 μL, 2mM dNTPs 10 μL, OsSK8-PU1301-F / OsSK8-PU1301-R 1.5 μL each, KOD Fx (1U / μL) 1 μL, and ddH2O 8 μL. The PCR reaction program was: 94°C for 2 min, 1 cycle; 98°C for 10 sec, 55°C for 30 sec, 68°C for 5 min, 30 cycles; 68°C for 1 min 30 sec, 25°C for 1 min, 1 cycle. The PCR product was confirmed to have the correct size by agarose gel electrophoresis, and then recovered by DNA extraction using a DNA recovery kit (FastPureGel DNAExtraction Mini Kit).

[0069] The overexpression vector pU1301 was double-digested with KpnⅠ and BamHI. After the digestion was complete as detected by agarose electrophoresis, it was recovered and purified by the sodium acetate method.

[0070] The target gene and the linearized vector after restriction digestion were connected by homologous recombination enzyme (ClonExpress II One Step Cloning Kit reagent from Novozymes).

[0071] The ligated product was introduced into competent DH5α, and positive single clones were selected and sequenced on LB medium containing kanamycin. After the alignment was correct, the construction of OsSK8-OE vector was completed successfully. The above plant expression vector was transferred into rice variety ZH11 by the above Agrobacterium-mediated method, and two independent T0 generation transgenic plant lines were obtained by Western Blot and qRT-PCR detection, named OsSK8-OE1 and OsSK8-OE2 ( Figure 2 shown).

[0072] Example 4

[0073] Identification of resistance to sheath blight in transgenic rice

[0074] The resistance of the wild type (ZH11), gene-edited knockout lines (ossk8-1, ossk8-2, ossk8-3, ossk8-4) and overexpression lines (OsSK8-OE1, OsSK8-OE2) of this gene to sheath blight was identified using greenhouse inoculation and in vitro inoculation methods.

[0075] 1. The identification method of greenhouse sheath blight resistance is as follows:

[0076] When the rice plants grow to the 3-leaf stage, they are transplanted into long pots, 5 plants per pot, and placed in a greenhouse. The temperature and light conditions in the greenhouse are set to 14h light (30℃), 10h dark (24℃), and the indoor humidification is carried out using a mist nozzle device. When the rice plants grow to the early stage of booting, they are inoculated. Before inoculation, the plants with natural disease and death and small or redundant tillers are pruned. The inoculation method is artificial inoculation by embedding method. The 1cm long and 2mm wide wood bark (covered with hyphae) with the hyphae of Rhizoctonia solani YN-7 is carefully placed on the leaf sheath 1cm below the second leaf. Five seedlings are inoculated in each pot, and each seedling is inoculated with 5 stems with relatively consistent growth periods. The length of the lesions is investigated 14d after inoculation.

[0077] 2. The in vitro identification method for sheath blight resistance is as follows:

[0078] When the rice plants in the field grow to the early stage of booting, in vitro stem sampling is carried out. After cutting the rice stems, only the sword leaf and the second leaf are left. The rice is placed in water overnight to adapt to the climate room environment and prevent the rice from losing water. The next day, the embedded method is also used for inoculation. The 1cm long and 2mm wide wood bark with hyphae of Rhizoctonia solani (covered with hyphae) is carefully placed on the leaf sheath 1cm below the second leaf. After the inoculation, the stem is inserted into a test tube rack embedded with floral mud and then moved into the nutrient solution. Then it is placed in an environment with a temperature and light setting of 14h light (30℃), 10h dark (24℃), and a humidity setting of 90% for growth. The length of the lesions is investigated 7d after inoculation.

[0079] 3. When using greenhouse artificial inoculation, if Figure 3 and Figure 4 The average lesion lengths of the two transgenic overexpression lines (18.78 cm and 19.01 cm, respectively) were significantly lower than those of the wild type (26.26 cm) ( Figure 3 A, B, C), the average lesion lengths of the four gene-edited strains (33.31 cm, 32.13 cm, 31.10 cm, and 30.28 cm, respectively) were significantly higher than those of the wild type (26.26 cm) ( Figure 4 A, B, C).

[0080] 4. When in vitro inoculation is used, Figure 5 and Figure 6The average lesion lengths of the two transgenic overexpression lines (10.43 cm and 9.67 cm, respectively) were significantly lower than those of the wild type (13.72 cm) ( Figure 5 A, B, C), the average lesion lengths of the four gene-edited strains (17.44 cm, 19.64 cm, 18.02 cm, and 19.72 cm, respectively) were significantly higher than those of the wild type (13.72 cm) ( Figure 6 A, B, C). These results indicate that the gene OsSK8 positively regulates rice sheath blight resistance, and the ability of rice to resist sheath blight can be significantly improved by overexpressing the OsSK8 gene.

[0081] Example 5

[0082] Identification of transgenic rice resistance to bacterial blight

[0083] The field inoculation method of bacterial blight was used to identify the bacterial blight resistance of the wild type (ZH11), gene-edited knockout lines (ossk8-1, ossk8-2, ossk8-3, ossk8-4) and overexpression lines (OsSK8-OE1, OsSK8-OE2) of this gene.

[0084] Cultivation of bacterial blight pathogen

[0085] The bacterial blight pathogen used in the present invention is ZHE173, which is activated and cultured in potato culture medium at 28°C. After culturing in the dark for 2-3 days, the bacterial cells are scraped and mixed in sterilized ddH2O, and the OD is adjusted to 0.5 for inoculation.

[0086] Vaccination method

[0087] The leaf cutting method was used. Scissors were dipped in the bacterial solution and 1 cm of the upper part of the flag leaf of rice at the booting stage was cut off to allow the bacterial solution to infect the rice along the wound. Five plants were inoculated per strain, and at least five flag leaves were inoculated per plant. The length of the lesions and the length of the diseased leaves were investigated 14 days after inoculation in the normal field environment. The results are shown in Table 1. Figure 7 . Wherein, the area of ​​lesion (%) = length of lesion (cm) / length of diseased leaf (cm).

[0088] like Figure 7 As shown, the average lesion area of ​​the two transgenic overexpression lines (22.70% and 24.49%, respectively) was significantly lower than that of the wild type (28.77%) ( Figure 7 A, B), the average lesion area of ​​the four gene-edited strains (41.10%, 30.55%, 33.03%, and 30.94%, respectively), among which the lesion area of ​​the knockout strain was significantly higher than that of the wild type (28.77%) ( Figure 7 A, B)

[0089] These results indicate that the gene OsSK8 positively regulates rice resistance to bacterial blight, and that overexpression of the OsSK8 gene can significantly enhance rice resistance to bacterial blight.

Claims

1. A method for regulating rice disease resistance gene, characterized in that: The gene is the OsSK8 gene, and its sequence is shown in SEQ ID NO.1 or SEQ ID NO.2; or a DNA molecule sequence of a gene that has more than 90% similarity to the nucleotide sequence of the OsSK8 gene and can regulate rice disease resistance; or a DNA molecule that can hybridize with the nucleotide sequence of the OsSK8 gene and can regulate rice disease resistance.

2. The rice disease resistance regulating gene according to claim 1, characterized in that: The disease resistance is preferably resistance to sheath blight and bacterial blight.

3. A protein encoded by a rice disease resistance regulating gene according to claim 1, characterized in that: The protein is encoded by SEQ ID NO.2, and its amino acid sequence is shown in SEQ ID NO.

3.

4. An overexpression vector containing the rice sheath blight resistance-related gene according to claim 1, characterized in that: The overexpression vector is obtained by amplifying the CDS sequence of the OsSK8 gene, connecting it to the overexpression vector pU1301, and extracting the plasmid through transformation to finally obtain the overexpression vector.

5. A gene knockout vector for a rice sheath blight resistance-related gene according to claim 1, characterized in that: The gene knockout vector comprises a target sequence and a CRISPR / Cas9 vector; the nucleotide sequence of the target sequence is shown in SEQ ID NO.

4.

6. A recombinant microorganism or transgenic plant cell line containing the overexpression vector according to claim 4 or the gene knockout vector according to claim 5.

7. Use of the rice disease resistance regulating gene according to claim 1, the protein encoded by the rice disease resistance regulating gene according to claim 2, the overexpression vector according to claim 4, the gene knockout vector according to claim 5, or the recombinant microorganism or transgenic plant cell line according to claim 6 in regulating rice disease resistance.

8. The use according to claim 7, characterized in that: Overexpression of the OsSK8 gene in rice increases resistance to rice sheath blight and bacterial leaf blight, while knocking out the OsSK8 gene reduces resistance to rice sheath blight and bacterial leaf blight.

9. Use of the regulated rice disease resistance gene according to claim 1, or the protein encoded by the regulated rice disease resistance gene according to claim 2, or the overexpression vector according to claim 4, or the gene knockout vector according to claim 5, or the recombinant microorganism or transgenic plant cell line according to claim 6 in cultivating rice germplasm with enhanced resistance to sheath blight and bacterial blight.

10. A method for cultivating transgenic rice with improved / reduced resistance to sheath blight and bacterial blight, comprising enhancing / reducing the expression level and / or activity of the protein encoded by the OsSK8 gene in a recipient rice to obtain transgenic rice, wherein the disease resistance of the transgenic rice is higher / lower than that of the recipient rice.

Images