Specific primer probe combination for identifying nontuberculous mycobacterium and detection method

Abstract

The invention provides a specific primer probe combination for identifying nontuberculous mycobacteria and a detection method. In the specific primer probe combination, a first round of amplification substance combination comprises at least one pair of SEQ ID NO.1 and 2, SEQ ID NO.4 and 5, SEQ ID NO.7 and 8, SEQ ID NO.10 and 11, SEQ ID NO.13 and 14, and SEQ ID NO.16 and 17, and a second round of amplification substance combination comprises SEQ ID NO.19 and 20 and a probe corresponding to the first round of amplification substance combination. According to the invention, nontuberculous mycobacteria are detected by an asymmetric PCR probe melting curve method. The detection method disclosed by the invention has the characteristics of simplicity in operation, high sensitivity, good repeatability and high specificity.

Description

Technical Field

[0001] The present invention relates to the technical field of bioforensic science, and in particular to a specific primer-probe combination and a detection method for identifying non-tuberculous mycobacteria. Background Art

[0002] The main pathogen of tuberculosis is Mycobacterium tuberculosis complex (MTBC), but in recent years, non-tuberculous mycobacteria (NTM) infection has also been on the rise. The diseases caused by MTBC and NTM are difficult to distinguish clinically, but the treatment plans for the two are significantly different. Therefore, rapid and accurate identification of NTM is of great significance for the early diagnosis and treatment of tuberculosis, as well as the control of tuberculosis infection. Common non-tuberculous mycobacteria that need to be identified and distinguished from Mycobacterium tuberculosis include Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii.

[0003] At present, domestic laboratories mainly use traditional bacteriological classification methods to identify NTM species, but this method is complicated and time-consuming, is not suitable for rapid clinical diagnosis, and is difficult to distinguish between closely related species.

[0004] The fluorescent PCR melting curve method is a simple and rapid molecular biological method for identifying NTM strains. The traditional asymmetric fluorescent PCR melting curve method requires adding multiple pairs of primers in the same tube and optimizing different primer concentrations for multiple detections, which leads to competition between multiple pairs of primers and thus causes low detection sensitivity. Summary of the invention

[0005] In view of the defects of the prior art, the purpose of the present invention is to provide a specific primer-probe combination and a detection method for identifying non-tuberculous mycobacteria, wherein the target-specific primer is connected to the label primer sequence, which increases the consistency of the specific primer and makes the amplification efficiency as consistent as possible. Asymmetric amplification is performed using a pair of label primers and a specific probe to realize the detection of non-tuberculous mycobacteria through the asymmetric PCR probe melting curve method.

[0006] To achieve the above object, the present invention provides a specific primer-probe combination for identifying non-tuberculous mycobacteria, wherein the specific primer-probe combination comprises a first-round amplification material combination and a second-round amplification material combination; wherein:

[0007] The first round amplification material combination includes at least one pair selected from the following nucleotide sequence pairs: SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.5, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.10 and SEQ ID NO.11, SEQ ID NO.13 and SEQ ID NO.14, SEQ ID NO.16 and SEQ ID NO.17;

[0008] The second-round amplification material combination includes SEQ ID NO.19 and SEQ ID NO.20 and probes corresponding to the nucleotide sequence pairs selected in the first-round amplification material combination, wherein the probes corresponding to the nucleotide sequence pairs SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.5, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.10 and SEQ ID NO.11, SEQ ID NO.13 and SEQ ID NO.14, SEQ ID NO.16 and SEQ ID NO.17 are SEQ ID NO.3, SEQ ID NO.6, SEQ ID NO.9, SEQ ID NO.12, SEQ ID NO.15, and SEQ ID NO.18 respectively.

[0009] In the above-mentioned specific primer-probe combination, preferably, the concentration of each pair of nucleotide sequence pairs in the first-round amplification material combination is 50 nM to 100 nM.

[0010] In the above-mentioned specific primer-probe combination, preferably, the concentrations of SEQ ID NO.19 and SEQ ID NO.20 in the second round amplification material combination are 1000nM-2000nM and 200nM-500nM respectively; and / or, the probe concentration is 20nM-80nM.

[0011] In the above-mentioned specific primer-probe combination, preferably, the first round amplification material combination includes SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.5, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.10 and SEQ ID NO.11, SEQ ID NO.13 and SEQ ID NO.14, SEQ ID NO.16 and SEQ ID NO.17;

[0012] The second round amplification material combination includes SEQ ID NO.19 and SEQ ID NO.20 as well as SEQ ID NO.3, SEQ ID NO.6, SEQ ID NO.9, SEQ ID NO.12, SEQ ID NO.15, and SEQ ID NO.18.

[0013] In the above-mentioned specific primer probe combination, preferably, the concentration of each pair of nucleotide sequence pairs in the first-round amplification material combination is 75nM, the concentrations of SEQ ID NO.19 and SEQ IDNO.20 in the second-round amplification material combination are 1500nM and 350nM respectively, the concentrations of SEQ ID NO.3, SEQID NO.6, and SEQ ID NO.12 in the second-round amplification material combination are all 40nM, and the concentrations of SEQ ID NO.9, SEQ ID NO.15, and SEQ ID NO.18 in the second-round amplification material combination are all 60nM.

[0014] The present invention also provides a kit for identifying non-tuberculous mycobacteria, which comprises the above-mentioned specific primer-probe combination.

[0015] In the above-mentioned kit, preferably, at least one of Taq reaction buffer, dNTP, Taq DNA polymerase, magnesium ions and water is also included.

[0016] The present invention also provides a method for identifying and detecting non-tuberculous mycobacteria, wherein the identification and detection method uses the aforementioned specific primer-probe combination or the aforementioned kit, and the identification and detection method comprises the following steps:

[0017] S11: preparing a non-tuberculous mycobacterium genomic DNA sample and the first-round amplification material combination, mixing the non-tuberculous mycobacterium genomic DNA sample and the first-round amplification material combination, and then performing a PCR reaction to obtain a first-round amplification product;

[0018] S12: preparing the second round amplification material combination, mixing the first round amplification product with the second round amplification material combination, and performing an asymmetric PCR reaction to obtain the second round amplification product;

[0019] S13: analyzing the melting curve of the target of the second round amplification product in the same and / or different optical channels to obtain a melting temperature value, and identifying the species of non-tuberculous mycobacteria according to the melting temperature value;

[0020] Wherein, the non-tuberculous mycobacterium genomic DNA sample comes from at least one non-tuberculous mycobacterium.

[0021] In the above identification and detection method, preferably, the species of the non-tuberculous mycobacteria include one or a combination of two or more of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum and Mycobacterium kansasii.

[0022] In the above identification and detection method, preferably, the reaction conditions for the PCR reaction in step S11 are: pre-denaturation at 95°C for 2 minutes, denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds, and 30 cycles;

[0023] The reaction conditions for the asymmetric PCR reaction in step S12 are: pre-denaturation at 95°C for 2 minutes, denaturation at 95°C for 15 seconds, annealing at 62°C for 30 seconds, 45 cycles, denaturation at 95°C for 2 minutes, heating from 50°C to 85°C to collect fluorescence.

[0024] The technical solution of the present invention has the following beneficial technical effects:

[0025] This patent innovatively proposes a method based on connecting a label primer to the 5′ end of the primer in combination with asymmetric PCR probe melting curve analysis. An identical label primer sequence is connected to the upstream and downstream 5′ ends of all target-specific primers, and the label primer sequence is unrelated to the target sequence. First, the target-specific primer pair is amplified to form an initial product containing label primer sequences at both ends, and then the second round of amplification is performed using the first round amplification product (initial product) as a template and the label primer pair as a primer. On the one hand, connecting the label primer sequence to the upstream and downstream 5′ ends of all target-specific primers causes local consistency in all target-specific primers. In the late stage of the second round of PCR amplification, because the single-stranded product (initial product) carries a label primer, and the primer pairs used in the second round of amplification only have one label primer pair, it is possible to achieve synchronous amplification of all initial products, so that the amplification efficiency of all target-specific primers is as consistent as possible, that is, the amplification results of all target-specific primers will not be significantly different, and thus all target detection results will not be due to differences in amplification factors. Differentiated results; secondly, the traditional asymmetric fluorescent PCR melting curve method requires the addition of multiple pairs of primers at the same time and the optimization of different primer concentrations for multiple detections. This patent only requires the second round of asymmetric amplification of the label primers. Although multiple pairs of primers are added to form a multiple amplification system during multiple detections, there is no need to conduct multiple experiments to determine the optimal primer concentration combination for each primer pair in the multiple amplification system, which greatly simplifies the research and development process of the detection reagent. At the same time, it also avoids the correlation between multiple primer pairs in the traditional method and the competition for raw materials such as enzymes and magnesium ions, which can greatly improve the detection sensitivity. This patent combines the melting curve analysis of asymmetric PCR probes with the connection of the label primer at the 5′ end of the primer, and the detection system has good sensitivity and specificity. The invention provides an asymmetric PCR probe melting curve method based on the connection of the label primer at the 5′ end of the primer. The primer probe is designed according to the specific sequence of the ITS (Intergenic transcribed spacer, ITS) region fragment, and is used for the identification and detection of non-tuberculous mycobacteria through two rounds of amplification. This method avoids the problem of mutual influence and low sensitivity between multiple primer pairs caused by conventional primer asymmetric PCR. At the same time, combined with melting curve analysis, the purpose of multiple analysis can be achieved. This method has the characteristics of simple operation, high sensitivity, good repeatability and high specificity. The target-specific primers of the first round of amplification are connected to the label primer sequence, which increases the consistency of the specific primers and makes the amplification efficiency as consistent as possible. The second round of amplification uses a pair of label primers and a specific probe for asymmetric amplification to realize the detection of non-tuberculous mycobacteria through the asymmetric PCR probe melting curve method. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1These are the amplification curves and melting curves of the first-round amplification primers of Mycobacterium avium at different primer concentrations.

[0027] Figure 2 These are the amplification curves and melting curves of the first-round amplification of Mycobacterium intracellulare at different primer concentrations.

[0028] Figure 3 The amplification curve and melting curve of Mycobacterium fortuitum at different primer concentrations in the first round of amplification.

[0029] Figure 4 These are the amplification curves and melting curves of the first-round amplification primers of Mycobacterium chelonae at different primer concentrations.

[0030] Figure 5 These are the amplification curves and melting curves of the first-round amplification primers of Mycobacterium kansasii at different primer concentrations.

[0031] Figure 6 The amplification curve and melting curve of Mycobacterium abscessus at different primer concentrations in the first round of amplification.

[0032] Figure 7 This is the melting curve of the second round amplification primers of Mycobacterium avium at different primer concentration combinations when the W-RP concentration is the same.

[0033] Figure 8 Figure 3 is the melting curve of the second round amplification primers of Mycobacterium avium at various primer concentration combinations under the optimal W-FP concentration.

[0034] Fig. 9 Melting curves of primers for the second round of amplification of Mycobacterium intracellulare at different primer concentration combinations when the W-RP concentration is the same.

[0035] Fig.10 Figure 3 is the melting curve of the second round amplification primers of Mycobacterium intracellulare at various primer concentration combinations under the optimal W-FP concentration.

[0036] Fig.11 The melting curves of the second-round amplification primers of each nontuberculous mycobacterium are shown in FIG. 1 when the concentration of W-FP / W-RP is 1500 / 350 nM.

[0037] Fig.12 Figure 2 is the melting curve of each nontuberculous mycobacterium at different probe concentrations.

[0038] Fig.13 The results of multiple sensitivity detection of nontuberculous mycobacteria at 100 CFU / mL.

[0039] Fig.14 The results of multiple sensitivity detection of nontuberculous mycobacteria at 50 CFU / mL.

[0040] Fig.15 The results are for multiple specific tests of nontuberculous mycobacteria.

[0041] Fig.16 This is the mixed validation result of two targets in the same channel for the multiple combination of non-tuberculous mycobacteria.

[0042] Fig.17 The results of the mixed validation of different channel targets for multiple combinations of Mycobacterium avium, Mycobacterium intracellulare, and Mycobacterium abscessus.

[0043] Fig.18 The results of mixed validation of different channel targets for multiple combinations of Mycobacterium fortuitum, Mycobacterium chelonae, and Mycobacterium kansasii. DETAILED DESCRIPTION

[0044] In order to have a clearer understanding of the technical features, purposes and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be construed as limiting the applicable scope of the present invention.

[0045] Example 1: Screening of primer concentrations for single-plex first-round amplification of nontuberculous mycobacteria

[0046] In this study, Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii were selected as reference sequences (Genebank numbers were CP046507.1, AP024247.1, CP003322.1, CP089589.1, CP110127.1, and AP023343.1, respectively), and primers and probes were designed using the ITS regions of different mycobacteria.

[0047] 1.1 Experimental Materials

[0048] 1.1.1 Instruments: Archimed, a medical fluorescence quantitative PCR instrument, and Qubit, a nucleic acid quantification instrument;

[0049] 1.1.2 Reagents: Extraction reagent: Universal genomic DNA extraction kit using magnetic beads (Tiangen); Detection reagent: Champagene TaqDNA Polymerase (Novozyme).

[0050] 1.1.3 Primers: synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0051] 1.1.4 Samples: Nontuberculous mycobacteria were purchased from Beina Chuanglian Biotechnology Co., Ltd.

[0052] 1.2 Primer design: In this study, primer probes for the identification of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii were designed using the specific sequences of the ITS gene fragments of each mycobacterium. The reference sequences of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii are CP046507.1, AP024247.1, CP003322.1, CP089589.1, CP110127.1, and AP023343.1, respectively. The specific primer sequences are shown in Table 1.

[0053]

[0054]

[0055] Note: CATTTCGGTACCCGAATTGA sequence and CTTCGTAGAGCCTAACGATA sequence are the tag primer sequences.

[0056] 1.3 Experimental design

[0057] 1.3.1 Template preparation: Purchase samples of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii and use a magnetic bead-based universal genomic DNA extraction kit (Tian Gen) to extract the samples. The extraction method was carried out in full accordance with the kit instructions, and the extracted genomic DNA was stored at -20°C.

[0058] 1.3.2 Primer combinations: 200 CFU / mL of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii DNA were selected as templates, and nuclease-free water was used as the control (NTC). The SYBR method (also known as the SYBR Green dye method, which is a fluorescent dye that can bind to the minor groove of double-stranded DNA, does not bind to single-stranded DNA, and has almost no fluorescence in the free state. It will only emit fluorescence when bound to double-stranded DNA. Therefore, the amount of double-stranded DNA produced by PCR amplification is directly related to the fluorescence intensity to produce a real-time monitoring effect. The change in the amount of double-stranded DNA produced by PCR amplification is reflected by the change in fluorescence intensity.) Use different concentrations of primer pairs to perform single-plex detection on the above-mentioned mycobacterial DNA templates to confirm the optimal primer concentration of each primer pair. The concentration and addition volume of each primer pair are shown in Table 2.

[0059] Table 2

[0060]

[0061] 1.3.3 Reaction system: According to the following reaction system, single primer combinations of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii were prepared for verification. The first round amplification reaction system is shown in Table 3.

[0062] Table 3

[0063]

[0064] 1.3.4 Reaction procedure: The reaction procedure is shown in Table 4.

[0065] Table 4

[0066]

[0067] 1.4 Experimental results: It should be noted that: usually after the primer design is completed, a primer feasibility verification experiment needs to be performed, that is, the designed primer pair is first used to detect the sample to form an amplification curve. If amplification occurs, it means that the primer pair is feasible and can detect the corresponding sample. In order to simplify the experimental process, this application combines the primer feasibility verification experiment with the primer concentration screening experiment, that is, the experiment in Example 1 can not only verify whether the primer is feasible, but also screen out the optimal primer concentration.

[0068] The primer concentration was screened by SYBR method. Figure 1 , the criteria for selecting the optimal primer concentration are:

[0069] ① Under different primer concentrations, NTC has no amplification or NTC has amplification but the melting peak of NTC can be distinguished from the target peak, and the CT value of NTC is greater than the CT value of the target;

[0070] ② On the other hand, under different primer concentrations, the primer concentration with a smaller target CT value and a higher melting peak should be selected;

[0071] ③On the other hand, when the CT values ​​are the same and the melting curves are not much different under different primer concentrations, choose the combination with a smaller primer concentration.

[0072] According to the NTC melting peak and the CT value of sample amplification, the optimal first-round amplification primer concentration was selected.

[0073] Figure 1 The amplification curve and melting curve of the first round amplification primers of Mycobacterium avium at various primer concentrations are shown in Figure 2. Figure 1As shown, Mycobacterium avium (M.avi): When the primer concentrations were 100nM, 75nM and 50nM, although NTC was amplified, the melting peak of NTC could be distinguished from the target peak, and the CT value of NTC was greater than the CT value of the target. Further observation showed that the CT values ​​were not much different when the primer concentrations were 100nM, 75nM and 50nM, while when the primer concentration was 75nM, the melting peak of the sample was higher than that of 50nM and 100nM, so 75nM was selected;

[0074] Figure 2 The amplification curve and melting curve of the first round amplification primers of intracellular mycobacterium at various primer concentrations are shown in Figure 2. Figure 2 As shown, Mycobacterium intracellulare (M.int): Compared with the primer concentration of 100 nM, there was no amplification of NTC and no melting peak when the primer concentration was 50 nM and 75 nM. Further observation showed that when the primer concentration was 75 nM, the sample CT value was smaller and the melting peak was also higher, so 75 nM was selected;

[0075] Figure 3 The amplification curve and melting curve of the first round amplification primers of Mycobacterium fortuitum at various primer concentrations are shown in Figure 2. Figure 3 As shown, Mycobacterium fortuitum (M.for): Compared with the primer concentration of 100nM, there was no amplification of NTC and no melting peak when the primer concentration was 50nM and 75nM. Further observation showed that when the primer concentration was 75nM, the sample CT value was smaller and the melting peak was also higher, so 75nM was selected;

[0076] Figure 4 The amplification curve and melting curve of the first round amplification primers of Mycobacterium chelonae at different primer concentrations are shown in Figure 2. Figure 4 As shown, Mycobacterium chelonae (M.che): When the primer concentrations were 100nM, 75nM, and 50nM, NTC was amplified, but the melting peak of NTC could be distinguished from the target peak, and the CT value of NTC was greater than the CT value of the target. Further observation showed that when the primer concentration was 75nM, the sample CT value was smaller and the melting peak was also higher, so 75nM was selected;

[0077] Figure 5 The amplification curve and melting curve of the first round amplification primers of Mycobacterium kansasii at various primer concentrations are shown in Figure 2. Figure 5 As shown, Mycobacterium kansasii (M.kan): compared with primer concentrations of 100 nM and 50 nM, there was no amplification or melting peak in NTC at a primer concentration of 75 nM, and the sample CT value was also smaller, so 75 nM was selected.

[0078] Figure 6 The amplification curve and melting curve of the first round amplification primers of Mycobacterium abscessus at various primer concentrations are shown in Figure 2. Figure 6As shown, Mycobacterium abscessus (M.abs): When the primer concentrations were 100nM, 75nM, and 50nM, NTC was amplified, but the melting peak of NTC could be distinguished from the target peak, and the CT value of NTC was greater than the CT value of the target. Further observation showed that when the primer concentration was 75nM, the sample CT value was smaller and the melting peak was also higher, so 75nM was selected;

[0079] Based on this experiment, a first-round amplification primer concentration of 75 nM was selected for each target for subsequent verification.

[0080] Example 2: Screening of primer concentrations for asymmetric amplification of single-plex second-round amplification of nontuberculous mycobacteria

[0081] In this study, Mycobacterium avium and Mycobacterium intracellulare were selected as reference sequences (Genebank numbers CP046507.1 and AP024247.1, respectively), and primers and probes were designed using the ITS regions of different mycobacteria.

[0082] 2.1 Experimental Materials

[0083] 2.1.1 Instruments: Archimed, a medical fluorescence quantitative PCR instrument, and Qubit, a nucleic acid quantification instrument;

[0084] 2.1.2 Reagents: Extraction reagent: Magnetic bead method universal genomic DNA extraction kit (Tiangen); Detection reagent: Champagene TaqDNA Polymerase (Novozyme).

[0085] 2.1.3 Primers: synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0086] 2.1.4 Samples: Nontuberculous mycobacteria were purchased from Beina Chuanglian Biotechnology Co., Ltd.

[0087] 2.2 Primer design: In this study, primers and probes for the identification of Mycobacterium avium and Mycobacterium intracellulare were designed using the specific sequences of the ITS gene fragment of Mycobacterium avium and the specific sequences of the ITS gene fragment of Mycobacterium intracellulare, respectively. The reference sequences of Mycobacterium avium and Mycobacterium intracellulare are CP046507.1 and AP024247.1, respectively. The specific primer and probe sequences are shown in Table 5.

[0088] Table 5

[0089]

[0090]

[0091] Note: CATTTCGGTACCCGAATTGA sequence and CTTCGTAGAGCCTAACGATA sequence are tag primer sequences, and CGTCGC sequence and CGTGCC sequence are stem sequences in molecular beacons.

[0092] 2.3 Experimental design

[0093] 2.3.1 Template preparation: Purchase samples of Mycobacterium avium and Mycobacterium intracellulare and use the magnetic bead method universal genomic DNA extraction kit (Tian Gen) to extract the samples. The extraction method was carried out in full accordance with the instructions of the kit, and the extracted genomic DNA was stored in an environment of -20°C.

[0094] 2.3.2 Primer combinations: Select 200 CFU / mL of Mycobacterium avium and Mycobacterium intracellulare DNA as templates to perform single-plex second-round amplification asymmetric primer concentration screening and verification. The concentrations of Mycobacterium avium and Mycobacterium intracellulare primer pairs in the first round of amplification were both 75 nM, and the added volume was 0.375 μL. The concentrations and added volumes of each primer pair and probe in the second round of amplification are shown in Table 6.

[0095] Table 6

[0096]

[0097] 2.3.3 Reaction system

[0098] The first round of amplification reaction system:

[0099] ① The reaction system of Mycobacterium avium / Mycobacterium intracellulare is shown in Table 7, wherein M.avi-F and M.avi-R are used for Mycobacterium avium, and M.int-F and M.int-R are used for Mycobacterium intracellulare.

[0100] Table 7

[0101]

[0102] The W-FP / W-RP amplification systems with different ratios in the second round of amplification reaction system are shown in Table 8:

[0103] Table 8

[0104]

[0105] 2.3.4 Reaction procedure

[0106] The first round of amplification reaction program is shown in Table 9:

[0107] Table 9

[0108]

[0109] The second round amplification reaction program is shown in Table 10:

[0110] Table 10

[0111]

[0112] 2.4 Experimental results: A sample concentration of 200 CFU / ml of Mycobacterium avium was used as a template for the second round of amplification single-asymmetric primer concentration screening experiment. Nine sets of primer concentration tests were performed. The melting curves are shown in Figure 2. Figure 7 As shown; the sample concentration of intracellular mycobacterium with a concentration of 200 CFU / ml was used as a template for the second round of amplification single-plex asymmetric primer concentration screening experiment. Nine groups of primer concentration tests were performed on it. The melting curve is shown in Fig. 9 As shown; the melting curve of the second round amplification primers of Mycobacterium avium at each primer concentration combination at the preferred W-FP concentration is shown Figure 8 As shown; the melting curve of the second round amplification primers of intracellular mycobacterium at each primer concentration combination at the preferred W-FP concentration is shown Fig.10 shown.

[0113] Based on the experimental results, the concentration of single-asymmetric primers for the second round of amplification was screened for single-asymmetric primer combinations of Mycobacterium avium and Mycobacterium intracellulare. The screening criteria were: first look at the melting curve peak height, select the primer concentration combination with a higher melting curve peak, and when the melting curve peak height is not much different, select the combination with a lower primer concentration.

[0114] Mycobacterium avium: Observation Figure 7 From the melting curves of the 9 primer concentration combinations tested, it can be seen that the melting curves when W-FP was 1500nM and 2000nM were not much different, both were higher than when W-FP was 1000nM, so W-FP was initially selected as 1500nM. On this basis, 3 more primer concentration combinations (W-FP / W-RP-1500nM / 200nM, 1500nM / 350nM, 1500nM / 5000nM) were tested, and the test results are as follows: Figure 8 As shown, observe Figure 8 From the melting curves of the three primer concentration combination test results, it can be seen that the melting curve peaks of the three primer concentration combination test results are not much different, and the primer concentration of 1500 / 350nM is relatively better. Therefore, the final selection and final determination of the W-FP / W-RP primer concentration is 1500 / 350nM.

[0115] Mycobacterium intracellulare: Observation Fig. 9From the melting curves of the 9 primer concentration combinations tested, it can be seen that the melting curves when W-FP was 1500nM and 2000nM were not much different, both were higher than when W-FP was 1000nM, so W-FP was initially selected as 1500nM. On this basis, 3 more primer concentration combinations (W-FP / W-RP-1500nM / 200nM, 1500nM / 350nM, 1500nM / 5000nM) were tested, and the test results are as follows: Fig.10 As shown, observe Fig.10 From the melting curves of the three primer concentration combination test results, it can be seen that the melting curve peaks of the three primer concentration combination test results are not much different, and the primer concentration of 1500 / 350nM is relatively better. Therefore, the final selection and final determination of the W-FP / W-RP primer concentration is 1500 / 350nM.

[0116] Based on this experiment, the concentration of asymmetric amplification primers was determined to be 1500 / 350 nM for subsequent experiments.

[0117] Example 3: Single-plex verification of all targets after the concentration of asymmetric primers is determined for the second round of amplification of nontuberculous mycobacteria

[0118] According to the results of the asymmetric primer concentration adjustment for the second-round amplification of Mycobacterium avium and Mycobacterium intracellulare, after determining the asymmetric primer concentration for the second-round amplification, single-plex verification of other targets was performed.

[0119] 3.1 Experimental Materials

[0120] 3.1.1 Instruments: Archimed, a medical fluorescence quantitative PCR instrument, and Qubit, a nucleic acid quantification instrument;

[0121] 3.1.2 Reagents: Extraction reagent: Magnetic bead method universal genomic DNA extraction kit (Tiangen); Detection reagent: Champagene TaqDNA Polymerase (Novozyme).

[0122] 3.1.3 Primers: synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0123] 3.1.4 Samples: Nontuberculous mycobacteria were purchased from Beina Chuanglian Biotechnology Co., Ltd.

[0124] 3.2 Primer probe design: In this study, primer probes for the identification of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii were designed using the specific sequences of the ITS gene fragments of each mycobacterium. The reference sequences of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii are CP046507.1, AP024247.1, CP003322.1, CP089589.1, CP110127.1, and AP023343.1, respectively. The primer probe sequences are shown in Table 11.

[0125] Table 11

[0126]

[0127] Note: CATTTCGGTACCCGAATTGA sequence and CTTCGTAGAGCCTAACGATA sequence are tag primer sequences, and CGTCGC sequence and CGTGCC sequence are stem sequences in molecular beacons.

[0128] 3.3 Experimental design

[0129] 3.3.1 Template preparation: Purchase samples of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii and use a magnetic bead-based universal genomic DNA extraction kit (Tian Gen) to extract the samples. The extraction method was carried out in full accordance with the instructions of the kit, and the extracted genomic DNA was stored at -20°C.

[0130] 3.3.2 Primer combinations: 200 CFU / mL of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii DNA were used as templates, and the concentration of the second-round amplification primers W-FP / W-RP was 1500 / 350 nM for single-plex verification.

[0131] In the first round of amplification, the concentrations of upstream and downstream primers of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii were all 75 nM, and the added volume was all 0.375 μL.

[0132] In the second round of amplification, the concentration of W-FP (SEQ ID NO.19) was 1500 nM, the added volume was 7.5 μL, the concentration of W-RP (SEQID NO.20) was 350 nM, the added volume was 1.75 μL, the concentration of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii probes were 30 nM, and the added volume was 0.15 μL.

[0133] 3.3.3 Reaction system: Prepare single primer combinations for Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii according to the following reaction systems for verification. The upstream primers and downstream primers in the first round of amplification reaction system are shown in 3.3.2 for the first round of amplification primers and concentrations of each target, and the rest of the reaction system is the same as Table 7. The upstream primers and downstream primers in the second round of amplification reaction system are shown in 3.3.2 for the second round of amplification primers and concentrations of each target, and the probes are shown in 3.3.2 for the probes and concentrations of each target, and the rest of the reaction system is the same as Table 8.

[0134] 3.3.4 Reaction procedure: The first round amplification reaction procedure is the same as Table 9. The second round amplification reaction procedure is the same as Table 10.

[0135] 3.4 Experimental results: After determining the concentration of the asymmetric amplification primers W-FP / W-RP in the second round of amplification to be 1500 / 350 nM, single-plex verification was performed on all targets. The melting curves of the second round amplification primers W-FP / W-RP concentrations of each non-tuberculous mycobacterium when the concentration was 1500 / 350 nM are shown in the figure below. Fig.11 As shown, Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium abscessus, Mycobacterium chelonae, Mycobacterium fortuitum, and Mycobacterium kansasii can all be detected. Based on this experiment, the concentration of the asymmetric amplification primers W-FP / W-RP in the second round of amplification was determined to be 1500 / 350 nM and used in subsequent multiple experiments.

[0136] Example 4: Adjustment of the concentration of single-plex probes for nontuberculous mycobacteria

[0137] After each target single-plex is verified to be correct, the concentration of each target single-plex probe is adjusted.

[0138] 4.1 Experimental Materials

[0139] 4.1.1 Instruments: Archimed, a medical fluorescence quantitative PCR instrument, and Qubit, a nucleic acid quantification instrument;

[0140] 4.1.2 Reagents: Extraction reagent: Magnetic bead method universal genomic DNA extraction kit (Tiangen); Detection reagent: Champagene TaqDNA Polymerase (Novozyme).

[0141] 4.1.3 Primers: synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0142] 4.1.4 Samples: Nontuberculous mycobacteria were purchased from Beina Chuanglian Biotechnology Co., Ltd.

[0143] 4.2 Experimental design

[0144] 4.2.1 Template preparation: Purchase samples of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii and use a magnetic bead-based universal genomic DNA extraction kit (Tian Gen) to extract the samples. The extraction method was carried out in full accordance with the instructions of the kit, and the extracted genomic DNA was stored at -20°C.

[0145] 4.2.2 Primer combinations: Select 200 CFU / mL of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii DNA as templates, and use their respective primers and probes to detect the templates. The concentrations of upstream and downstream primers of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii in the first round of amplification are all 75 nM, and the added volume is 0.375 μL. The primer pairs and probe combinations of the second round of amplification are shown in Table 12.

[0146] Table 12

[0147]

[0148] 4.2.3 Reaction system: Prepare single primer combinations for Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii according to the following reaction systems to verify the single probe concentration adjustment. The upstream primers and downstream primers in the first round amplification reaction system can be found in 4.2.2 First round amplification primers for each target, and the rest of the reaction system is the same as Table 7. The upstream primers and downstream primers in the second round amplification reaction system can be found in 4.2.2 Second round amplification primers and concentrations for each target, and the probes can be found in 4.2.2 Probes and concentrations for each target, and the rest of the reaction system is the same as Table 8.

[0149] 4.2.4 Reaction procedure: The first round amplification reaction procedure is the same as Table 9. The second round amplification reaction procedure is the same as Table 10.

[0150] 4.3 Experimental results: The probe concentration screening and verification were performed on Mycobacterium chelonae, Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium abscessus, Mycobacterium fortuitum, and Kansas single complex. The melting curves of each non-tuberculous mycobacterium at different probe concentrations are shown in Figure 2. Fig.12As shown, the melting peaks of Mycobacterium avium and Mycobacterium intracellulare were higher when the probe concentration was 40nM, so the probe 40nM was selected for Mycobacterium avium and Mycobacterium intracellulare; the melting peaks of Mycobacterium abscessus probe were not much different when the probe concentration was 40, 60, and 80nM, all of which were better than 20nM, so the probe 40nM was selected for Mycobacterium abscessus; the melting peaks of Mycobacterium chelonae, Mycobacterium fortuitum, and Mycobacterium kansasii were not much different when the probe was 60nM and 80nM, which was better than the probes 20nM and 40nM, so the probe 60nM was selected for Mycobacterium chelonae, Mycobacterium fortuitum, and Mycobacterium kansasii. After the single-plex probe concentrations of each target were determined based on this experiment, multiple verifications were performed in subsequent combinations.

[0151] Example 5: Nontuberculous Mycobacteria Multiple Combination Sensitivity Verification

[0152] The primers and probes of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii were multiplexed to verify the sensitivity of the multiplexed system.

[0153] 5.1 Experimental Materials

[0154] 5.1.1 Instruments: Archimed, a medical fluorescence quantitative PCR instrument, and Qubit, a nucleic acid quantification instrument;

[0155] 5.1.2 Reagents: Extraction reagent: Magnetic bead method universal genomic DNA extraction kit (Tiangen); Detection reagent: Champagene TaqDNA Polymerase (Novozyme).

[0156] 5.1.3 Primers: synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0157] 5.1.4 Samples: Nontuberculous mycobacteria were purchased from Beina Chuanglian Biotechnology Co., Ltd.

[0158] 5.2 Experimental design

[0159] 5.2.1 Template preparation: Purchase samples of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii and use a magnetic bead-based universal genomic DNA extraction kit (Tian Gen) to extract the samples. The extraction method was carried out in full accordance with the instructions of the kit, and the extracted genomic DNA was stored at -20°C.

[0160] 5.2.2 Primer combinations of each group: 50 CFU / mL and 100 CFU / mL of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii DNA were selected as templates, and multiple detection was performed using each template. The concentration of upstream and downstream primers of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii in the first round of amplification was 75 nM, and the added volume was 0.375 μL. The primer pairs and probe combinations for the second round of amplification are shown in Table 13.

[0161] Table 13

[0162]

[0163]

[0164] 5.2.3 Reaction system: Mix the primers and probes according to the following reaction system to form a multiplex detection system. The upstream primers and downstream primers in the first round of amplification reaction system can be found in 5.2.2 First round amplification primers for each target, and the rest of the reaction system is the same as Table 7. The upstream primers and downstream primers in the second round of amplification reaction system can be found in 5.2.2 Second round amplification primers and concentrations for each target, and the probes can be found in 5.2.2 Probes and concentrations for each target, and the rest of the reaction system is the same as Table 8.

[0165] 5.2.4 Reaction procedure: The first round amplification reaction procedure is the same as Table 9. The second round amplification reaction procedure is the same as Table 10.

[0166] 5.3 Experimental results: Based on the system optimization results, the primers and probes were mixed and configured into a multiplex detection system. DNA of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii were detected. Fig.13 The results of multiple sensitivity tests for nontuberculous mycobacteria at 100 CFU / mL; Fig.14 The results of multiple sensitivity tests for nontuberculous mycobacteria at 50 CFU / mL. Fig.13 and Fig.14 The results showed that the samples could not be detected at 50 CFU / ml, but could be detected normally at 100 CFU / mL, and the sensitivity was qualified. Therefore, the sensitivity of the multiple detection system was 100 CFU / mL.

[0167] Example 6: Verification of detection system specificity

[0168] In the multiple combinations, 7 bacteria (Enterococcus faecalis, Escherichia coli, Pseudomonas aeruginosa, Acinetobacter baumannii, Enterobacter cloacae, Staphylococcus aureus, Klebsiella pneumoniae subsp. pneumoniae) at 10,000 CFU / mL, 3 fungi (Candida albicans, Aspergillus terreus, Candida krusei) at 10,000 CFU / mL, and 3 non-target mycobacteria (Mycobacterium nautilus, Mycobacterium scrofulae, Mycobacterium gordonii) at 1,000 CFU / mL were detected to verify the specificity of the system.

[0169] 6.1 Experimental Materials

[0170] 6.1.1 Instruments: Archimed, a medical fluorescence quantitative PCR instrument, and Qubit, a nucleic acid quantification instrument;

[0171] 6.1.2 Reagents: Extraction reagent: Magnetic bead method universal genomic DNA extraction kit (Tiangen); Detection reagent: Champagene TaqDNA Polymerase (Novozyme).

[0172] 6.1.3 Primers: synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0173] 6.1.4 Samples: 10,000 CFU / mL of 7 bacteria (Enterococcus faecalis, Escherichia coli, Pseudomonas aeruginosa, Acinetobacter baumannii, Enterobacter cloacae, Staphylococcus aureus, Klebsiella pneumoniae subsp.), 10,000 CFU / mL of 3 fungi (Candida albicans, Aspergillus terreus, Candida krusei), 1000 CFU / mL of 3 non-target mycobacteria (Mycobacterium tomatis, Mycobacterium scrofulae, Mycobacterium gordonii).

[0174] 6.2 Experimental design

[0175] 6.2.1 Template preparation: Seven bacteria, three fungi and three non-target mycobacterium samples were purchased and extracted using a magnetic bead-based universal genomic DNA extraction kit (Tian Gen). The extraction method was carried out in full accordance with the kit instructions, and the extracted genomic DNA was stored at -20°C.

[0176] 6.2.2 Primer combinations: The concentration of upstream and downstream primers for Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii in the first round of amplification was 75 nM, and the added volume was 0.375 μL. The multiple primer pairs and probe combinations for the second round of amplification are shown in Table 13.

[0177] 6.2.3 Reaction system: Mix the primers and probes according to the following reaction system to form a multiplex detection system. The upstream primers and downstream primers in the first round of amplification reaction system are shown in 6.2.2 First round amplification primers for each target, and the rest of the reaction system is the same as Table 7. The upstream primers and downstream primers in the second round of amplification reaction system are shown in 6.2.2 Second round amplification primers and concentrations for each target, and the probes are shown in 6.2.2 Probes and concentrations for each target, and the rest of the reaction system is the same as Table 8.

[0178] 6.2.4 Reaction procedure: The first round amplification reaction procedure is the same as Table 9. The second round amplification reaction procedure is the same as Table 10.

[0179] 6.3 Experimental results: Based on multiple combinations, the system specificity study, the results of multiple specificity detection of nontuberculous mycobacteria are as follows Fig.15 As shown, the results show that the detection system has no cross-reaction to other common bacteria, fungi, and mycobacteria, because no relevant melting peaks appear, which means that common bacteria, fungi, and mycobacteria are not detected.

[0180] Example 7: Multi-target hybrid validation

[0181] According to the multiple combination system, multi-target mixed validation was carried out, including mixed validation of two targets in the same channel: Mycobacterium avium + Mycobacterium fortuitum, Mycobacterium abscessus + Mycobacterium kansasii, Mycobacterium intracellulare + Mycobacterium chelonae, and the final concentration of the samples was 200 CFU / ml; mixed validation of targets in different channels: Mycobacterium avium + Mycobacterium intracellulare + Mycobacterium abscessus, Mycobacterium fortuitum + Mycobacterium kansasii + Mycobacterium chelonae, and the final concentration of the samples was 200 CFU / ml.

[0182] 7.1 Experimental Materials

[0183] 7.1.1 Instruments: Archimed, a medical fluorescence quantitative PCR instrument, and Qubit, a nucleic acid quantification instrument;

[0184] 7.1.2 Reagents: Extraction reagent: Universal genomic DNA extraction kit using magnetic beads (Tiangen); Detection reagent: Champagene TaqDNA Polymerase (Novozyme).

[0185] 7.1.3 Primers: Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0186] 7.1.4 Samples: Nontuberculous mycobacteria were purchased from Beina Chuanglian Biotechnology Co., Ltd.

[0187] 7.2 Experimental Design

[0188] 7.2.1 Template preparation: Purchase samples of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii and use a magnetic bead-based universal genomic DNA extraction kit (Tian Gen) to extract the samples. The extraction method was carried out in full accordance with the kit instructions, and the extracted genomic DNA was stored at -20°C.

[0189] 7.2.2 Primer combinations of each group: A mixed sample with a final concentration of 200 CFU / mL was selected: Mycobacterium avium + Mycobacterium fortuitum, Mycobacterium abscessus + Mycobacterium kansasii, Mycobacterium intracellulare + Mycobacterium chelonae, Mycobacterium avium + Mycobacterium intracellulare + Mycobacterium abscessus, Mycobacterium fortuitum + Mycobacterium kansasii + Mycobacterium chelonae DNA was used as a template to detect multiple combinations. The concentration of upstream and downstream primers of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum, and Mycobacterium kansasii in the first round of amplification was 75 nM, and the added volume was 0.375 μL. The primer pairs and probe combinations for the second round of amplification are shown in Table 13.

[0190] 7.2.3 Reaction system: Mix the primers and probes according to the following reaction system to form a multiplex detection system. The upstream primers and downstream primers in the first round of amplification reaction system are shown in 7.2.2 First round amplification primers for each target, and the rest of the reaction system is the same as Table 7. The upstream primers and downstream primers in the second round of amplification reaction system are shown in 7.2.2 Second round amplification primers and concentrations for each target, and the probes are shown in 7.2.2 Probes and concentrations for each target, and the rest of the reaction system is the same as Table 8.

[0191] 7.2.4 Reaction procedure: The first round amplification reaction procedure is the same as Table 9. The second round amplification reaction procedure is the same as Table 10.

[0192] 7.3 Experimental results: Based on multiple combinations, multi-target mixed verification is performed. When two target samples in the same channel are mixed, the two target peaks can be distinguished and detected. When target samples in different channels are mixed, the verification is qualified if all targets can be detected. Fig.16 This is the mixed validation result of two targets in the same channel for multiple combinations of non-tuberculous mycobacteria. Fig.17 The results of mixed validation of different channel targets for multiple combinations of Mycobacterium avium, Mycobacterium intracellulare, and Mycobacterium abscessus are shown. Fig.18 This is the mixed verification result of different channel targets of multiple combinations of Mycobacterium fortuitum, Mycobacterium chelonae, and Mycobacterium kansasii. According to the results shown in the figure, it can be seen that the multiple detection system of the present application is qualified in the multi-target verification experiment.

Claims

1. A specific primer-probe combination for identifying non-tuberculous mycobacteria, the specific primer-probe combination comprising a first-round amplification material combination and a second-round amplification material combination; wherein: The first round amplification material combination includes at least one pair selected from the following nucleotide sequence pairs: SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.5, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.10 and SEQ ID NO.11, SEQ ID NO.13 and SEQ ID NO.14, SEQ ID NO.16 and SEQ ID NO.17; The second-round amplification material combination includes SEQ ID NO.19 and SEQ ID NO.20 and probes corresponding to the nucleotide sequence pairs selected in the first-round amplification material combination, wherein the probes corresponding to the nucleotide sequence pairs SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.5, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.10 and SEQ ID NO.11, SEQ ID NO.13 and SEQ ID NO.14, SEQ ID NO.16 and SEQ ID NO.17 are SEQ ID NO.3, SEQ ID NO.6, SEQ ID NO.9, SEQ ID NO.12, SEQ ID NO.15, and SEQID NO.18 respectively.

2. The specific primer-probe combination according to claim 1, wherein: The concentration of each pair of nucleotide sequences in the first round amplification material combination is 50 nM to 100 nM.

3. The specific primer-probe combination according to claim 1 or 2, wherein: The concentrations of SEQ ID NO.19 and SEQ ID NO.20 in the second round amplification substance combination are 1000nM to 2000nM and 200nM to 500nM respectively; and / or the probe concentration is 20nM to 80nM.

4. The specific primer-probe combination according to claim 1, wherein: The first round amplification material combination includes SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.5, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.10 and SEQ ID NO.11, SEQ ID NO.13 and SEQ ID NO.14, SEQ ID NO.16 and SEQ ID NO.17; The second round amplification material combination includes SEQ ID NO.19 and SEQ ID NO.20 as well as SEQ ID NO.3, SEQ ID NO.6, SEQ ID NO.9, SEQ ID NO.12, SEQ ID NO.15, and SEQ ID NO.

18.

5. The specific primer-probe combination according to claim 4, wherein: The concentration of each pair of nucleotide sequence pairs in the first-round amplification material combination is 75nM, the concentrations of SEQ ID NO.19 and SEQ ID NO.20 in the second-round amplification material combination are 1500nM and 350nM respectively, the concentrations of SEQ IDNO.3, SEQ ID NO.6, and SEQ ID NO.12 in the second-round amplification material combination are all 40nM, and the concentrations of SEQID NO.9, SEQ ID NO.15, and SEQ ID NO.18 in the second-round amplification material combination are all 60nM.

6. A kit for identifying nontuberculous mycobacteria, wherein: The method comprises the specific primer-probe combination as described in any one of claims 1 to 5.

7. The kit according to claim 6, wherein The method further comprises at least one of Taq reaction buffer, dNTP, Taq DNA polymerase, magnesium ions and water.

8. A method for identifying and detecting nontuberculous mycobacteria, wherein: The identification detection method uses the specific primer-probe combination according to any one of claims 1 to 5 or the kit according to claim 6 or 7, and the identification detection method comprises the following steps: S11: preparing a non-tuberculous mycobacterium genomic DNA sample and the first-round amplification material combination, mixing the non-tuberculous mycobacterium genomic DNA sample and the first-round amplification material combination, and then performing a PCR reaction to obtain a first-round amplification product; S12: preparing the second round amplification material combination, mixing the first round amplification product with the second round amplification material combination, and performing an asymmetric PCR reaction to obtain the second round amplification product; S13: analyzing the melting curve of the target of the second round amplification product in the same and / or different optical channels to obtain a melting temperature value, and identifying the species of non-tuberculous mycobacteria according to the melting temperature value; Wherein, the non-tuberculous mycobacterium genomic DNA sample comes from at least one non-tuberculous mycobacterium.

9. The identification and detection method according to claim 8, wherein: The non-tuberculous mycobacterium species include one or a combination of two or more of Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium fortuitum and Mycobacterium kansasii.

10. The identification and detection method according to claim 8 or 9, wherein: The reaction conditions for the PCR reaction in step S11 are: pre-denaturation at 95°C for 2 minutes, denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds, and 30 cycles; The reaction conditions for the asymmetric PCR reaction in step S12 are: pre-denaturation at 95°C for 2 minutes, denaturation at 95°C for 15 seconds, annealing at 62°C for 30 seconds, 45 cycles, denaturation at 95°C for 2 minutes, heating from 50°C to 85°C to collect fluorescence.

Images