Application of ags1 gene segment in regulating synthesis of monascus exopolysaccharide

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of an ags1 gene segment in regulating monascus exopolysaccharide synthesis. According to the invention, the ags1 gene segment related to synthesis of a mycelium aggregation factor-cell wall alpha-1, 3-glucan is found from monascus for the first time, and experimental research finds that compared with an initial strain, the content of exopolysaccharides in liquid fermentation liquor of monascus recombinant bacteria of which the gene segment is knocked out is remarkably increased, and the content of the exopolysaccharides in the liquid fermentation liquor is remarkably reduced. The content of extracellular polysaccharide in liquid fermentation liquor of monascus recombinant bacteria overexpressing the gene segment is reduced, but the relative content of galactomannan in the extracellular polysaccharide is increased, so that the monascus recombinant bacteria have higher immunocompetence.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and particularly relates to ags1 Application of gene fragments in regulating exopolysaccharide synthesis in Monascus purpurogenus. Background Art

[0002] Monascus Monascus spp . ) is a small hemisaccharidic filamentous fungus, and the exopolysaccharides (EPS) in its fermentation broth contain substances with immunomodulatory activity such as galactomannan. Galactomannan can improve the survival rate of immune cells and promote the secretion of NO, IL-6 and TNF-α cytokines, but the relative content of galactomannan in the exopolysaccharides produced by Monascus is not high. On the other hand, Monascus is prone to aggregation during liquid fermentation, which greatly affects the yield of exopolysaccharides, thereby limiting the widespread application and promotion of Monascus exopolysaccharides. Therefore, regulating the relative content or yield of immunologically active substances in Monascus exopolysaccharides has positive significance for the further development of Monascus exopolysaccharides. Summary of the invention

[0003] In view of the above technical problems, the present invention provides ags1 The application of gene fragments in regulating the synthesis of Monascus exopolysaccharide. The present invention first discovered that ags1 The gene has an impact on the production of Monascus exopolysaccharides and the relative content of galactomannan. The production of Monascus exopolysaccharides can be increased by knocking out the gene fragment, or the relative content of galactomannan in Monascus exopolysaccharides can be increased by overexpressing it, thereby improving its immune activity.

[0004] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions: The first aspect of the present invention provides ags1 Application of gene fragments in regulating the synthesis of Monascus exopolysaccharide, the ags1 The nucleotide sequence of the gene fragment is shown in SEQ ID NO.1.

[0005] ags1 Nucleotide sequence of gene fragment:

[0006] The present invention is the first to discover a protein related to the synthesis of cell wall α-1,3-glucan, a mycelium aggregation factor of Monascus, from Monascus. ags1 Gene fragment. The present invention has found through experimental research that compared with the initial strain, the content of extracellular polysaccharides in the liquid fermentation broth of the Monascus recombinant bacteria with the gene fragment knocked out is significantly increased, while the content of extracellular polysaccharides in the liquid fermentation broth of the Monascus recombinant bacteria overexpressing the gene fragment is reduced, but the content of galactomannan (monosaccharide composition is galactose and mannose) in the extracellular polysaccharide is increased, and has higher immune activity. This discovery provides a valuable reference for increasing the production of fungal extracellular polysaccharides and galactomannan and its application in immune regulation.

[0007] The second aspect of the present invention provides a nucleotide sequence as shown in SEQ ID NO.1 ags1 Application of gene fragments in promoting the synthesis of exopolysaccharides by Monascus.

[0008] The third aspect of the present invention provides a knockout nucleotide sequence as shown in SEQ ID NO.1 ags1 Recombinant expression vector of gene fragment.

[0009] Preferably, the recombinant expression vector includes a recombinant plasmid and a recombinant bacterium.

[0010] More preferably, the recombinant bacteria is recombinant Monascus.

[0011] The fourth aspect of the present invention provides a knockout nucleotide sequence as shown in SEQ ID NO.1 ags1 The method for constructing a recombinant plasmid of a gene fragment specifically comprises the following steps: S1. Using the whole genome DNA of Monascus purpurogenus as template, the upstream homology arm primers with sequences as shown in SEQ ID NO. 2 and SEQ ID NO. 3 were used. ags1 -1-F and ags1 -1-R and downstream homology arm primers as shown in SEQ ID NO.4 and SEQ ID NO.5 ags1 -2-F and ags1 -2-R was amplified by PCR to obtain the upstream homology arm fragment with the sequence shown in SEQ ID NO.6 ags1- 1 and the downstream homology arm fragment shown in SEQ ID NO.7 ags1- 2; S2, the plasmid carrying the kanamycin selection gene is connected to the upstream homology arm fragment ags1-1. Connect and introduce into competent E. coli (DH5α), spread on LB plate containing kanamycin, transfer the grown colonies to LB liquid medium containing kanamycin for culture, then collect all the cells by centrifugation and extract the plasmid; S3, the plasmid obtained in S2 and the downstream homology arm fragment ags1- 2. Connect and introduce into competent E. coli (DH5α), spread on LB plate containing kanamycin, and after cultivation, transfer the grown colonies to LB liquid medium containing kanamycin for cultivation, then collect all the bacteria by centrifugation, extract the plasmid, and the obtained plasmid is the knockout ags1 Recombinant plasmid of gene fragment.

[0012] Preferably, the plasmid with kanamycin selection gene in S2 and the ags1 Gene fragments Kpn Ⅰ and BamH After digestion by enzyme Ⅰ, ligation was performed using T4 ligase at room temperature.

[0013] Preferably, the culture temperature on the LB plate in S2 is 37±1° C. and the culture time is 18-20 h.

[0014] Preferably, the culture temperature in liquid culture medium in S2 is 37±1° C. and the culture time is 6-7 h.

[0015] Preferably, in S3, the plasmid obtained in S2 is consistent with the downstream homology arm fragment ags1- 2 Use Pst Ⅰ and Hind After digestion with III enzyme, the fragments were connected at room temperature using T4 ligase.

[0016] Preferably, the culture temperature on the LB plate in S3 is 37±1° C., and the culture time is 18-20 h.

[0017] Preferably, the culture temperature in liquid culture medium in S3 is 37±1° C. and the culture time is 6-7 h.

[0018] Preferably, the plasmid is plasmid p59.

[0019] The fifth aspect of the present invention provides a knockout nucleotide sequence as shown in SEQ ID NO.1 ags1 The method for constructing a recombinant Monascus of the gene is as follows: the recombinant Monascus carrying the hygromycin selection gene and knocking out the ags1 The recombinant plasmid of the gene is introduced into the protoplasts of Monascus spores, and the plasmid is spread on a PDA plate containing hygromycin. After cultivation, strains that can grow on the PDA plate containing hygromycin are selected to knock out the gene. ags1 Genes of recombinant Monascus purpureus.

[0020] Preferably, the recombinant plasmid is plasmid p59.

[0021] Preferably, the Monascus is purple Monascus M9.

[0022] Exemplarily, the knockout ags1 The method for introducing the recombinant plasmid of the gene into the protoplasts of Monascus spores can be performed by the following operation: knocking out the ags1 The recombinant plasmid of the gene was mixed with the spore protoplasts, placed on ice for 30 minutes, 1 mL of PTC solution was added, and the mixture was placed at room temperature for 15 minutes. After mixing, 200 μL was taken and placed in a new EP tube. 1 mL of STC solution was aspirated and added to the EP tube. After mixing, the mixture was spread on a PDA plate containing hygromycin (200 μL / 100 mL). The composition and preparation method of the PTC solution are as follows: 40% PEG4000, 50 mmol / L Tris-HCl, 50 mmol / L CaCl2, the solvent is sterile water, and the mixture is sterilized at 121°C for 20 minutes. The composition and preparation method of the STC solution are as follows: 1 mol / L sorbitol, 100 mmol / L Tris-HCl, 50 mmol / LCaCl2, the solvent is sterile water, and the mixture is sterilized at 121°C for 20 minutes. Knock out the ags1 The recombinant plasmid of the gene contains a hygromycin selection gene, while the initial Monascus strain does not contain the hygromycin selection gene and cannot grow on a PDA plate containing hygromycin, thereby obtaining a positive transformant.

[0023] The sixth aspect of the present invention provides a nucleotide sequence as shown in SEQ ID NO.1 ags1 Application of gene fragments in increasing the relative content of galactomannan in extracellular polysaccharides.

[0024] The seventh aspect of the present invention provides an overexpression nucleotide sequence as shown in SEQ ID NO.1 ags1 Recombinant expression vector of gene fragment.

[0025] Preferably, the recombinant expression vector includes a recombinant plasmid and a recombinant bacterium.

[0026] More preferably, the recombinant bacteria is recombinant Monascus.

[0027] The eighth aspect of the present invention provides an overexpression nucleotide sequence as shown in SEQ ID NO.1 ags1 The method for constructing a recombinant plasmid of a gene fragment specifically comprises the following steps: SI, extract the total RNA of Monascus purpureus and reverse transcribe it into cDNA as a template, using the primers shown in SEQ ID NO.8 ags1 -F and a primer with a sequence as shown in SEQ ID NO.9ags1 -R was obtained by PCR amplification ags1 Gene fragments; S II, the plasmid carrying the kanamycin selection gene and the ags1 The gene fragments were connected and introduced into competent Escherichia coli (DH5α), and then spread on LB plates containing kanamycin for culture. The grown colonies were transferred to LB liquid medium containing kanamycin for culture, and then all the bacteria were collected by centrifugation and the plasmid was extracted. The obtained plasmid was the overexpression plasmid. ags1 Recombinant plasmid of gene fragment.

[0028] Preferably, the plasmid with kanamycin selection gene in S II and the ags1 Gene fragments Nco Ⅰ and Afl After digestion with II enzyme, the fragments were connected at room temperature using T4 ligase.

[0029] Preferably, the culture temperature on the LB plate in S II is 37±1° C. and the culture time is 18-20 h.

[0030] Preferably, the culture temperature in liquid culture medium in S II is 37±1° C. and the culture time is 6-7 h.

[0031] Preferably, the plasmid is plasmid p1301. Plasmid p1301 contains a super strong promoter CaMV 35S, which has a repeated enhancer region from cauliflower mosaic virus, and the plasmid carries kanamycin and hygromycin selection genes. Therefore, connecting the target gene fragment to the downstream of the strong promoter CaMV 35S can enhance the target gene ( ags1 )The role of expression.

[0032] The ninth aspect of the present invention provides an overexpression nucleotide sequence as shown in SEQ ID NO.1 ags1 A method for constructing a recombinant Monascus containing a gene fragment: carrying a hygromycin selection gene and overexpressing the ags1 The recombinant plasmid of the gene is introduced into the protoplasts of Monascus spores, and the plasmid is spread on a PDA plate containing hygromycin. After cultivation, strains that can grow on the PDA plate containing hygromycin are selected to obtain strains overexpressing the gene. ags1 Genes of recombinant Monascus purpureus.

[0033] Preferably, the recombinant plasmid is plasmid p1301.

[0034] Preferably, the Monascus is purple Monascus M9.

[0035] Exemplarily, overexpressing ags1The method for introducing the recombinant plasmid of the gene fragment into the protoplasts of Monascus spores can be performed by the following operation: ags1 The plasmid p1301 of the gene was mixed with the spore protoplasts, placed on ice for 30 minutes, 1 mL of PTC solution was added, and the mixture was placed at room temperature for 15 minutes. After mixing, 200 μL was taken out and put into a new EP tube. 1 mL of STC solution was aspirated and added to the EP tube. After mixing, the mixture was spread on a PDA plate containing hygromycin (200 μL / 100 mL). The composition and preparation method of the PTC solution are as follows: 40% PEG4000, 50 mmol / L Tris-HCl, 50 mmol / L CaCl2, the solvent is sterile water, and the mixture is sterilized at 121°C for 20 minutes. The composition and preparation method of the STC solution are as follows: 1 mol / L sorbitol, 100 mmol / L Tris-HCl, 50 mmol / L CaCl2, the solvent is sterile water, and the mixture is sterilized at 121°C for 20 minutes. Overexpression of the ags1 The recombinant plasmid of the gene contains a hygromycin selection gene, and the initial strain of Monascus cannot grow on a PDA plate containing hygromycin, thereby obtaining a positive transformant.

[0036] The tenth aspect of the present invention provides a knockout or overexpression nucleotide sequence as shown in SEQ ID NO.1 ags1 Application of recombinant Monascus with gene fragments in the production of exopolysaccharides. ags1 The recombinant Monascus of the gene fragment can significantly increase the production of exopolysaccharides, while overexpression ags1 The recombinant Monascus of the gene fragment can increase the relative content of galactomannan in the extracellular polysaccharide, and the extracellular polysaccharide produced by it has higher immune activity.

[0037] Exemplarily, the present invention also provides a method for preparing extracellular polysaccharide, comprising the following steps: knocking out or overexpressing the nucleotide sequence as shown in SEQ ID NO. ags1 The recombinant Monascus containing the gene fragment is cultured in a PDA solid medium until the logarithmic growth phase, washed with sterile water and adjusted to a spore number, then inoculated into a fermentation medium for fermentation culture, and filtered to obtain a fermentation broth; The fermentation liquid is concentrated, and then 20 times the volume of ethanol is added, and the mixture is extracted for 10 to 12 hours. The precipitate is collected by centrifugation at 8000 r / min for 20 minutes, and the residual pigments and small molecular compounds are removed by dialysis after re-dissolving in water. The protein of the dialyzed product is removed, and after another dialysis, the dialyzed product is dried to obtain the extracellular polysaccharide. The molecular weight cutoff of the dialysis is 1000 Da.

[0038] In the preparation method, preferably, the spore count is adjusted to 1×10 5 Pieces / mL.

[0039] Preferably, the fermentation medium comprises: 1.0 g / L potassium dihydrogen phosphate (K2HPO4), 0.5 g / L potassium chloride (KCl), 0.5 g / L magnesium sulfate heptahydrate (MgSO4‧7H2O), 0.01 g / L ferrous sulfate heptahydrate (FeSO4‧7H2O), 5.0 g / L yeast extract, and 20.0 g glucose.

[0040] Preferably, the fermentation culture conditions are 30°C and 180r / min.

[0041] Preferably, the fermentation broth is concentrated to one fifth of its volume.

[0042] Preferably, the protein removal method is: adding 0.6 mol / L trichloroacetic acid (TCA) to the dialysis product to adjust the solution pH to 3.0.

[0043] The beneficial effects of the present invention are: the present invention screens out the ags1 Gene fragment, this gene fragment is related to the aggregation state of mycelium during the liquid fermentation of Monascus, directly affecting the mass transfer efficiency and fermentation time. The mycelium aggregation degree of the recombinant strain with this gene fragment knocked out was significantly reduced, and the total sugar content of extracellular polysaccharides in the fermentation broth was increased, while the mycelium aggregation degree of the strain overexpressing this gene was significantly increased, and the extracellular polysaccharide content in the fermentation broth decreased, but the relative content of galactomannan in the extracellular polysaccharide increased, thereby improving the immune activity. Therefore, ags1 The gene fragments are of great significance for increasing the production of fungal exopolysaccharides or increasing the production of galactomannan and improving the immune activity of exopolysaccharides. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 In Example 1 of the present invention ags1 Diagram of the construction process of gene fragment knockout plasmid p59-ags1-1-2; Figure 2 In Example 1 of the present invention ags1 The construction results of gene fragment knockout plasmid p59-ags1-1-2; Figure 3 In Example 1 of the present invention ags1 Diagram of the construction process of gene fragment overexpression plasmid p1301-ags1; Figure 4 In Example 1 of the present invention ags1 The construction results of gene fragment overexpression plasmid p1301-ags1; Figure 5 In Example 2 of the present invention ags1Gene fragment knockout strain (∆ags1) and overexpression strain (ags1 OE ) Build results; Figure 6 is WT, ∆ags1 and ags1 in the liquid fermentation process in Example 3 of the present invention OE Mycelium and fermentation broth status of the strain; Figure 7 WT, ∆ags1 and ags1 in Test Example 1 of the present invention OE The total polysaccharide content of EPS of the strains; Figure 8 WT, ∆ags1 and ags1 in Test Example 1 of the present invention OE The molecular weight distribution of EPS of strains; Figure 9 WT, ∆ags1 and ags1 in Test Example 1 of the present invention OE EPS monosaccharide composition distribution of strains; Figure 10 WT, ∆ags1 and ags1 in Test Example 1 of the present invention OE EPS sugar residue distribution of strains; Figure 11 WT, ∆ags1 and ags1 in Test Example 2 of the present invention OE Comparison of cell survival rates after EPS of strains acted on RAW 264.7; Figure 12 WT, ∆ags1 and ags1 in Test Example 2 of the present invention OE Comparison of NO content after the EPS of the strain acted on RAW 264.7; Figure 13 WT, ∆ags1 and ags1 in Test Example 2 of the present invention OE Comparison of IL-6 content after EPS of strains acted on RAW 264.7; Figure 14 WT, ∆ags1 and ags1 in Test Example 2 of the present invention OE Comparison of TNF-α content after EPS of strains acted on RAW 264.7; Figure 15 WT, ∆ags1 and ags1 in Test Example 2 of the present invention OE Comparison of IL-6 mRNA expression after EPS of strains acted on RAW 264.7; Figure 16 For the present invention, WT, ∆ags1 and ags1 OE Comparison of TNF-α mRNA expression levels after the EPS of the strains acted on RAW 264.7. DETAILED DESCRIPTION

[0045] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work fall within the scope of protection of the present invention.

[0046] The extracellular polysaccharides (EPS) in the Monascus fermentation broth contain substances with immunomodulatory activity such as galactomannan, but their content needs to be further improved. In addition, the aggregation of mycelium during the liquid fermentation of Monascus directly affects the mass transfer efficiency and fermentation time, affecting the yield of extracellular polysaccharides.

[0047] The embodiment of the present invention provides ags1 Application of gene fragments in regulating the synthesis of exopolysaccharides in Monascus, ags1 The nucleotide sequence of the gene fragment is shown in SEQ ID NO. 1. ags1 The gene fragment can affect the production of Monascus extracellular polysaccharides and the content of galactomannan: compared with the initial strain, the content of extracellular polysaccharides in the liquid fermentation broth of the Monascus recombinant bacteria with the gene fragment knocked out was significantly increased, while the content of galactomannan in the extracellular polysaccharides produced by the Monascus recombinant bacteria overexpressing the gene fragment was increased and had higher immune activity.

[0048] The embodiment of the present invention also provides the above ags1 The application of gene fragments in promoting Monascus to synthesize exopolysaccharides and in increasing the relative content of galactomannan in exopolysaccharides.

[0049] The present invention also provides knockout and overexpression of the above ags1 A recombinant expression vector of a gene fragment and a method for constructing the same.

[0050] The present invention also provides a method for knocking out or overexpressing the above ags1 Extracellular polysaccharide extracted from the fermentation liquid of recombinant Monascus with gene fragments and a preparation method thereof.

[0051] The following is further described with reference to specific embodiments.

[0052] The culture medium used in the following examples is: LB solid medium (100 mL): 1 g tryptone, 0.5 g yeast extract, 1 g NaCl, 15%-20% (w / v) agar, pH 7.5, sterilized at 121°C for 20 min; LB liquid medium (100 mL): 1 g tryptone, 0.5 g yeast extract, 1 g NaCl, pH 7.5, sterilized at 121°C for 20 min; Kanamycin concentration: Add 100 μL of 60 mg / mL kanamycin solution to every 100 mL of LB solid medium and liquid medium.

[0053] Solid medium PDA (100 mL): Take 200 g of peeled potatoes, cut them into small pieces, add water and boil them until they are soft, filter them through gauze, add 20 g of glucose and 20% agar (w / v) to the obtained potato filtrate, dissolve them in 1 L of distilled water, and sterilize them at 115°C for 30 min. Fermentation medium (1L): 1.0g K2HPO4, 0.5g KCl, 0.5g MgSO4‧7H2O, 0.01g FeSO4‧7H2O, 5.0g yeast extract, 20.0g glucose, sterilized at 121℃ for 20min; The ingredients and preparation methods of the reagents used in the following examples are: Enzyme hydrolysate (100 mL): 0.3 g cellulase, 0.3 g snail enzyme and 0.3 g lytic enzyme were dissolved in 100 mL sterile water and filtered through a 0.22 μm sterile filter membrane; PTC solution: 40% PEG4000, 50mmol / L Tris-HCl, 50mmol / L CaCl2, the solvent is sterile water, sterilized at 121℃ for 20min; STC solution: 1 mol / L sorbitol, 100 mmol / L Tris-HCl, 50 mmol / L CaCl2, the solvent is sterile water, sterilized at 121°C for 20 min.

[0054] Unless otherwise specified, other raw materials, reagents, drugs or instruments used in the following examples are conventional commercial products obtained from commercial channels. The methods used in the following examples are conventional methods in the art unless otherwise specified.

[0055] Example 1 This embodiment provides ags1 Gene fragment knockout plasmid and ags1 Gene fragment overexpression plasmid and construction method thereof.

[0056] 1. ags1 Gene fragment knockout plasmid and its construction method Extracted purple Monascus M9 ( M. purpureus M9) whole genome DNA was used as template and upstream homology arm primers were used ags1 -1-F, ags1 -1-R and downstream homology arm primersags1 -2-F, ags1 -2-R was amplified by PCR to obtain ags1 Gene upstream homology arm fragment ags1- 1 and downstream homology arm fragment ags1- 2.

[0057] ags1 -1-F (as shown in SEQ ID NO.2): 5'-gcGGTACCggtatgggaattaaggtgagttacccac-3'; ags1 -1-R (as shown in SEQ ID NO.3): 5'- gcGGATCCaacatgtctgccagagcatcc-3'.

[0058] ags1 -2-F (as shown in SEQ ID NO. 4): 5'-gcCTGCAGcatccactgaaagcggcaagg-3'; ags1 -2-R (as shown in SEQ ID NO. 5): 5'-gcAAGCTTaacgtatacacaactgcggctg-3'.

[0059] The PCR amplification reaction system is shown in Table 1, and the reaction procedure is shown in Table 2.

[0060] Table 1 PCR amplification reaction system

[0061] Table 2 PCR reaction procedure

[0062] ags1- 1 and ags1- 2 are 984 bp and 854 bp in length, and the sequences are shown in SEQ ID NO. 6 and SEQ ID NO. 7, respectively.

[0063] ags1- The sequence of 1 is: ggtatgggaattaaggtgagttacccacccgcttattttgcccactttgtctcaccttcctgctaccaggccatctacatcgctggaacggcgttgatgaatcagccctggggctatgacggttattccgcgctggacaccaccgtcctggataagcattacgccgatatacagacatggaggaatgcaatcaccgaaatccacaaccgaggcatgtatgtcatttgggacaacactctggcgacgtaagtattgctatcacgtatatcccgattctccgccgatctcaccacgtgctcaccgttcaaaaaacataaaaacagtatgggtgatcttcttgggttcaagggatatctgaacgaaaccaccccgttctcagttcacgaataccccgtcttgtggaagtcggatcgtcagtatgtggattttcacatcaacaatgtgtggaacgattcgtgtccctaccctcgtttttggaatgaaacaggctatcctgtcgactcctatgtcaccgaggaattgaaaggctgctacgacagcgacttcgaccagtacggagatgttgaggctttcggtgtctttccggattggcagcgtgagctgtccaagttcgcatcagttcaggatcgtctgcgtgaatggatacccagcgtgcgcgaaaagctcatccgacactcttgtatgatgattgcctcattcgaacatgacctcgttcaagggatatctgaacgaaaccaccccgttctcagttcacgaataccccgtcttgtttcgtgtccctaccctcgcggtcgaatcagatgcgacatggcggtgatgtggctggtctgttggataccctggattacctgcagcaaaactatcacaccgaccaacacaactccgcttattttgcccactttgtctcaccttcctgctcgacatcgatggcttccgctttgacaaggccactcaggccacaccggatgctctggcagacatgtt; ags1- The sequence of 2 is as follows: catccactgaaagcggcaaggccacgaactggggaagtacctggtccacctggataccctacacgggtggaaataccactattgaggaacagccgtggtctggagcaaaacatcagaagtggcatgggaaacatgtaaccgttgagtactggagtaaactgaccggtagcagcgattatatccaggatggtgatttgaactggggaaataagcccccacgacgcttcccgcacatgtttttcaacggtccctataaccagtacggttacgatgcagtctatgcggctgcctcctcaagtggttctgtcttcttcgcactgaactttggtgacgagagcggtgcgcctgtgaaagaatgggtgttccgagcatgccttatccagggcacgcagcaagcttatgtcattgctagctgacagtattgattcaatatagcgctatttgtatacccatctgcgtcttcctgtgggctattgggctggcctggacaatgagatgaagcaggaccccgatgatgggatttggaaatttagattcatggccgaatggcctgcacagggccaaattaatatctggggcattaatccggatggcaaacccgatcagaccggtgtgtacggagacgttgattcggatagcattctcgatcggctccctccatcttccctaagtgctacgctcatcaacatcacccaccccccaccgaagcctcatctggcatggaatatttttgtcaatgacggaactatgcgctttgacctttatccgactggttctcaatctcttcagttggccttgtacctcctcatgtggattgtaccggcgtgcacctcagccgcagttgtgtatacgtt。

[0064] Plasmid p59 and ags1 -1 fragment were simultaneously digested with Kpn Ⅰ and BamH Ⅰ at 37 °C for 1 h. T4 ligase was used to ligate the digested plasmid p59 andags1 -1 fragment. The ligated fragment was introduced into the competent E. coli (DH5α), spread on the LB plate containing kanamycin, and cultured in a 37°C incubator for 18-20 hours. The colonies grown on the LB plate containing kanamycin were picked and transferred to the LB liquid medium containing kanamycin for 6-7 hours. All the cells were collected by centrifugation, the plasmid was extracted, and the plasmid was used again. Kpn Ⅰ and BamH Ⅰ was used for enzyme digestion verification to obtain a smaller fragment length and ags1 -1 length was consistent, indicating that plasmid p59-ags1-1 was successfully constructed.

[0065] The above p59-ags1-1 plasmid and ags1 -2 fragments are used simultaneously Pst Ⅰ and Hind Ⅲ was digested by enzyme, and then constructed according to the construction and verification method of p59-ags1-1 ags1 Gene fragment knockout plasmid p59-ags1-1-2. Pst Ⅰ and Hind Ⅲ enzyme digestion, the smaller fragment length is ags1 -2 fragments are consistent, indicating ags 1-2 was successfully connected with p59-ags1-1; Kpn Ⅰ and Hind Ⅲ was digested with enzyme and obtained ( ags1 -1+Hyg+ ags1 -2) fragments with a total length of about 3243 bp, which is consistent with the gel imaging results after enzyme digestion, thus confirming that the P59-ags1-1-2 gene knockout plasmid was successfully constructed. The construction process of p59-ags1-1-2 is as follows Figure 1 As shown, the construction results are as follows Figure 2 The enzyme digestion system is shown in Table 3, and the ligation system is shown in Table 4.

[0066] Table 3 Enzyme digestion system

[0067] Note: In the first enzyme digestion reaction, enzyme 1 and enzyme 2 represent Kpn Ⅰ and BamH Ⅰ enzyme; in the second enzyme digestion reaction, enzyme 1 and enzyme 2 represent Pst Ⅰ and Hind III enzyme.

[0068] Table 4 Connection system

[0069] Note: In the first ligation reaction, plasmid DNA represents plasmid p59 and fragment DNA represents ags1-1 fragment; in the second ligation reaction, plasmid DNA represents plasmid p59-ags1-1, and fragment DNA represents ags1 -2 fragments.

[0070] 2. ags1 Gene fragment overexpression plasmid and construction method thereof Total RNA from Monascus purpurogenus M9 was extracted and reverse transcribed into cDNA as a template. ags1 -F and ags1 -R PCR ags1 Gene cDNA region fragment ags1 (as shown in SEQ ID NO.1).

[0071] ags1 -F (as shown in SEQ ID NO. 8): 5'-gcCCATGGtatgggtgatcttcttgggttcaagggat-3'; ags1 -R (as shown in SEQ ID NO. 9): 5'-gcCTTAAGtagtagacgtattcggtctgtttagagagc-3'.

[0072] The PCR amplification reaction system and reaction procedure are the same as those in Tables 1 and 2.

[0073] Plasmid p1301 and ags1 cDNA fragment of ags1 gene Nco Ⅰ and Afl After digestion with Ⅱ enzyme, connect overnight at room temperature with T4 ligase, introduce the overnight connected fragment into competent E. coli (DH5α), spread on LB plate containing kanamycin, and culture in 37℃ incubator for 18-20h. Pick the colonies growing on LB plate containing kanamycin and transfer them to LB liquid medium containing kanamycin and culture for 6-7h. Collect all the bacteria by centrifugation, extract the plasmid, and obtain the overexpression plasmid p1301-ags1. Nco Ⅰ and Afl Ⅱ was used for enzyme digestion verification, and the smaller enzyme digestion fragments were obtained. ags1 The CDS size results of the p1301-ags1 overexpression plasmid were consistent, and the bands were clear. According to the gene sequencing results of the plasmid, the sequenced fragments were consistent with the target fragments, and there were no overlapping peaks or messy peaks. These two aspects showed that the p1301-ags1 overexpression plasmid was successfully constructed. Figure 3 As shown, the construction results are as follows Figure 4 The enzyme digestion system is shown in Table 5, and the ligation system is shown in Table 6.

[0074] Table 5 Enzyme digestion system

[0075] Table 6 Connection system

[0076] Example 2 This embodiment provides ags1 Gene fragment knockout strains and overexpression strains and construction methods thereof.

[0077] The purple Monascus M9 was cultured on the slant solid medium PDA for about 7 days with 20 mL of sterile water containing 0.1% Tween 80 ( Monascus purpureus M9 , WT) fresh spores, and transfer the cleaned spores to a 50 mL Erlenmeyer flask containing glass beads, shake at 180 r / min at room temperature for 1 h to break up the spores, and filter through a 500 mesh non-woven fabric to make the spores evenly distributed; The evenly distributed spore suspension was centrifuged at 4°C, 8000 r / min for 5 min to collect the spores, 10 mL of sterile water was added to the collected spores and mixed, 100 μL of 5 mmol / L EDTA-Na2 and 17.34 μL of 25 mmol / L β-mercaptoethanol were added, and the mixture was shaken at room temperature, 180 r / min, for 20 min; After shaking, centrifuge at 4°C, 8000r / min for 5 min to collect spores, add 10mL of sterile water and centrifuge, add stabilizer sorbitol to the precipitated spores, then add enzyme solution (1:10, w / v), and water bath at 33°C for 5-6h; the spores after water bath are centrifuged at 4°C, 8000r / min for 5min to obtain spore precipitates, add sorbitol suspension and mix well to obtain spore protoplasts, which are divided into 200μL tubes each and stored at -80°C for later use.

[0078] Pipette 20-50μL knockout plasmid p59-ags1-1-2 and overexpression plasmid p1301-ags1, mix with 200μL spore protoplasts and place on ice for 30 minutes, add 1mL PTC solution and place at room temperature for 15 minutes, mix well, take 200μL and put it into a new EP tube, pipette 1mL STC solution and add it to the EP tube, mix well, and spread on a PDA plate containing hygromycin (200μL / 100mL). Both plasmid p59-ags1-1-2 and plasmid p1301-ags1 contain hygromycin selection genes, while WT does not contain hygromycin selection genes and cannot grow on PDA plates containing hygromycin, thus obtaining positive transformants.

[0079] The transformants grown on the plate containing hygromycin were subcultured for about 10 generations to verify their genetic stability. ags1 Gene fragment knockout strain (∆ags1) andags1 Gene fragment overexpression strain (ags1 OE ),like Figure 5 shown.

[0080] Example 3 This embodiment provides ags1 Gene fragment knockout strain (∆ags1) and ags1 Gene fragment overexpression strain (ags1 OE ) Method for extracting extracellular polysaccharides (EPS) by liquid fermentation.

[0081] WT, ∆ags1 and ags1 cultured in PDA solid medium for 7 days OE Fresh spores were washed with sterile water and adjusted to a spore count of 1 × 10 5 / mL, and then inoculated into the fermentation medium and cultured at 30℃ and 180r / min for 4 days. Compared with the WT strain, the hyphae aggregation of ∆ags1 was significantly reduced, while ags1 OE The hyphae aggregation increased significantly, such as Figure 6 As shown, it shows that the α-1,3-glucan in the cell wall is highly correlated with the aggregation state of mycelium during liquid fermentation. OE Mycelium and fermentation broth; The filtered fermentation broth was concentrated to one-fifth of its volume, and ethanol (1:20, v / v) was added to the concentrated fermentation broth for extraction for 12 hours, and the precipitate was collected by centrifugation at 8000r / min for 20 minutes. After re-dissolving with water, the precipitate was dialyzed (≤1000Da) for 2 days to remove residual pigments and small molecular compounds. The substances in the dialysis bag were collected, and 0.6mol / L trichloroacetic acid (TCA) was added to adjust the solution pH to 3.0 to remove proteins. The solution was then dialyzed for 2 days and then freeze-dried for 24 hours to obtain the extracellular polysaccharide (EPS) in the fermentation broth.

[0082] Test Example 1 The total sugar content of the fermentation broth obtained in Example 3 was determined, and the molecular weight distribution, monosaccharide composition and glycosidic bond connection mode of the extracellular polysaccharide (EPS) were detected.

[0083] 1. EPS total sugar content of fermentation broth The samples from WT, ∆ags1 and ags1 OE The EPS of the strain was adjusted to a concentration of 0.1 mg / mL, and the total sugar content was detected using the phenol-sulfuric acid method. The standard curve was y=1.41349x+0.16524, R 2=0.999. After testing and calculation, it was found that the total sugar content of EPS in WT fermentation broth was 1.52 mg / mL, and the total sugar content of EPS in ∆ags1 fermentation broth was 6.00 mg / mL, which was 4.00 times higher than that in WT, while OE The total sugar content of EPS in the fermentation broth was 0.65 mg / mL, which was 57% lower than that of WT. Figure 7 shown.

[0084] 2. Molecular weight distribution of EPS Weigh 1.0-2.0 mg of WT, ∆ags1 and ags1 OE The molecular weight (Mw) distribution of all EPS samples was detected by high performance gel chromatography (HPSEC), and the standard curve was logMw=-0.5672Rt+10.161, R 2 = 0.995. After testing, WT, ∆ags1 and ags1 OE The molecular weight distribution of EPS of the strains is shown in Table 7 and Figure 8 shown.

[0085] Table 7 WT, ∆ags1 and ags1 OE EPS molecular weight distribution of strains

[0086] 3. Monosaccharide composition of EPS Weigh 1.0-1.5 mg of WT, ∆ags1 and ags1 OE EPS samples were fully dissolved by adding 1.5 mL of 2 mol / L trifluoroacetic acid (TFA) in an oil bath at 120 °C for 3 h, and then concentrated by a vacuum centrifuge at 50 °C until the sample adhered to the wall. High performance anion exchange chromatography (HPESC-PAD) was used to detect the monosaccharide composition, and 0.1 mg / mL of galactose (Gal), arabinose (Ara), rhamnose (Rha), mannose (Man), glucose (Glc) and fucose (Fuc) were set as standard products. After testing, WT, ∆ags1 and ags1 OE The monosaccharide composition of EPS is shown in Table 8 and Figure 9 shown.

[0087] Table 8 WT, ∆ags1 and ags1 OE EPS monosaccharide composition of strains

[0088] 4. Glycosidic bond connection mode of EPS Weigh 2.0-3.0 mg of WT, ∆ags1 and ags1 OEThe EPS samples extracted from the extract were treated with 0.5 mL DMSO dissolution, 0.3 mL iodomethane (CI4) alkylation, 0.5 mL 4 mol / L TFA hydrolysis and sodium borodeuteride (D4BNa) reduction. The treated samples were tested by gas chromatography-mass spectrometry (GC-MS) to detect the types of sugar residues in all polysaccharide samples. OE The glycosidic bond connection modes of EPS are shown in Table 9 and Figure 10 shown.

[0089] Table 9 WT, ∆ags1 and ags1 OE EPS glycosidic bond connection mode of strains

[0090] -: No ingredient was detected.

[0091] Test Example 2 The WT, ∆ags1 and ags1 obtained in Example 3 were OE The EPS were applied to mouse macrophage RAW 264.7 cells, and the immune activity was analyzed by detecting the cell survival rate, NO, IL-6 and TNF-α contents and IL-6 and TNF-α mRNA expressions.

[0092] Mouse macrophage RAW 264.7 cells were adjusted to 1×10 5 The cells were inoculated into 6-well plates at a concentration of 1 μg / mL and cultured in an incubator at 37°C and 5% CO2 for 12 h. The control groups included blank control, positive control (LPS: 2 μg / mL) and negative control (Gum Arabic: 100 μg / mL), and the experimental groups included different concentrations (50, 200 and 400 μg / mL) of WT, ∆ags1 and ags1 OE The EPS samples of the strains were treated and cultured for 24 h. The contents of NO, IL-6, and TNF-α were detected according to the instructions of the Griess reagent method and ELISA kit (Multisciences). All experiments were set up in triplicate.

[0093] The mRNA of RAW 264.7 cells treated with the three control groups and three polysaccharide samples for 24 hours was extracted using the Trizol method, and the cDNA was reverse transcribed using the PrimeScript™RT kit. RT-qPCR was used to detect the mRNA expression levels of IL-6 and TNF-α, with β-actin as the internal reference gene.

[0094] The above RT-qPCR primers are shown in Table 10.

[0095] Table 10 Primer sequences in RT-qPCR.

[0096]

[0097] The results are as follows Figures 11 - 16 Shown, from ags1 OE The EPS of ags1 has a stronger immunomodulatory effect than that of WT and ∆ags1.

[0098] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. ags1 The application of gene fragments in regulating the synthesis of exopolysaccharides of Monascus is characterized in that: Said ags1 The nucleotide sequence of the gene fragment is shown in SEQ ID NO.

1.

2. The nucleotide sequence is shown in SEQ ID NO.1 ags1 Application of gene fragments in promoting the synthesis of exopolysaccharides by Monascus.

3. A knockout nucleotide sequence as shown in SEQ ID NO.1 ags1 A recombinant expression vector of a gene fragment; preferably, the recombinant expression vector comprises a recombinant plasmid and a recombinant bacterium.

4. Knock out the nucleotide sequence as shown in SEQ ID NO.1 ags1 A method for constructing a recombinant plasmid of a gene fragment, characterized in that: The specific steps include: S1. Using the whole genome DNA of Monascus purpurogenus as template, the upstream homology arm primers with sequences as shown in SEQ ID NO.2 and SEQ ID NO.3 were used. ags1 -1-F and ags1 -1-R and downstream homology arm primers as shown in SEQ ID NO.4 and SEQ ID NO.5 ags1 -2-F and ags1 -2-R, and the upstream homology arm fragment with the sequence shown in SEQ ID NO.6 was obtained by PCR amplification ags1- 1 and the downstream homology arm fragment as shown in SEQ ID NO.7 ags1- 2; S2, the plasmid carrying the kanamycin selection gene and the upstream homology arm fragment ags1- 1. Connect and introduce into competent E. coli (DH5α), spread on LB plate containing kanamycin, transfer the grown colonies to LB liquid medium containing kanamycin for culture, then collect all the cells by centrifugation and extract the plasmid; S3, the plasmid obtained in S2 and the downstream homology arm fragment ags1- 2. Connect and introduce into competent E. coli (DH5α), spread on LB plate containing kanamycin, and after cultivation, transfer the grown colonies to LB liquid medium containing kanamycin for cultivation, then collect all the bacteria by centrifugation, extract the plasmid, and the obtained plasmid is the knockout ags1 Recombinant plasmid of gene fragment.

5. Knock out the nucleotide sequence as shown in SEQ ID NO.1 ags1 A method for constructing a recombinant Monascus of a gene fragment, characterized in that: The hygromycin selection gene was knocked out. ags1 The recombinant plasmid of the gene fragment is introduced into the spore protoplasts of Monascus, and the plasmid is spread on a PDA plate containing hygromycin. After cultivation, strains that can grow on the PDA plate containing hygromycin are selected to knock out the gene fragment. ags1 Preferably, the recombinant Monascus containing gene fragments; preferably, the recombinant plasmid is plasmid p59; preferably, the Monascus is purple Monascus M9.

6. The nucleotide sequence is shown in SEQ ID NO.1 ags1 Application of gene fragments in increasing the relative content of galactomannan in extracellular polysaccharides.

7. An overexpressed nucleotide sequence as shown in SEQ ID NO.1 ags1 A recombinant expression vector of a gene fragment; preferably, the recombinant expression vector comprises a recombinant plasmid and a recombinant bacterium.

8. Overexpression of nucleotide sequence as shown in SEQ ID NO.1 ags1 A method for constructing a recombinant plasmid of a gene fragment, characterized in that: The specific steps include: SI, extract the total RNA of Monascus purpureus and reverse transcribe it into cDNA as a template, using the primers shown in SEQ ID NO.8 ags1 -F and a primer with a sequence as shown in SEQ ID NO.9 ags1 -R was obtained by PCR amplification ags1 Gene fragments; S II, the plasmid carrying the kanamycin selection gene and the ags1 The gene fragments were connected and introduced into competent Escherichia coli (DH5α), and then spread on LB plates containing kanamycin for culture. The grown colonies were transferred to LB liquid medium containing kanamycin for culture, and then all the bacteria were collected by centrifugation and the plasmid was extracted. The obtained plasmid was the overexpression plasmid. ags1 Recombinant plasmid of gene fragment.

9. A method for constructing a recombinant Monascus overexpressing the ags1 gene fragment of the nucleotide sequence as shown in SEQ ID NO. 1, characterized in that: The recombinant plasmid carrying the hygromycin selection gene and overexpressing the ags1 gene fragment is introduced into the protoplasts of Monascus spores, and the plasmid is spread on a PDA plate containing hygromycin. After culturing, strains that can grow on the PDA plate containing hygromycin are selected to obtain the strains overexpressing the ags1 gene fragment. ags1 Preferably, the recombinant Monascus containing gene fragments; preferably, the recombinant plasmid is plasmid p1301; preferably, the Monascus is purple Monascus M9.

10. Knockout or overexpression of the nucleotide sequence shown in SEQ ID NO.1 ags1 Application of recombinant Monascus gene fragments in the production of exopolysaccharides.

Images