Biosensor detection platform based on droplet evaporation and application of biosensor detection platform in liver cancer marker AFP detection

Abstract

The invention belongs to the field of analysis and detection, and particularly relates to a biosensor detection platform based on droplet evaporation and application of the biosensor detection platform in liver cancer marker AFP detection. The biosensor detection platform at least comprises a substrate, aptamer DNA, cholinesterase, a choline surfactant and streptavidin-coated magnetic beads, and through specific binding between the aptamer DNA and an object to be detected and hydrolysis reaction between the cholinesterase and the choline surfactant, the surface tension of liquid drops is changed by utilizing the surfactant, so that the detection sensitivity of the biosensor is improved. The dry area of the liquid drops on the surface of the substrate is changed, so that the to-be-detected object is rapidly detected. A biological sensing platform which is good in sensitivity and selectivity, rapid, simple and low in cost is created, and the method is particularly suitable for rapid on-site detection of AFP and can be applied to early screening and diagnosis of HCC.

Description

Technical Field

[0001] The invention belongs to the field of analysis and detection, and in particular relates to a biosensor detection platform based on droplet evaporation and its application in the detection of liver cancer marker AFP. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Early screening and diagnosis of cancer are the basis for effective treatment and prediction of recurrence. Hepatocellular carcinoma (HCC) is one of the most common fatal cancers worldwide and is regarded as the third leading cause of cancer death. Alpha-fetoprotein (AFP), a glycoprotein belonging to the albumin family, is the most important tumor marker for HCC and has received considerable attention in cancer research. In healthy adults, the normal range of AFP in human serum is 0-25 ng / mL. Abnormally elevated AFP indicates the occurrence of HCC or predicts a potential high risk of HCC.

[0004] The existing methods for detecting AFP include fluorescence, colorimetry, electrochemistry, immunoassay, etc. Although these methods have high sensitivity and selectivity, they all have relatively difficult to overcome defects, such as the need for labeled molecules, multi-step preparation, the need for professionals to perform complex instrument detection, time-consuming, and high cost, which hinder the rapid and portable detection of AFP. Therefore, there is an urgent need to establish a simple, rapid, label-free, and low-cost AFP detection method for early screening and diagnosis of HCC. Summary of the invention

[0005] In order to address the deficiencies of the prior art, the present invention provides an application of a biosensor detection platform based on droplet evaporation in the detection of liver cancer marker AFP. The biosensor detection platform of the present invention is based on the diffusion and evaporation of surfactant-loaded water droplets on a hydrophobic substrate, and can quantitatively detect AFP in human serum by measuring the area of ​​dried droplets. The detection method provided by the present invention is simple, portable, highly sensitive and highly selective, avoids the use of labeled molecules and complex instruments, is particularly suitable for rapid on-site detection of AFP, and provides broad prospects for early screening and diagnosis of HCC.

[0006] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0007] In a first aspect, the present invention provides a biosensor detection platform based on droplet evaporation, the biosensor detection platform comprising at least a substrate, aptamer DNA, cholinesterase, a choline surfactant, and streptavidin-coated magnetic beads;

[0008] Wherein, the aptamer DNA includes a first aptamer DNA and a second aptamer DNA;

[0009] The first aptamer DNA has a complementary region that specifically binds to the detection object, and the 5' end of the first aptamer DNA is modified with biotin;

[0010] The second aptamer DNA has complementary regions that specifically bind to the detection object and cholinesterase.

[0011] Through the specific binding between aptamer DNA and the analyte, the hydrolysis reaction of cholinesterase and choline surfactant Myr, and the principle of surfactant changing the surface tension of droplets, the size of the drying area of ​​droplets on the substrate surface can be changed, so that the analyte can be quickly detected, achieving rapid trace detection with low sample consumption, high sensitivity and no need for large instruments.

[0012] In one or more embodiments of the present invention, the cholinesterase is acetylcholinesterase AChE, and the surfactant is myristoylcholine chloride Myr.

[0013] In one or more embodiments of the present invention, the substrate includes at least one of a polyethylene terephthalate plate, a polyvinyl chloride plate, a polycarbonate plate, a polystyrene plate, and a polymethyl methacrylate plate;

[0014] Preferably, the substrate is a polyethylene terephthalate board.

[0015] In a second aspect, the present invention provides a method for detecting alpha-fetoprotein, which uses the above-mentioned biosensor detection platform for detection, comprising the following steps:

[0016] S1, incubating the streptavidin-modified magnetic beads with the first aptamer DNA, wherein the first aptamer DNA is denoted as apt1, and then obtaining the MB-apt1 complex by magnetic separation;

[0017] S2, incubating the sample to be tested with the MB-apt1 complex, and then obtaining the MB-apt1-AFP complex by magnetic separation;

[0018] S3, incubating the second aptamer DNA with the MB-apt1-AFP complex, wherein the second aptamer DNA is recorded as ssDNA, and then obtaining the MB-apt1-AFP-ssDNA complex by magnetic separation;

[0019] S4, incubating the AChE solution with the MB-apt1-AFP-ssDNA complex, and then obtaining the MB-apt1-AFP-ssDNA-AChE complex by magnetic separation;

[0020] S5, incubating the surfactant Myr solution with the MB-apt1-AFP-ssDNA-AChE complex, and collecting the supernatant by magnetic separation, wherein the supernatant contains the hydrolyzed surfactant Myr;

[0021] S6, dropping the supernatant onto a substrate, drying, and quantitatively detecting AFP by comparing the dry area after evaporation of the droplets;

[0022] The methods are for non-therapeutic or diagnostic purposes.

[0023] The nucleotide sequence of the first aptamer DNA is shown in SEQ ID NO.1, specifically: 5-Biotin-A 12 GTGACGCTCCTAACGCTGACTCAGGTGCAGTTCTCGACTCGGT CTTGATGTGGGTCCTGTCCGTCCGAACCAATC-3' (SEQ ID NO.1); the nucleotide sequence of the second adaptor DNA is as shown in SEQ ID NO.2, specifically: 5'-TAGATATGGCAGGAAGACAAACAAGCTTGGCGGCGGGAAGGTGTTTAA ATTCCCGGGTCTGCGTGGTCTGTGGTGCTGTAAAAAAAAAAGGTTGACTGT AGCTCTGGCAGACGTAGTGTGAAGGTACC-3' (SEQ ID NO.2).

[0024] Among them, the AFP to be tested is connected to the magnetic beads by specifically binding to apt1 on the surface of the magnetic beads, and then the AFP to be tested on the magnetic beads is specifically bound to ssDNA to connect ssDNA to the magnetic beads. After AChE specifically binds to ssDNA, it can hydrolyze the Myr solution to generate myristic acid and choline chloride, which changes the Myr concentration and thus changes the size of the dried droplet area on the substrate surface, thereby realizing rapid detection of AFP concentration.

[0025] In one or more embodiments of the present invention, the sample to be tested is a biological sample, including ex vivo serum.

[0026] In one or more embodiments of the present invention, in S1-S3, the incubation conditions are: incubation at 24.5-25.5° C. for 20-40 min.

[0027] In one or more embodiments of the present invention, in S4, the incubation conditions are: incubation at 24.5-25.5°C for 0.5-1.5h; the concentration of the AChE solution is 10 -5 ~10 -1 mg / mL.

[0028] In one or more embodiments of the present invention, in S5, the incubation conditions are: incubation at 36.5-37.5° C. for 10-20 min; and the concentration of the surfactant Myr solution is 0.001-0.1 mmol / L.

[0029] In one or more embodiments of the present invention, in S6, quantitative detection of AFP is achieved through the linear relationship between the concentration of the analyte and the drying area.

[0030] In a third aspect, the present invention provides the use of the above-mentioned biosensor detection platform in the detection and analysis of AFP in biological samples, wherein the biological samples include ex vivo serum.

[0031] In a fourth aspect, the present invention provides the use of the above-mentioned biosensor detection platform in the preparation of HCC diagnostic products.

[0032] In a fifth aspect, the present invention provides the use of the above-mentioned biosensor detection platform or the above-mentioned method for detecting alpha-fetoprotein in AFP drug screening.

[0033] One or more technical solutions of the present invention described above achieve the following beneficial effects:

[0034] 1. The present invention creates a biosensor platform with good selectivity, rapidity, simplicity and low cost through the specific binding between aptamer DNA and the analyte and the hydrolysis reaction between AChE and Myr;

[0035] 2. The present invention utilizes the principle that surfactants change the surface tension of droplets to change the size of the drying area of ​​droplets on the substrate surface. It has high sensitivity and shows a good linear relationship (R2=0.996) in the range of 5-25 ng / mL. The detection limit (LOD) is 1.27 ng / mL (based on 3σ / k). It can quickly detect the analyte with a small amount of sample and does not require the use of large instruments for rapid micro-detection.

[0036] 3. The biosensor detection platform of the present invention can truly reflect the AFP concentration in serum samples and can be applied to the early diagnosis of HCC. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0038] Figure 1 Schematic diagram of the diffusion of surfactant-loaded water droplets and the type and concentration of surfactant, where a is a representative image of the evaporation of droplets of surfactant Myr with different concentrations on the substrate surface taken by a smartphone; b is a statistical graph of the evaporation area of ​​the droplets on the surface corresponding to a; c is a microscope image of the evaporation of droplets of surfactant Myr with different concentrations on the substrate surface, Ⅰ-Ⅵ represent 0.1, 0.05, 0.01, 0.005, 0.001, 0 mmol / L of Myr, respectively; d is the contact angle of droplets containing different concentrations of surfactant Myr on the substrate surface; e is the surface tension of droplets containing different concentrations of surfactant Myr on the substrate surface;

[0039] Figure 2 This is a schematic diagram of the biosensing method based on surfactant-mediated surface droplet evaporation for detecting AFP in Example 1;

[0040] Figure 3 The results of the correlation study of the AFP detection method described in Example 1: a is a representative image of dried droplets obtained by mixing different concentrations of AFP with apt1 (100nmol / L), ssDNA (100nmol / L), AChE (0.1mg / mL), and Myr (0.05mmol / L) taken by a smartphone; b is a linear relationship fitting diagram between the area of ​​the dried droplet corresponding to a and the AFP concentration; c is a microscope image of the dried droplet corresponding to a, and Ⅰ-Ⅷ represent 0, 1, 5, 10, 15, 20, 25 and 30ng / mL of AFP, respectively;

[0041] Figure 4 Representative images and area statistics of the biosensing method based on surfactant-mediated surface droplet evaporation in Example 2 for detecting AFP in real blood samples. DETAILED DESCRIPTION

[0042] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0043] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0044] The present invention is further described in conjunction with specific examples. The following examples are only for explaining the present invention and are not intended to limit the content thereof. If the specific experimental conditions are not specified in the examples, they are usually carried out according to conventional conditions or the conditions recommended by the reagent company; the reagents and consumables used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0045] Surfactants are a class of surface-active molecules with a hydrophilic head group and a hydrophobic tail group that can reduce the surface tension of a solution. The diffusion of surfactant-loaded water droplets on a hydrophobic surface is an important phenomenon. The diffusion of surfactant-loaded water droplets is closely related to the type and concentration of the surfactant. Figure 1 As shown in the figure, with the increase of Myr concentration, the drying area of ​​the droplet after evaporation increases, while the surface tension and contact angle decrease. There is a certain linear relationship between the Myr concentration and the droplet drying area, so the concentration of the surfactant in the solution can be inferred from the droplet drying area.

[0046] Example 1

[0047] PBS (pH 7.4) was used to prepare Myr solutions of different concentrations (0, 0.001, 0.005, 0.01, 0.05, 0.1 mmol / L), and Tris buffer (0.02 M Tris buffer, pH 7.5) was used to prepare Myr solutions of different concentrations (0, 10 -5 , 10 -4 , 10 -3 , 10 -2 and 10 -1 AChE solution of 100 mg / mL was prepared using PBS (pH 7.2) containing 5% trehalose to prepare AFP solutions of different concentrations (0, 1, 5, 10, 15, 20, 25 and 30 ng / mL). The aptamer DNA was dissolved to 10 μmol / L in TE buffer (1× solution, low EDTA, pH 8.0) for storage.

[0048] First, 1 μL 10 mg / mL streptavidin-modified magnetic beads were washed twice with buffer I (10 mmol / L Tris-HCl, 1 mmol / L EDTA, 1 mol / L NaCl, 0.01% to 0.1% Tween-20, pH = 7.5), and then mixed with 500 μL 100 nmol / L apt1 for 20 to 40 min at 24.5 to 25.5°C, and magnetic bead-apt1 complexes were obtained by magnetic separation. The obtained magnetic bead-apt1 complexes were mixed with different concentrations of AFP (0, 1, 5, 10, 15, 20, 25 and 30 ng / mL) in buffer I for 20 to 40 min at 24.5 to 25.5°C, and magnetic bead-apt1-AFP complexes were obtained by magnetic separation. The obtained magnetic bead-apt1-AFP complex was mixed with 500 μL of 100 nmol / L ssDNA composed of apt2 and AChE aptamers at 24.5-25.5°C for 20-40 min, and the magnetic bead-apt1-AFP-ssDNA complex was obtained by magnetic separation. The obtained magnetic bead-apt1-AFP-ssDNA complex was mixed with 140 μL of 0.1 mg / mL AChE at 24.5-25.5°C for 0.5-1.5 h, and the magnetic bead-apt1-AFP-ssDNA-AChE complex was obtained by magnetic separation. The obtained magnetic bead-apt1-AFP-ssDNA-AChE complex was mixed with 100 μL of 0.05 mmol / L Myr at 36.5-37.5°C for 10-20 min, and the supernatant was collected after magnetic separation. Finally, 1 μL of the supernatant to be tested was transferred with a pipette and dropped onto the surface of the polyethylene terephthalate plate, which was then placed in an incubator at a constant temperature of 25°C and a humidity of 40% to dry for 10 minutes, and the experimental data was recorded with a microscope.

[0049] like Figure 2 As shown in the figure, there is a certain linear relationship between the AFP concentration and the droplet drying area, so the AFP concentration can be inferred from the droplet drying area. After the Myr solution is mixed and incubated with the magnetic bead-apt1-AFP-ssDNA-AChE complex, AChE can hydrolyze the Myr solution to generate myristic acid and choline chloride, which changes the Myr concentration and thus changes the size of the dried droplet area on the substrate surface, thereby achieving rapid detection of the AFP concentration.

[0050] like Figure 3 As shown in Figure 2, the area of ​​the dried droplet decreases with the increase of AFP concentration. The response of AFP to the dried droplet area is concentration-dependent and shows a good linear relationship in the range of 5-25 ng / mL (R 2=0.996), the limit of detection (LOD) was 1.27 ng / mL (based on 3σ / k), and the quantitative detection of AFP could be achieved through the obtained linear relationship.

[0051] Example 2

[0052] In order to test the performance of the surface droplet evaporation sensor in detecting real blood samples, we collected 8 serum samples from the hospital (including 6 healthy adult serum samples and 2 HCC patient serum samples, where the AFP concentration range in the healthy adult serum samples was 0-25 ng / mL, and the HCC patient serum samples were 2 high AFP concentration samples) for AFP detection. The serum samples were packaged and frozen at -20°C for subsequent testing. The AFP concentration in the serum samples was detected using the AFP detection method described in Example 1. The test results were compared with the chemiluminescence detection method used in the hospital laboratory.

[0053] like Figure 4 As shown, there is also a correlation between the droplet drying area and the AFP concentration. The AFP concentrations of samples I-VIII detected by chemiluminescence were 0.60, 4.10, 10.50, 14.70, 21.10, 24.60, 79.60 and 191.30 ng / mL, respectively. Large dried droplet patterns can be seen in samples I and II, indicating that the AFP concentration is low; for samples III-VI, the area of ​​the dried droplet pattern gradually decreases with the increase of AFP concentration. Small dried droplet patterns can be seen in samples VII and VIII, indicating that the AFP concentration is high. The standard curve is used to compare Figure 4 The AFP concentrations of samples III-VI were calculated, and the recovery rates and the comparison with the results of the chemiluminescence method are shown in Table 1. The biosensor detection platform based on surfactant-mediated surface droplet evaporation used in the present invention has similar detection results to the chemiluminescence method, indicating that it can effectively and accurately perform quantitative detection of AFP in real blood samples.

[0054] Table 1 Comparison of the concentration calculated from the dried droplet area and the chemiluminescence results

[0055]

[0056] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A biosensor detection platform based on droplet evaporation, characterized in that: The biosensor detection platform at least includes a substrate, aptamer DNA, cholinesterase, a choline surfactant, and streptavidin-coated magnetic beads; Wherein, the aptamer DNA includes a first aptamer DNA and a second aptamer DNA; The first aptamer DNA has a complementary region that specifically binds to the detection object, and the 5' end of the first aptamer DNA is modified with biotin; The second aptamer DNA has complementary regions that specifically bind to the detection object and cholinesterase.

2. The biosensor detection platform according to claim 1, characterized in that: The cholinesterase is acetylcholinesterase AChE, and the surfactant is myristoylcholine chloride Myr.

3. The biosensor detection platform according to claim 1, characterized in that: The substrate comprises at least one of a polyethylene terephthalate plate, a polyvinyl chloride plate, a polycarbonate plate, a polystyrene plate, and a polymethyl methacrylate plate; Preferably, the substrate is a polyethylene terephthalate board.

4. A method for detecting alpha-fetoprotein, characterized in that: The method comprises using the biosensor detection platform according to any one of claims 1 to 3 for detection.

5. The method according to claim 4, characterized in that The method comprises: S1, incubating the streptavidin-modified magnetic beads with the first aptamer DNA, wherein the first aptamer DNA is denoted as apt1, to obtain a MB-apt1 complex; S2, incubating the sample to be tested with the MB-apt1 complex to obtain a MB-apt1-AFP complex; S3, incubating the second aptamer DNA with the MB-apt1-AFP complex, wherein the second aptamer DNA is recorded as ssDNA, to obtain the MB-apt1-AFP-ssDNA complex; S4, incubating the AChE solution with the MB-apt1-AFP-ssDNA complex to obtain the MB-apt1-AFP-ssDNA-AChE complex; S5, incubating the surfactant Myr solution with the MB-apt1-AFP-ssDNA-AChE complex, and collecting the supernatant; S6, dropping the supernatant onto a substrate, drying, and quantitatively detecting AFP by comparing the dry area after evaporation of the droplets; Wherein, the nucleotide sequence of the first aptamer DNA is shown as SEQ ID NO.1; the nucleotide sequence of the second aptamer DNA is shown as SEQ ID NO.2; The methods are for non-therapeutic or diagnostic purposes.

6. The method according to claim 5, characterized in that In S1-S3, the incubation conditions are: incubation at 24.5-25.5°C for 20-40 min.

7. The method according to claim 5, characterized in that In S4, the incubation conditions are: incubation at 24.5-25.5°C for 0.5-1.5h; the concentration of the AChE solution is 10 -5 ~10 -1 mg / mL; Or, in S5, the incubation conditions are: incubation at 36.5-37.5° C. for 10-20 min; and the concentration of the surfactant Myr solution is 0.001-0.1 mmol / L.

8. Use of the biosensor detection platform according to any one of claims 1 to 3 in the detection and analysis of AFP in biological samples.

9. Use of the biosensor detection platform according to any one of claims 1 to 3 in the preparation of HCC diagnostic products.

10. Use of the biosensor detection platform according to any one of claims 1 to 3 or the method according to any one of claims 5 to 7 in AFP drug screening.

Images