Dumbbell siRNA and in-vitro synthesis method thereof

Abstract

The invention provides a dumbbell-type siRNA molecule and an in-vitro synthesis method thereof, and belongs to the technical field of gene engineering. The invention provides a DNA structure for constructing a dumbbell-type siRNA molecule. The DNA structure comprises a T4 bacteriophage thymidylate synthetase 3'intron homologous arm, a 3 'exon splicing sequence, a 5' exon splicing sequence and a T4 bacteriophage thymidylate synthetase 5 'intron homologous arm from left to right; the 3'exon splicing sequence is CTAA or CTAC, and the 5 'exon splicing sequence is TTGGGT. According to the dumbbell type siRNA molecule, the siRNA synthesis process can be simplified, and the purpose of efficiently knocking down a target gene can be achieved without modifying base replacement.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering, and in particular to a dumbbell-shaped siRNA and an in vitro synthesis method thereof. Background Art

[0002] RNA interference (RNAi) is an ancient biological defense mechanism used to resist the invasion of foreign genes. It is usually a single-stranded RNA of 21-23 bases, which can silence and degrade disease-related genes in a sequence-specific manner, making small interfering RNA (siRNA) a promising therapeutic approach. Over the past 20 years, small interfering RNA drugs have been successfully used in clinical treatment, and several drugs have shown amazing efficacy in the treatment of diseases such as hyperlipidemia and acute hepatic porphyria.

[0003] A major obstacle to the clinical application of small interfering RNA is that it is easily degraded by RNase in the body, resulting in insufficient drug efficacy. The current method used by the medical community to solve this problem is to incorporate various chemically modified alternative bases into the bases synthesized by RNA, such as m6A, m5C, Etc. The incorporation of chemically modified alternative bases requires professional manufacturers to supply high-quality raw materials, which will greatly increase the cost of RNA in vitro synthesis. Another way to reduce the risk of RNAase degradation and prolong the efficacy of small interfering RNA in vivo is to synthesize circular small interfering RNA (circular siRNA). Studies have shown that circular double-stranded small interfering RNA can indeed prolong the duration of action in vivo and reduce off-target effects. However, this type of circular small interfering RNA generally uses T4 RNA ligase to connect the synthesized single-stranded small interfering RNA end to end into a circular (Circular) or a dumbbell shape (Dumbbell shape), which is relatively inefficient and costly.

[0004] Circular RNA is a single-stranded covalently closed non-coding RNA found in eukaryotic cells. Using the permutated intron-exon (PIE) of Anabaena or T4 bacteriophage to self-splice RNA transcripts is an effective RNA cyclization method. Taking the PIE of T4 phage thymidylate synthase (Td) as an example, the DNA structure design of this type I PIE generally includes, from left to right, a 3' intron homology arm (3'intron arm), a 3' exon splicing sequence (E2, CTACCGTTTAATATTGCGTCACC), a target gene coding sequence, a 5' exon splicing sequence (E1, TTGGGT), and a 5' intron homology arm (5'intron arm). This DNA structure can be transcribed by T7 / T3 / SP6 promoter in vitro and by U6 or CMV promoter in cells. The generated RNA transcripts have their own nuclease activity and are activated by GTP and Mg. 2+ RNA splicing and circularization are carried out under the action of the molecule. After circularization, the 3' and 5' intron homology arms are removed, and only part of the exon splicing sequence (E2-E1) and the target gene RNA inserted in the middle are retained.

[0005] However, this common RNA circularization splicing method will leave a long exon splicing sequence E2-E1 (CTACCGTTTAATATTGCGTCACC / TTGGGT), which will affect the sequence targeting of small interfering siRNA. How to overcome this difficulty is the technical problem to be solved by the present invention. Summary of the invention

[0006] The purpose of the present invention is to provide a dumbbell-shaped siRNA molecule and an in vitro synthesis method thereof, which can further improve the sequence targeting of siRNA.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The invention provides a DNA structure for constructing a dumbbell-shaped siRNA molecule. The DNA structure comprises, from left to right, a T4 phage thymidylate synthase 3' intron homology arm, a 3' exon splicing sequence, a 5' exon splicing sequence, and a T4 phage thymidylate synthase 5' intron homology arm; the 3' exon splicing sequence is CTAA or CTAC, and the 5' exon splicing sequence is TTGGGT.

[0009] Preferably, the nucleotide sequence of the DNA structure is shown as SEQ ID NO.1.

[0010] Preferably, the primers for amplifying the DNA structure are shown as SEQ ID NO.4 and SEQ ID NO.5.

[0011] The present invention also provides an expression vector comprising the DNA structure.

[0012] The present invention also provides a DNA molecule for constructing a dumbbell-shaped siRNA molecule for transcription using the DNA structure or the expression vector, wherein the forward and antisense strands of the siRNA are inserted between the 3' exon splicing sequence and the 5' exon splicing sequence of the DNA structure, and the forward and antisense strands are connected by a linker; the structure of the DNA molecule includes, from left to right, a 3' intron homology arm, a 3' exon splicing sequence, an antisense strand of the siRNA, a linker, a sense strand of the siRNA, a 5' exon splicing sequence, and a 5' intron homology arm.

[0013] Preferably, the DNA molecule is driven by a T7, T3 or SP6 promoter for in vitro transcription and by a U6 or CMV promoter for intracellular transcription.

[0014] Preferably, the length of the siRNA is 22-27 bp; the bases of the siRNA include chemically modified bases.

[0015] The invention also provides an expression vector comprising the DNA molecule for transcribing the dumbbell-shaped siRNA molecule.

[0016] The present invention also provides a method for constructing a dumbbell-shaped siRNA molecule using the DNA molecule or the expression vector, comprising the following steps:

[0017] (1) constructing a siRNA targeting a target gene and inserting it into the DNA structure to obtain a DNA molecule capable of transcribing a dumbbell-shaped siRNA molecule;

[0018] (2) connecting the DNA molecule to a plasmid vector to obtain an expression vector capable of expressing the DNA molecule;

[0019] (3) obtaining a linearized DNA in vitro transcription template from the expression vector, and performing in vitro transcription to obtain siRNA;

[0020] (4) After opening the secondary structure of the siRNA, GTP is added to allow the siRNA to self-splice and cyclize under the mediation of T4 phage thymidylate synthase TdPIE to obtain a dumbbell-shaped siRNA molecule.

[0021] The present invention also provides a dumbbell-shaped siRNA molecule constructed according to the method.

[0022] The method for synthesizing circular small interfering RNA in vitro provided by the present invention targets the PIE structure of T4 phage thymidylate synthase Td, designs the core exon splicing sequence E2-E1 with a degenerate E2 (CTAA or CTAC) / E1 (TTGGGT) splicing sequence, and circularizes the small interfering RNA to finally form a dumbbell-shaped small interfering RNA (Dumbbell siRNA). The process is as follows Figure 1 This structure can be used to synthesize circular small interfering RNA of any target gene at low cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of in vitro synthesis of dumbbell-shaped small interfering RNA;

[0024] Figure 2 The sequence map of the Db siRNA (dumbbell siRNA) backbone constructed in Example 1;

[0025] Figure 3 This is the separation effect of Db-siRNA-Luc869-891 by PAGE electrophoresis in Experimental Example 1;

[0026] Figure 4 This is the knockdown efficiency test result of Db-siRNA-Luc869-891 in Experimental Example 1. DETAILED DESCRIPTION

[0027] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0028] Example 1

[0029] Construction of pcDNA3.1-Db siRNA (dumbbell-shaped siRNA) backbone expression vector

[0030] 1.1 Synthesis of dumbbell-shaped siRNA sequence template

[0031] The DNA sequence of Td 3'arm-E2-E1-Td5'arm was synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0032] The DNA sequence of Td 3'arm-E2-E1-Td5'arm is as follows:

[0033] GGAGACCCTCGAATGGAATTGGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATG CTAA / CTTGGGT TAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATC TAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACTAATTCCATTTATCAGATTTCTAG(SEQ ID NO.1)

[0034] The 3′ exon splicing sequence (E2) is: CTAA or CTAC;

[0035] The 5′ exon splicing sequence (E1) is: TTGGGT;

[0036] The sequence of Td 3'arm is: SEQ ID NO.2

[0037] GGAGACCCTCGAATGGAATTGGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATG

[0038] The sequence of Td 5'arm is: SEQ ID NO.3

[0039] TAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACTAATTCCATTTATCAGATTTCTAG

[0040] 1.2 PCR amplification of Db-siRNA template fragment

[0041] Primers HindIII-5'arm-F / Xho1-3'arm-R were designed, and PCR was performed to amplify the synthesized DNA of Td3'arm-E2-E1-Td5'arm as a template to obtain the amplified product Db-siRNA DNA ( Figure 2 ).

[0042] Among them, the primer sequences are as follows:

[0043] HindIII-5'arm-F SEQ ID NO.4:

[0044] GCGTTTAAACTTAAGCTTGGGAGACCCTCGAATGGAATTG

[0045] Xho1-3'arm-R SEQ ID NO.5:

[0046] GGGCCCTCTAGACTCGAGCTAGAAATCTGATAAATGGAATTAGTC

[0047] The high-fidelity PCR amplification reaction system is shown in Table 1.

[0048] Table 1 Amplification reaction system

[0049] Composition Dosage 2×PhantaMaxBuffer 25μl dNTP (10 mM each) 1μl Primer HindIII-5'arm-F 2μl Primer Xho1-3'arm-R 2μl Amplified template 1ng PhantaMaxSuper-FidelityDNAPolymerase 1μl <![CDATA[ddH2O]]> Make up the system to 50 μl

[0050] The high-fidelity PCR amplification reaction procedure is shown in Table 2.

[0051] Table 2 Amplification reaction procedure

[0052]

[0053] 1.3 Clone Db-siRNA DNA into vector pcDNA3.1

[0054] The pcDNA3.1 plasmid was cut with restriction endonucleases HindIII and Xho1 (NEB) at 37°C for 2 h, and the DNA product was recovered using a kit (Novagen, catalog number: DC301-01) to obtain a linear vector.

[0055] Use the One step cloning kit homologous recombination kit (Yisheng, 10911ES50) to recombinate the Db-siRNA DNA fragment obtained in 1.2 with the linear pcDNA3.1DNA digested with HindIII+Xho1 in vitro. Transform the recombinant product into competent Dh5α (Qingke, catalog number: TSC-C14), screen single clones, and sequence to obtain the pcDNA3.1-DbsiRNAbackbone expression vector. The sequence map is shown in Figure 2shown.

[0056] Among them, T7 sequencing primer: TAATACGACTCACTATAGG SEQ ID NO.6

[0057] Experimental Example 1

[0058] 1.1 Construction of Db-siRNA-Luc869-891 plasmid targeting luciferase

[0059] 1.1.1 Construction of Db-siRNA-Luc transcription vector targeting the site (869-891, antisense strand) on the luciferase gene.

[0060] Db-siRNA-Luc sequence:

[0061] TTTGGCGAAGAAGGAGAATAGGG SEQ ID NO.7

[0062] The product Db-siRNA-Luc was amplified by PCR using the following long primers.

[0063] Db-siRNA-Luc-F SEQ ID NO.8:

[0064] AAATTCAAGAGATTTGGCGAAGAAGGAGAATAGGGTTTGGGTTAAT TGAGGCCTGA

[0065] Db-siRNA-Luc-R SEQ ID NO.9:

[0066] CAAATCTCTTGAATTTGGCGAAGAAGGAGAATAGGGGTAGCATTA TGTTCAGATAAGGTCG

[0067] PCR was performed using Db-siRNA-Luc as a template, and a PCR product of about 5.7 kb was recovered using a kit (Novozymes, catalog number: DC301-01).

[0068] The high-fidelity PCR amplification reaction system is shown in Example Table 1, wherein the amounts of primers Db-siRNA-Luc-F and Db-siRNA-Luc-R are the same as the two primers in Table 1.

[0069] The high-fidelity PCR amplification reaction program is shown in Table 3.

[0070] Table 3 Amplification reaction procedure

[0071]

[0072] 1.1.2 Transformation to obtain pcDNA3.1-Db-siRNA-Luc869-891 plasmid

[0073] The Db-siRNA-Luc869-891 product obtained by the above amplification was transformed into the competent Dh5α (Qingke, product number: TSC-C14), single clones were screened, and sequencing was performed to obtain the transcription plasmid pcDNA3.1-Db-siRNA-Luc869-891.

[0074] The T7 sequencing primer is as 1.3 in Example 1.

[0075] 1.2 In vitro transcription and RNA circularization of Db-siRNA-Luc869-891

[0076] 1.2.1 Preparation of Db-siRNA-Luc869-891 in vitro transcription template

[0077] The following in vitro transcription primers IVT-F / IVT-R were designed, and a high-fidelity enzyme (Novozyme, P501-d1) was used to perform PCR using the plasmid pcDNA3.1-Db-siRNA-Luc869-891 obtained in 1.1.2 above as a template to recover the in vitro transcription template with a T7 promoter.

[0078] IVT-F:GCAGAGCTCTCTGGCTAACTAGAG SEQ ID NO.10

[0079] IVT-R: GCTAGAAATCTGATAAATGGAATTAG SEQ ID NO.11

[0080] The linearized transcription template was recovered using a kit (Novozymes, catalog number: DC301-01).

[0081] 1.2.2 In vitro transcription of Db-siRNA-Luc869-891

[0082] Use high-yield T7 in vitro transcription reagent (Hanhai New Enzyme, HBP001506) to prepare the in vitro transcription reaction system according to Table 4, mix the components gently with a pipette, and incubate at 37°C for 12 hours. Then add 2μL DNase I to the reaction system and incubate at 37°C for 15 minutes to digest the transcribed linearized plasmid DNA template to obtain the transcribed RNA ， The sequence is as follows:

[0083] GAGACCCAAGCUGGCUAGCGUUUAAACUUAAGCUUGGGAGACC

[0084] CUCGAAUGGAAUUGGUUCUACAUAAAUGCCUAACGACUAUCCCUUU

[0085] GGGGAGUAGGGUCAAGUGACUCGAAACGAUAGACAACUUGCUUUA

[0086] ACAAGUUGGAGAUAAUAGUCUGCUCUGCAUGGUGACAUGCAGCUGGA

[0087] UAUAAUUCCGGGGUAAGAUUAACGACCUUAUCUGAACAUAAUGCUA

[0088] ACCCUAUUCUCCUUCUUCGCCAAAUUCAAGAGAUUUGGCGAAGAAG

[0089] GAGAAUAGGGUUGGGUUAAUUGAGGCCUGAGUAUAAGGUGACUUA

[0090] UACUUGUAAUCUAUCUAAACGGGGAACCUCUCUAGUAGACAAUCCC

[0091] GUGCUAAAUUGUAGGACUAAUUCCAUUUAUCAGAUUUCUAGCUCGA

[0092] GUCUAGAGGGCCCGUUUAAA(SEQ ID NO.12)

[0093] Table 4 Reaction system for in vitro transcription

[0094]

[0095]

[0096] 1.2.3 In vitro circularization of Db-siRNA-Luc869-891

[0097] The RNA obtained by in vitro transcription was heated to 70°C for 5 minutes and then immediately cooled on ice for 3 minutes to open the secondary structure of the RNA; then GTP solution (Sangon, catalog number: A620332-0250) was added to a final concentration of 2 mM and treated at 55°C for 15 minutes; the siRNA obtained by in vitro transcription was self-spliced ​​and circularized under the mediation of Td PIE.

[0098] 1.3Db-siRNA-Luc869-891 purification

[0099] 1.3.1 Preliminary purification: LiCl precipitation method

[0100] (1) Add 160 μl RNase-free ddH2O to dilute the product to 180 μl;

[0101] (2) adding an equal volume of LiCl solution (5 M) to the reaction product;

[0102] (3) After mixing, the mixture was precipitated at -20°C for 30 min, centrifuged at 12,000 rpm for 15 min at 4°C, and the supernatant was discarded;

[0103] (4) Add 200 μL of 70% ice-cold ethanol to wash the RNA precipitate, centrifuge at 12,000 rpm for 15 min at 4°C, and discard the supernatant;

[0104] (5) Open the lid and dry for 5-10 minutes. After it is completely dry, add 50 μL RNase-free ddH2O to dissolve the Db-siRNA-Luc869-891 RNA precipitate.

[0105] 1.3.2 Further purification: Urea-PAGE method

[0106] A 10% urea gel was prepared using a Urea-PAGE gel preparation kit (Biyuntian, R0218S). The preparation method is shown in Table 5.

[0107] Table 5 Preparation method of 10% Urea-PAGE gel

[0108]

[0109]

[0110] RNA sample pretreatment: The initially purified Db-siRNA-Luc869-891 was mixed with equal volumes of 2× RNA loading buffer (Biyuntian, R0215), incubated at 95°C for 1 min to fully denature the RNA to open the secondary structure of the RNA, and then immediately placed in an ice water bath;

[0111] Electrophoresis: Add 1×TBE electrophoresis buffer to the electrophoresis tank. Rinse the urea in each loading well with 1×TBE electrophoresis buffer before loading the sample, and then quickly add the RNA sample. After loading, use constant voltage electrophoresis, 180V, 60min;

[0112] Staining: After electrophoresis, take out the gel and place it in a clean container, add about 30 ml of nucleic acid staining solution, and stain it on a shaker at room temperature for 15 minutes at 25 rpm. Finally, rinse it with DEPC water for 2 minutes and transfer it to a gel imaging device to observe the staining results after electrophoresis ( Figure 3 );

[0113] Gel excision: Find the band of target size (indicated by the arrow) and excise the single-component circular Db-siRNA-Luc869-891 into an RNase-free EP tube.

[0114] 1.3.3 Urea-PAGE gel recovery of Db-siRNA-Luc869-891: CRUSHAND SOAK method

[0115] Accurately weigh the gel mass in the above EP tube, add Gel-soaking buffer at a 2-fold volume-to-mass ratio, then crush the gel as much as possible with an RNase-free pipette tip, and place it in a rotating disk mixer for overnight treatment; Gel-soaking buffer preparation: 0.41 g NaOAc, 0.4 mL EDTA (0.5 M, pH 8.0), dilute to 100 mL with DEPC water

[0116] Centrifuge at 12000 rpm for 1 min, collect the supernatant, and repeat the centrifugation once to prevent the collection of gel fragments;

[0117] Add 0.1 volume of NaOAc (3M, pH 5.2) and 3 volumes of anhydrous ethanol, mix well, put into -20℃ refrigerator, precipitate for 1h, centrifuge at 12000rpm for 15min at 4℃, and discard the supernatant;

[0118] Add 200 μL of 70% ice-cold ethanol to wash the RNA precipitate, centrifuge at 12,000 rpm for 15 min at 4°C, and discard the supernatant;

[0119] Open the lid and dry for 5-10 minutes. After it is completely dry, add 20 μL DEPC water to dissolve the RNA precipitate.

[0120] 1.4Db-siRNA-Luc869-891 functional test

[0121] Dual fluorescein assay to detect knockdown efficiency of Db-siRNA-Luc869-891

[0122] HEK293T cells were passaged and evenly plated in a 24-well plate. When the cell confluence reached 70-80%, transfection experiments were performed. Db-siRNA-Luc869-891 transfection system / well was prepared: 125ng pGL3-Basic, 5ng pRL-TK, 12.5μL DMEM, 0.25μL Lipo8000 (Biyuntian, C0533); linear siRNA transfection system / well was prepared: 400ng siRNA (final concentration of about 40nM), 25μL DEME, 1μL Lipo8000.

[0123] Db-siRNA-Luc869-891 transfection system and linear siRNA transfection system were added to the cells respectively, and cells without transfection system were used as blank control. Three biological replicates were guaranteed for each group. After 24 hours, the cells were harvested and the siRNA knockdown effect was detected using the DualLuciferase ReporterAssay Kit (Novozyme, DL101-01). Figure 4 shown.

[0124] from Figure 4 It can be seen that compared with the control, Db-siRNA-Luc869-891 can achieve a gene knockdown efficiency comparable to that of synthetic linear siRNA.

[0125] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A DNA structure for constructing a dumbbell-shaped siRNA molecule, characterized in that: The DNA structure includes, from left to right, a T4 phage thymidylate synthase 3' intron homology arm, a 3' exon splicing sequence, a 5' exon splicing sequence, and a T4 phage thymidylate synthase 5' intron homology arm; the 3' exon splicing sequence is CTAA or CTAC, and the 5' exon splicing sequence is TTGGGT.

2. The DNA structure according to claim 1, characterized in that The nucleotide sequence of the DNA structure is shown in SEQ ID NO.

1.

3. The DNA structure according to claim 2, characterized in that The primers for amplifying the DNA structure are shown in SEQ ID NO.4 and SEQ ID NO.

5.

4. An expression vector comprising the DNA structure according to any one of claims 1 to 3.

5. A DNA molecule for transcribing dumbbell-shaped siRNA molecules using the DNA structure according to any one of claims 1 to 3 or the expression vector according to claim 4, characterized in that: The forward and antisense strands of siRNA are inserted between the 3' exon splicing sequence and the 5' exon splicing sequence of the DNA structure, and the forward and antisense strands are connected by a linker; the structure of the DNA molecule includes, from left to right, a 3' intron homology arm, a 3' exon splicing sequence, an antisense strand of siRNA, a linker, a sense strand of siRNA, a 5' exon splicing sequence, and a 5' intron homology arm.

6. The DNA molecule for transcribing dumbbell-shaped siRNA molecules according to claim 5, characterized in that: The DNA molecule is driven for in vitro transcription by T7, T3 or SP6 promoter, and for intracellular transcription by U6 or CMV promoter.

7. The DNA molecule for transcribing dumbbell-shaped siRNA molecules according to claim 6, characterized in that: The length of the siRNA is 22-27 bp; the bases of the siRNA include chemically modified bases.

8. An expression vector comprising a DNA molecule for transcribing a dumbbell-shaped siRNA molecule according to any one of claims 5 to 7.

9. A method for constructing a dumbbell-shaped siRNA molecule using the DNA molecule according to any one of claims 5 to 7 or the expression vector according to claim 8, characterized in that: The steps include: (1) constructing a siRNA targeting a target gene and inserting it into the DNA structure to obtain a DNA molecule capable of transcribing a dumbbell-shaped siRNA molecule; (2) connecting the DNA molecule to a plasmid vector to obtain an expression vector capable of expressing the DNA molecule; (3) obtaining a linearized DNA in vitro transcription template from the expression vector, and performing in vitro transcription to obtain siRNA; (4) After opening the secondary structure of the siRNA, GTP is added to allow the siRNA to self-splice and cyclize under the mediation of T4 bacteriophage thymidylate synthase Td PIE to obtain a dumbbell-shaped siRNA molecule.

10. A dumbbell-shaped siRNA molecule constructed according to the method of claim 9.

Images