Wheat-resistant protein TaHT3 as well as coding gene and application thereof

Abstract

The invention discloses a wheat heat-resistant protein TaHT3 as well as a coding gene and application thereof. The technical problem to be solved is to improve the heat resistance of wheat through a transgenic technology. The invention specifically discloses application of a substance for up-regulating or enhancing or improving the expression of the coding gene of the protein or a substance for up-regulating or enhancing or improving the activity or content of the protein in improving the heat resistance of the wheat plant. The protein is a protein with an amino acid sequence as shown in a sequence 2, and a variant and a fusion protein thereof. The heat resistance of a plant through overexpression of the TaHT3 protein coding gene is obviously higher than that of a wild plant, and the TaHT3 protein coding gene can be used for industrial production and plant breeding.

Description

Technical Field

[0001] The present invention specifically relates to wheat heat-resistant protein TaHT3 and its encoding gene and application. Background Art

[0002] Wheat is one of the most widely planted crops in the world and one of the important staple crops in my country. The continuous increase and stable yield of wheat is of great significance to maintaining national food security. In recent years, due to global warming and the gradual increase in temperature throughout the year, wheat agricultural production has suffered great damage. Studies have shown that by 2040, global temperatures are expected to rise by 1.5℃-2.0℃, which will further threaten global food security and may reduce global food production by 30%-40%. Therefore, it is of great significance to explore excellent heat-resistant genes in wheat and analyze their molecular and genetic mechanisms for regulating heat resistance, so as to cultivate new wheat varieties with stress resistance and stable yield. Summary of the invention

[0003] The invention provides a method for improving the heat resistance of wheat plants based on TaHT3 protein, which is used for improving the heat resistance of wheat plants, including at least one of biomass and survival rate.

[0004] In a first aspect, the present invention provides a substance for up-regulating, enhancing or increasing the expression of a gene encoding a protein or a substance for up-regulating, enhancing or increasing the activity or content of a protein for use in improving the heat tolerance of a plant of the genus Triticum;

[0005] The protein is any of the following:

[0006] B1) The amino acid sequence is the protein shown in SEQ ID NO: 2;

[0007] B2) a protein having more than 80% identity with the protein shown in B1) and having the same function as the protein shown in B1) obtained by substitution and / or deletion and / or addition of amino acid residues of the protein shown in B1);

[0008] B3) A fusion protein obtained by connecting the N-terminus and / or C-terminus of B1) or B2) to a protein tag.

[0009] In the above proteins, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0010] In the above-mentioned proteins, identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be obtained.

[0011] In the above proteins, the above 80% identity may be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

[0012] In the above protein, sequence 2 (SEQ ID No. 2) consists of 348 amino acid residues. It is named TaHT3-A protein. Its encoding gene is TaHT3-A gene (TaHT3 gene).

[0013] In the present application, the substance that upregulates or enhances or increases the expression of the gene encoding the protein or the activity or content of the protein can enhance the heat tolerance of the plant. In the above, the heat tolerance index can be the survival rate and / or biomass.

[0014] In the above application, the protein is derived from wheat.

[0015] In a second aspect, the present invention provides a product for improving the heat resistance of wheat plants, wherein the product comprises the above-mentioned substance.

[0016] In the above, the wheat may be the wheat variety Fielder.

[0017] In the above, the substance that regulates gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the gene).

[0018] In the above-mentioned use or the above-mentioned product, the use includes increasing the biomass and / or survival rate of the Triticum plant.

[0019] In the above, the adverse temperature of the heat resistance is 42° C. The adverse time condition of the heat resistance is 3 days.

[0020] In the above-mentioned uses, in the above-mentioned products, or in the above-mentioned uses or products, the substance that upregulates, enhances or increases the expression of a protein encoding gene or the substance that upregulates, enhances or increases the activity or content of a protein or the substance is any of the following:

[0021] B1), a nucleic acid molecule encoding the above protein;

[0022] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0023] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0024] B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0025] B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0026] B6), transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0027] B7), a transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3).

[0028] B1) In the nucleic acid molecule, a person skilled in the art can easily mutate the nucleotide sequence encoding the protein TaHT3-A of the present invention by using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 80% or more identity with the nucleotide sequence of the protein TaHT3-A isolated by the present invention are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein TaHT3-A and have the function of the protein TaHT3-A.

[0029] The above 80% or more identity may be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0030] Herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and searching to calculate the identity of an amino acid sequence, the value (%) of identity can then be obtained.

[0031] Herein, the vector is well known to those skilled in the art, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage, etc.), cosmid (i.e., cosmid), Ti plasmid or viral vector. Specifically, it can be pWMB110 vector;

[0032] In the above biological materials, the expression cassette described in B2) refers to a DNA capable of expressing the gene in a host cell, and the DNA may include not only a promoter for initiating gene transcription, but also a terminator for terminating gene transcription. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the constitutive promoter 35S of cauliflower mosaic virus; a wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); chemically inducible promoter from tobacco, pathogenesis-related (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); tomato proteinase inhibitor II promoter (PIN2) or LAP promoter (both can be induced by methyl jasmonate); heat shock promoter (U.S. Pat. No. 5,187,267); tetracycline-inducible promoter (U.S. Pat. No. 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)), seed storage protein-specific promoters (e.g., promoters of phaseolusin, napin, oleosin and soybean beta conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters.All references cited herein are incorporated in their entirety. Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators (see, e.g., Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0033] In the above B3), the recombinant vector may be a recombinant expression vector containing the gene expression cassette constructed using a plant expression vector. The plant expression vector may be a Gateway system vector or a binary Agrobacterium vector, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, pMDC85 or pCAMBIA1391-Xb. When using TaHT1-A to construct a recombinant expression vector, any enhancing, constitutive, tissue-specific or inducible promoter can be added before its transcription start nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiqutin promoter (pUbi), etc. They can be used alone or in combination with other plant promoters; in addition, when using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signals and start codons are extensive and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene. As a specific embodiment, the present application uses the pWMB110 vector as an expression vector.

[0034] In the above application, the nucleic acid molecule described in B1) is a DNA molecule whose nucleotide sequence is shown in Sequence 1.

[0035] In the above, the ORF of the gene encoding the protein shown in Sequence 2 may be that shown in Sequence 1.

[0036] In the above, the sequence of the gene encoding the protein shown in Sequence 2 is Sequence 1.

[0037] In a third aspect, the present invention provides a method for cultivating thermophilic plants.

[0038] The method comprises up-regulating or enhancing or increasing the expression level of the gene encoding the above-mentioned protein in the target Triticum plant, and / or the activity and / or content of the protein to obtain a highly heat-resistant Triticum plant, wherein the heat resistance of the highly heat-resistant Triticum plant is higher than that of the target Triticum plant.

[0039] In a fourth aspect, the present invention provides a method for increasing the biomass and / or survival rate of Triticum plants under high temperature stress.

[0040] The method includes increasing the biomass and / or survival rate of wheat plants under high temperature stress by up-regulating, enhancing or improving the expression of the coding gene of the above protein in wheat plants and / or the activity of the above protein.

[0041] In the present application, the plant of the genus Triticum can be wheat. The wheat can be the wheat variety Fielder.

[0042] In the above method, the up-regulation, enhancement or improvement of the expression of the gene encoding the above protein in the wheat plant is achieved by expressing the gene encoding the above protein in the target wheat plant.

[0043] In the above, the overexpression of the gene encoding the above protein in the target Triticum plant comprises introducing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3) into the target plant.

[0044] In the above, the nucleic acid molecule may be the nucleic acid molecule described in Sequence 1.

[0045] In the above-mentioned uses, the above-mentioned products, the above-mentioned uses or products or the above-mentioned methods, the Triticum plant is wheat.

[0046] In the above-mentioned uses, the above-mentioned products, the above-mentioned uses or products or the above-mentioned methods, the Triticum plant is a Triticum plant in the seedling stage.

[0047] In the above, the wheat includes but is not limited to Yannong 15, Lumai 15, Jimai 38, Zhengmai 379, Jimai 44, Chuanmai 104, Xinong 511, Zhongmai 578, Weilong 169, Zhengmai 1860, Bainong 207, Luyuan 502, Huaimai 33, Bainong 4199, Xinmai 26, Malan 1, Yangmai 25, Yumai 14 superior series, Xinmai 19, Fengdecunmai 20, Zhongxinmai 998, Zhengmai 136, Bainong 307, Yannong 1212, Zhoumai 16, Zhoumai 22 or Fielder.

[0048] In the present application, the wheat may be the wheat variety Fielder.

[0049] In the above, the heat tolerance index may be survival rate and / or biomass.

[0050] In the above text, the biomass refers to the aboveground weight.

[0051] In the above, the survival rate = number of surviving seedlings / total number of seedlings.

[0052] In the above, high heat tolerance means higher survival rate and biomass under high temperature stress conditions.

[0053] In the above text, the seedling stage is 7-10 days of growth, which can be 7 or 10 days.

[0054] In the above, the 7-10 days of growth can be counted from sowing. Specifically, it can be 7 or 10 days.

[0055] In the present application, the high temperature pressing condition is heat treatment at 42°C for 3 days.

[0056] Beneficial Effects

[0057] The present invention discloses a wheat heat-resistant protein TaHT3 and its encoding gene and application. The technical problem to be solved is to improve the heat resistance of wheat by transgenic technology. Specifically disclosed is the use of a substance that up-regulates or enhances or improves the expression of the encoding gene of the protein or a substance that up-regulates or enhances or improves the activity or content of the protein in improving the heat resistance of wheat plants; the protein is a protein whose amino acid sequence is shown in Sequence 2 and its variants and fusion proteins. Plants that over-express the TaHT3 protein encoding gene have significantly higher heat resistance than wild-type plants and can be used for industrial production and plant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 This is a graph of the transcription level of the TaHT3 gene in wild-type wheat Fielder, OE-1 and OE-2.

[0059] Figure 2 The phenotypes of wild-type wheat Fielder, OE-1 and OE-2 before and after heat stress.

[0060] Figure 3 Biomass of wild-type wheat Fielder, OE-1 and OE-2 under heat stress and normal environments.

[0061] Figure 4 This is a graph showing the survival rates of wild-type wheat Fielder, OE-1, and OE-2 under heat stress and normal environments. DETAILED DESCRIPTION

[0062] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0063] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0064] The following examples were processed using SPSS11.5 statistical software, and the experimental results were expressed as mean ± standard deviation. One-way ANOVA test was used, and P < 0.05 (*) indicated a significant difference, P < 0.01 (**) indicated a very significant difference, and P < 0.001 (***) indicated an extremely significant difference.

[0065] In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology and laboratory operation procedures used herein are terms and routine procedures widely used in the corresponding fields. At the same time, in order to better understand the present invention, the definitions and explanations of the relevant terms are provided below.

[0066] In the present invention, products include but are not limited to reagents, kits or devices.

[0067] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may be linear, cyclic or branched, it may contain modified amino acids, particularly conservatively modified amino acids, and it may be interrupted by non-amino acids. The term also includes modified amino acid polymers such as those that have been modified by sulfation, glycosylation, lipidation, acetylation, phosphorylation, iodination, methylation, oxidation, proteolytic processing, isoprenylation, racemization, selenoylation, transfer-RNA mediated amino addition such as arginylation, ubiquitination, or any other operation such as conjugation with a labeling component. As used herein, the term "amino acid" refers to natural and / or non-natural or synthetic amino acids, including glycine and D or L optical isomers, as well as amino acid analogs and peptide mimetics. A polypeptide or amino acid sequence "derived from" a specified protein refers to the source of the polypeptide. The term also includes polypeptides expressed by a specified nucleic acid sequence.

[0068] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to naturally occurring amino acids. Naturally occurring amino acids are amino acids encoded by the genetic code, as well as subsequently modified amino acids, such as hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. In this article, amino acids may be represented by the common three-letter codes or single-letter codes recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides may be represented by their generally accepted single-letter codes.

[0069] The term "Triticum" refers to plants of the genus Triticum, class Monocots, family Poaceae. It is an annual or biennial herb. Its culms are erect, tufted, with 6-7 nodes, 60-100 cm high and 5-7 mm in diameter. The leaf sheaths are loosely phimotic, the lower ones are longer than the upper ones and shorter than the internodes; the ligules are membranous, about 1 mm long; the leaves are long-lanceolate. The spikes are erect, 5-10 cm long (except for the awns), 1-1.5 cm wide; the spikelets contain 3-9 florets, the upper ones are rudimentary; the glumes are ovate, 6-8 mm long, the main vein has a ridge on the upper back, extending to a tooth about 1 mm long at the top, and the dorsal ridges and apical teeth of the lateral veins are not obvious; the lemma is oblong-lanceolate, 8-10 mm long, with awns or no awns at the top; the palea is almost the same length as the lemma.

[0070] The term "wheat" refers to wheat of the genus Triticum, including but not limited to Yannong 15, Lumai 15, Jimai 38, Zhengmai 379, Jimai 44, Chuanmai 104, Xinong 511, Zhongmai 578, Weilong 169, Zhengmai 1860, Bainong 207, Luyuan 502, Huaimai 33, Bainong 4199, Xinmai 26, Malan 1, Yangmai 25, Yumai 14 superior line, Xinmai 19, Fengdecunmai 20, Zhongxinmai 998, Zhengmai 136, Bainong 307, Yannong 1212, Zhoumai 16, Zhoumai 22 or Fielder.

[0071] The term "heat tolerance" refers to the ability of a plant to adapt to and resist high temperature stress. Specifically, it can be reflected in the effects of high temperature stress on various indicators and / or traits, including but not limited to photosynthesis, respiration, transpiration, osmotic regulation substance content, antioxidant system, plant hormones, cell ultrastructure, biomass and / or survival rate.

[0072] In the present invention, the use of improving the heat resistance of wheat plants includes but is not limited to preparing products for improving the heat resistance of wheat plants, improving the heat resistance of wheat plants and / or wheat plant breeding.

[0073] The terms "high temperature stress" and "high temperature stress environment" have the same meaning and refer to high temperatures that have harmful effects on plants.

[0074] The term "expression cassette" refers to a DNA capable of expressing a target protein or nucleic acid in a host cell. The expression cassette may also include a single-stranded or double-stranded nucleic acid molecule containing all regulatory sequences necessary for expressing a nucleic acid molecule of any of the above proteins. The regulatory sequence can direct the coding sequence to express any of the above proteins in a suitable host cell under compatible conditions. The regulatory sequence includes, but is not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal sequence, and a transcription terminator. At a minimum, the regulatory sequence includes a promoter and termination signals for transcription and translation. In order to introduce specific restriction enzyme sites into the vector so as to connect the regulatory sequence to the coding region of the nucleic acid sequence encoding the protein, a regulatory sequence with a linker may be provided. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence that can be recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains a transcriptional regulatory sequence that mediates protein expression. The promoter may be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutant, truncated, and hybrid promoters, and may be obtained from a gene encoding an extracellular or intracellular protein that is homologous or heterologous to the host cell. The regulatory sequence may also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell to terminate transcription. The termination sequence may be operably linked to the 3' end of the nucleic acid sequence encoding the protein. Any terminator that can function in the selected host cell may be used in the present invention. The regulatory sequence may also be a suitable leader sequence, i.e., an untranslated region of mRNA that is important for translation of the host cell. The leader sequence may be operably linked to the 5' end of the nucleic acid sequence encoding the protein. Any leader sequence that can function in the selected host cell may be used in the present invention. The regulatory sequence may also be a signal peptide coding region that encodes an amino acid sequence attached to the amino terminus of the protein that can guide the encoded protein into the cell secretory pathway. Signal peptide coding regions that can guide the expressed protein into the secretory pathway of the host cell used may be used in the present invention. It may also be desirable to add regulatory sequences that can regulate protein expression according to the growth of the host cell. Examples of regulatory systems are those that can respond to chemical or physical stimuli (including in the presence of regulatory compounds) to open or close gene expression. Other examples of regulatory sequences are those that can amplify genes. In these cases, the nucleic acid sequence encoding the protein should be operably linked to the regulatory sequences.

[0075] The term "vector" generally refers to a vector that can carry foreign DNA or target gene into host cells for amplification and / or expression. The vector can be a cloning vector or an expression vector. The vector can be introduced into host cells by transformation, transduction or transfection, so that the genetic material elements it carries are amplified and / or expressed in the host cells. Those skilled in the art can select a suitable vector according to the purpose of genetic engineering and the properties of the recipient cells. The vector includes, but is not limited to, plasmid, phage (e.g., lambda phage or M13 phage), cosmid, phagemid, shuttle vector (e.g., yeast expression vector), Ti plasmid, artificial chromosome (e.g., yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), P1 artificial chromosome (PAC), or Ti plasmid artificial chromosome (TAC)), viral vector (e.g., baculovirus vector, retrovirus (including lentivirus), adenovirus, adeno-associated virus, poxvirus, papillomavirus, papillomavirus (e.g., SV40), herpesvirus (e.g., herpes simplex virus)). A vector may contain a variety of elements for controlling expression, including, but not limited to, promoter sequence, transcription initiation sequence, enhancer sequence, selection element, and reporter gene. In addition, the vector may also contain a replication initiation site.

[0076] The term "microorganism" generally includes bacteria, viruses, fungi, actinomycetes, rickettsia, mycoplasma, chlamydia, spirochetes, algae, etc. For example, the bacteria may be from Escherichia sp. (such as Escherichia coli), Erwinia sp., Agrobacterium sp. (such as Agrobacterium tumefaciens), Flavobacterium sp., Alcaligenes sp., Pseudomonas sp. and Bacillus sp. (such as Bacillus), etc. The virus may include rotavirus, baculovirus, retrovirus (such as lentivirus), adenovirus, adeno-associated virus, poxvirus, papillomavirus, influenza virus, papillomavirus (such as SV40) and herpes virus (such as herpes simplex virus), etc. The fungus may be from Saccharomyces sp. (such as Saccharomyces cerevisiae, methanol yeast, Pichia pastoris), Fusarium sp., Rhizoctonia sp., Verticillium sp., Penicillium sp., Aspergillus sp., and Cephalosporium sp., etc. The actinomycetes may be from Streptomyces sp. (such as Streptomyces). The algae may be from Cyanophyta (such as cyanobacteria), Fucus sp., Achnanthes sp., Amphiprora sp., Amphora sp., Ankistrodesmus sp., Asteromonas sp., and Boekelovia sp., etc.

[0077] The term "host cell" is also referred to as a recipient cell, and generally refers to any type of cell that can be used to introduce a vector, such as a plant cell and an animal cell. The host cell can be understood to refer not only to a specific recipient cell, but also to the progeny of such a cell, and due to natural, accidental or intentional mutations and / or changes, the progeny may not necessarily be completely identical to the original parent cell, but is still included in the scope of the host cell. Suitable host cells are known in the art, wherein: the plant cell may be Arabidopsis thaliana, tobacco (Nicotiana tabacum), corn (Zea mays), rice (Oryza sativa), wheat (Triticum aestivum) and the like plant cells but are not limited thereto; the animal cell may be a mammalian cell (e.g., Chinese hamster ovary cell (CHO cell), Chinese hamster ovary cell substrain (CHO-K1 cell), African green monkey kidney cell (Vero cell), SV40-transformed African green monkey kidney cell (COS cell), baby hamster kidney cell (BHK cell), mouse breast cancer cell (C127 cell), human embryonic kidney cell (HEK293 cell), human HeLa cell, fibroblast, bone marrow cell line, T cell or NK cell, etc.), avian cell (e.g., chicken or duck cell), amphibian cell (e.g., African clawed frog (Xenopus laevis) cell or giant salamander (Andrias davidianus) cells), fish cells (such as grass carp, carp, rainbow trout or catfish cells), insect cells (such as Sf21 cells, Sf-9 cells or Hi-5), etc., but are not limited thereto.

[0078] The term "recombinant vector" generally refers to a recombinant DNA molecule constructed by connecting an exogenous target gene to a vector in vitro. The recombinant vector can be constructed in any suitable manner as long as it can carry the exogenous target gene into the recipient cell.

[0079] It can be used to transfer genes into recipient cells and provide the exogenous target gene with the ability to replicate, integrate, amplify and / or express in the recipient cells.

[0080] The term "recombinant vector" generally refers to a recombinant DNA molecule constructed by connecting an exogenous target gene to a vector in vitro. It can be constructed in any suitable manner, as long as the constructed recombinant vector can carry the exogenous target gene into the recipient cell and provide the exogenous target gene with the ability to replicate, integrate, amplify and / or express in the recipient cell.

[0081] The term "recombinant microorganism" generally refers to a recombinant microorganism with changed functions obtained by manipulating and modifying the genes of a target microorganism, such as introducing an exogenous target gene or a recombinant vector into the target microorganism, or directly editing the endogenous genes of the target microorganism.

[0082] The term "recombinant host cell" generally refers to a recombinant host cell whose function has been changed by manipulating and modifying the genes of the host cell, such as introducing an exogenous target gene or a recombinant vector into the host cell, or directly editing the endogenous genes of the host cell.

[0083] The term "overexpression" refers to the process of increasing the expression level of a target gene beyond its normal physiological state by some means. Overexpression involves constructing the coding region of the target gene into a plasmid or viral vector, and then introducing it into the target cell, target plant, target organ or target plant to increase the expression level of the target gene.

[0084] As used herein, the terms "comprising, comprises and comprised of" are synonymous with "including and includes" or "containing and contains" and are inclusive or open-ended and do not exclude additional, unrecited members, elements or method steps. The terms "comprising, comprises and comprised of" also include the term "consisting of".

[0085] When the term "identity" is used to describe an amino acid sequence or a nucleic acid sequence relative to a reference sequence, the percentage of identical amino acids or nucleotides between two amino acid sequences or nucleic acid sequences is determined by conventional methods, for example, see Ausubel et al., eds. (1995), Current Protocols in MolecμLar Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York); and the ALIGN program (Dayhoff (1978), Atlas of Protein Sequence and Structure 5: Suppl. 3 (National Biomedical Research Foundation, Washington, DC). There are many algorithms for aligning sequences and determining sequence identity, including the homology alignment algorithm of Needleman et al. (1970) J. Mol. Biol. 48: 443; the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2: 482; the local homology algorithm of Pearson et al. (1988) P. The similarity search method of Proc. Natl. Acad. Sci. 85: 2444; Smith-Waterman algorithm (Meth. Mol. Biol. 70: 173-187 (1997); and BLASTP, BLASTN, and BLASTX algorithms (see Altsch μL et al. (1990) J. Mol. Biol. 215: 403-410). Computer programs that utilize these algorithms are also available and include, but are not limited to, ALIGN or Megalign (DNASTAR) software, or WU-BLAS T-2 (Altsch μL et al., Meth. Enzym., 266:460-480 (1996)); or GAP, BESTFIT, BLAST Altsch μL et al., supra, FASTA, and TFASTA, available in the Genetics Computing Group (GCG) package, Version 8, Madison, Wisconsin, USA; and CLUSTAL in the PC / Gene program provided by Intelligenetics, Mountain View, California.

[0086] The terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of the features. Further, in the description of the present invention, unless otherwise specified, "plurality" means two or more.

[0087] When referring to a measurable value such as an amount, a temporal duration, etc., the term "about" is meant to include variations of ±20%, or in some cases ±10%, or in some cases ±5%, or in some cases ±1%, or in some cases ±0.1% of the specified value.

[0088] Example 1. Acquisition and identification of transgenic plants

[0089] 1. Construction of recombinant plasmid

[0090] 1. Design primers (TaHT3-F and TaHT3-R) to amplify the ORF fragment of TaHT3-A with restriction endonuclease linker from the cDNA of wheat Fielder seedling leaves, introduce restriction site (BamHⅠ), and use primers TaHT3-F and TaHT3-R for PCR amplification to obtain the ORF fragment of TaHT3-A with restriction endonuclease linker.

[0091] The ORF fragment sequence of TaHT3-A is shown in Sequence 1.

[0092] Sequence 1 is as follows:

[0093] ATGGTCTCCAGCGCCCGTAGTTCCCGGCGGCATGGCTCACTCGGCTTCCAACAGCGCCG

[0094] GAAGCGCCGGTTCCCTCTCCGGCGGCATCGGGCCCGGCAAGGGGGTTGCGGCGGCGGC

[0095] CGCCACGACCTCGGCGTCAGCGTCCACGCCGGCCAGCGGGAGCACCGTTGCCCGCCGC

[0096] CTCAATGATCTCGAAATTCAGGGAGATGACCCCGCCATCGTCGCAGCCCGTTGCTAGCA

[0097] AGAAGAAAAAGAAAGGAACACGCGTAGTAGGTCCCGACAAAGGTAACCGTGGATTGC

[0098] GCCAATTCAGTATGAAAGTCTGTGAGAAAGTTGAAGGCAAAGGGAGAACAACCTACA

[0099] ATGAGGTGGCAGACGAACTTGTAGCTGAGTTTGCAGATCCAAATAGTAATATTGGGTC

[0100] ACCAGATCCTGATAATCCCAACACACAACAATATGATGAGAAAAATATACGAAGAAG

[0101] GGTTTACGATGCACTAAACGTCCTGATGGCTATGGATATTATATCTAAAGATAAAAAG

[0102] GAAATTCAGTGGAAGGGCTTACCCCGAACAAGTTTGAGTGATATTGATAAATTGAAGA

[0103] CTGAGGTCATTGGGCTGAAAGGTAGAATTGACAAGAAAAGTGCATATCTGCAGGAATT

[0104] ACAAGATCAATATGCGGGCCTCCAAAATTTGGTAGAGCGAAATGAGCAGCTATATGGT

[0105] TCGGGAGATGCTCCATCTGGCGGAGTGGCCCTGCCATTCATATTGGTTCAGACACGTCC

[0106] TCATGCAACTGTCGAAGTGGAGATATCAGAAGATATGCAGTTGGTGCATTTTGATTTCA

[0107] ATAGCACTCCGTTTGAGTTGCACGATGATTCCTTTGTATTGAAAGCAATGGGGTTCTCT

[0108] GGTAAAGAAGAAACTGACGGTACAGTGGCTCTGGTTGCAAATGCGGTTGAATGCTCAA

[0109] GTGCATCAAATGTTTATGGGCGTCGATCACCACAACCTGCAAGGCCAAATGGAATTAG

[0110] GCTACGAACCTCACCTCCTATTCCAGGGATACTGAAAGGGCGTGTCAAGCATGAACAC

[0111] TAG

[0112] The protein sequence encoded by TaHT3-A is shown in Sequence 2 as follows:

[0113] MVSSARSSGGMAHSASNSAGSAGSPSGGIGPGKGVAAAAATTSASASTPASGSTVARRLNDLEIQGDDPPSSQPVASKKKKKGTRVVGPDKGNRGLRQFSMKVCEKVEGKGRTTYNEVADELVAEFADPNSNIGSPDPDNPNTQQYDEKNIRRRVYDALNVLMAMDIISKDKKEIQWKGLPRTSLSDIDKLKTEVIGLKGRIDKKSAYLQELQDQYAGLQNLVERNEQLYGSGDAPSGGVALPFILVQTRPHATVEVEISEDMQLVHFDFNSTPFELHDDSFVLKAMGFSGKEETDGTVALVANAVECSSASNVYGRRSPQPARPNGIRLRTSPPIPGILKGRVKHEH*

[0114]

[0115] TaHT3-F:5'- GGATCC ATGGTCTCCAGCGCCCGTAG-3'; the underline is the restriction endonuclease BamHI recognition site;

[0116] TaHT3-R:5'- GGATCC CTAGTGTTCATGCTTGACAC3'; the underline indicates the recognition site of restriction endonuclease BamHI.

[0117] 2. The amplified product fragment with the restriction site linker (ORF fragment of TaHT3-A with the restriction site linker) is recovered and purified to obtain the PCR amplification product.

[0118] 3. Use restriction endonuclease BamHI to digest the PCR amplification product in step 2, recover the digestion product, and obtain the PCR digestion product.

[0119] 4. Use restriction endonuclease BamHⅠ to digest the pWMB110 vector (the p110 vector is recorded in the following literature: Wang, K., Shi, L., Liang, X. et al. The gene TaWOX5 overcomes genotype dependency in wheat ge netic transformation. Nat. Plants 8, 110–117 (2022). https: / / doi.org / 10.1038 / s41477-021-01085-8, and its name in the literature is pWMB110) and set aside to obtain the restriction endonuclease pWMB110 vector.

[0120] 5. Use T4 ligase to connect the PCR digestion product of step 3 and the digested pWMB110 vector of step 4 to obtain the pWMB110-TaHT3-A recombinant plasmid.

[0121] The sequencing results showed that the pWMB110-TaHT3-A recombinant plasmid was obtained by replacing the sequence between the restriction endonuclease BamHI recognition sites of the pWMB110 vector with sequence 1, while maintaining the correct expression of TaHT3-A (sequence 1) and the other nucleotides of the pWMB110 vector unchanged. The recombinant plasmid was named pWMB110-TaHT3-A recombinant plasmid.

[0122] 2. Obtaining TaHT3 overexpressing transgenic wheat

[0123] 1. Using Fielder's cDNA as a template, TaHT3-p110-F and TaHT3-p110-R primers were used to amplify the ORF fragment of TaHT3 containing the restriction site BamHI vector linker for the construction of an overexpression vector.

[0124] 2. After the amplified DNA fragments were recovered from agarose gel, TaHT3 was constructed onto the p110 vector using homologous recombination to form a TaHT3 overexpression vector (pWMB110-TaHT3-A recombinant plasmid).

[0125] 3. Transform the pWMB110-TaHT3-A recombinant plasmid into Escherichia coli to obtain the Escherichia coli Mach1-T1 / pWMB110-TaHT3-A recombinant plasmid. The Escherichia coli Mach1-T1 / pWMB110-TaHT3-A recombinant plasmid is the Escherichia coli containing the pWMB110-TaHT3-A recombinant plasmid.

[0126] 4. Screen the positive clones by PCR reaction and sequence them. The ones with correct sequences were named as pWMB110-TaHT3-A recombinant plasmid. At the same time, the pWMB110-TaHT3-A recombinant plasmid was extracted and transformed into Agrobacterium to obtain Agrobacterium / pWMB110-TaHT3-A recombinant plasmid transformation. The Agrobacterium EHA105 / pWMB110-TaHT3-A recombinant plasmid transformation was the Agrobacterium containing the pWMB110-TaHT3-A recombinant plasmid, which was sent to the wheat transgenic platform for wheat (the recipient was Fielder) genetic transformation to obtain 8 TaHT3-A overexpressing T0 generation transgenic wheat strains, which were self-pollinated to obtain 2 TaHT3-A overexpressing T2 generation homozygous transgenic wheat lines, which were named OE1 and OE2.

[0127] 5. PCR identification was performed on the TaHT3-A overexpression T2 generation homozygous transgenic wheat (OE1 and OE2).

[0128] Expression level identification is as follows:

[0129] T3 generation seeds (OE1 T3 generation homozygous seeds and OE2 T3 generation homozygous seeds) and control group (wheat variety Fielder) seeds were planted, and when they were in the three-leaf stage, RNA was extracted from the leaves and reverse transcribed into cDNA using a reverse transcription kit (VazymeBiotech, R223-01), and the expression level was monitored using quantitative primers; (expression level identification is a complete process, which requires the sampling time of Fielder, OE1, and OE2, the specific primers and internal reference primers for detection, the fluorescence quantitative kit and specific conditions).

[0130] Detection primers: TaHT3-qF: ACAAGATCAATATGCGGGC; TaHT3-qR: AAAGGAATCATCGTGCAACTC. TaACTIN was used as an internal reference, internal reference primers: TaACTIN-F: GGAATCCATGAGACCACCTAC; TaACTIN-R: GACCCAGACAACTCGCAAC.

[0131] The results are as follows Figure 1 ( Figure 1 (in the figure, Fielder is the control, OE1 and OE2 are OE1 T3 homozygous seedlings and OE2 T3 homozygous seedlings, respectively) as shown in the figure, the expression level of TaHT3 gene in TaHT3 overexpressing T3 homozygous seedlings was significantly increased compared with that in Fielder seedlings.

[0132] 6. After the positive strains are harvested, they are grown in the greenhouse for generations, and PCR is used to identify the T3 generation plants as positive.

[0133] Example 2 Identification of heat-resistant phenotype of transgenic plants

[0134] 1. Heat stress experiment of TaHT3 overexpression wheat

[0135] Seeds of the two lines N-OE1 and N-OE2 (OE1 homozygous T3 generation and OE2 homozygous T3 generation) that have been identified as positive overexpression strains mentioned above, as well as seeds of the wild-type Fielder were selected, disinfected with 1% hydrogen peroxide for 10 minutes, washed 3-4 times with distilled water, placed in a culture dish, covered with two layers of filter paper, added with a small amount of distilled water, and left at room temperature for 48 hours.

[0136] Select seedlings with consistent germination and transplant them into a culture box filled with nutrient soil (the culture medium in the culture box is obtained by mixing vermiculite and nutrient soil at a volume ratio of 2:1). Each pot is divided into two parts, one part is control seeds (seeds of wild-type Fielder) and the other part is seeds of overexpression lines (OE1 and OE2), with a total of four replicates. The experiment is divided into a heat-resistant experimental group and a control group.

[0137] The heat resistance test group performed the following operations:

[0138] After planting in the culture box, grow under the culture conditions of 22℃-18℃, 16 hours light / 8 hours dark, 60%-70% humidity for 7 days, and then conduct heat resistance assessment at 42℃ seedling stage:

[0139] Fielder and TaHT3 overexpressing plants (OE1 homozygous T3 generation and OE2 homozygous T3 generation) were heat treated at 42°C for 3 days, and then recovered for 7 days under culture conditions of 22°C-18°C, 16 h light / 8 h dark, and 60%-70% humidity. The phenotypes were recorded by photographing, and the survival rate and biomass before and after stress were calculated.

[0140] The control group underwent the following operations:

[0141] After planting in the culture box, the whole process was carried out under culture conditions (normal conditions) at 22℃-18℃, 16 hours of light / 8 hours of darkness, and 60%-70% humidity. When the heat-resistant experimental group recovered for 7 days, they were photographed together to calculate the survival rate and biomass before and after stress.

[0142] Survival rate = number of surviving seedlings / total number of seedlings.

[0143] Survival was determined when the stem remained green, leaves partially or fully turned green, or new leaves unfolded.

[0144] The criteria for determining death are: the leaves turn yellow and die, and the stems completely die with no signs of greening again.

[0145] The biomass before and after stress was obtained by cutting the aboveground part of wheat seedlings from the stem base and weighing and recording the weight.

[0146] Phenotypic results Figure 2 As shown ( Figure 2 The left side of the middle is the wild-type wheat Fielder, the middle is the OE1 homozygous T3 generation, the left side is the OE2 homozygous T3 generation, the Normal condition is the control group, and the HS treatment (42℃) is the heat-resistant experimental group). Under normal conditions, there is no significant difference between the overexpression plants and the wild-type plants. After heat treatment, the growth of the overexpression lines is significantly stronger than that of the wild-type lines.

[0147] The biomass results are as follows Figure 3 As shown ( Figure 3 In the figure, the left bar graph is the biomass bar graph, Normal condition is the control group, HS treatment (42℃) is the heat-resistant experimental group; Fielder is the wild-type wheat Fielder, OE-1 is the OE1 homozygous T3 generation, OE-2 is the OE2 homozygous T3 generation, and the vertical axis Biomass is the biomass). After 7 days of recovery, there were significant differences in the fresh and dry weights of each strain, and the fresh weight of the overexpression strain was greater than that of the wild-type plant. In addition, the dry weight of the overexpression strain after recovery was slightly higher than that of the wild-type strain ( Figure 4 ).

[0148] The survival rate results are as follows Figure 4 As shown ( Figure 4 Survival rate bar graph of heat-resistant experimental groups; Fielder is wild-type wheat Fielder, OE-1 is OE1 homozygous T3 generation, OE-2 is OE2 homozygous T3 generation, and the vertical axis Survival Rate (%) is the survival rate. The results showed that the survival rate of the overexpression lines (OE1 homozygous T3 generation and OE2 homozygous T3 generation) was significantly lower than that of the wild-type plants after recovery.

[0149] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of a substance that up-regulates, enhances or improves the expression of a protein-encoding gene or a substance that up-regulates, enhances or improves the activity or content of a protein in improving the heat resistance of wheat plants; The protein is any of the following: B1) The amino acid sequence is the protein shown in SEQ ID NO: 2; B2) a protein having more than 80% identity with the protein shown in B1) and having the same function as the protein shown in B1) obtained by substitution and / or deletion and / or addition of amino acid residues of the protein shown in B1); B3) A fusion protein obtained by connecting the N-terminus and / or C-terminus of B1) or B2) to a protein tag.

2. The use according to claim 1, characterized in that: The protein is derived from wheat.

3. A product for improving the heat resistance of wheat plants, characterized in that: The product comprises the substance described in claim 1 or 2.

4. The use according to claim 1 or 2 or the product according to claim 3, characterized in that The use includes increasing the biomass and / or survival rate of the Triticum plant.

5. The use according to claim 1 or 2, the product according to claim 3 or the use or product according to claim 4, characterized in that: The substance that upregulates, enhances or improves the expression of a gene encoding a protein or the substance that upregulates, enhances or improves the activity or content of a protein or the substance is any of the following: B1), a nucleic acid molecule encoding the protein according to claim 1 or 2; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6), transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7), a transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3).

6. A method for cultivating a thermophilic plant, characterized in that: The method comprises up-regulating, enhancing or increasing the expression level of the gene encoding the protein described in claim 1 or 2 in the target wheat plant, and / or the activity and / or content of the protein to obtain a highly heat-resistant wheat plant, wherein the heat resistance of the highly heat-resistant wheat plant is higher than that of the target wheat plant.

7. A method for increasing the biomass and / or survival rate of Triticum plants under high temperature stress, characterized in that: The method comprises increasing the biomass and / or survival rate of wheat plants under high temperature stress environment by up-regulating, enhancing or increasing the expression of the gene encoding the protein described in claim 1 or 2 in the wheat plants, and / or the activity and / or content of the protein described in claim 1 or 2.

8. The method according to claim 6 or 7, characterized in that: The up-regulation, enhancement or increase of the expression of the gene encoding the protein of claim 1 or 2 in the wheat plant is achieved by expressing the gene encoding the protein of claim 1 or 2 in the target wheat plant.

9. The use according to claim 1 or 2, the product according to claim 3, the use or product according to claim 4 or 5, or the method according to claim 8, characterized in that: The Triticeae plant is wheat.

10. The use according to claim 1 or 2, the product according to claim 3, the use or product according to claim 4 or 5, or the method according to claim 8, characterized in that: The wheat plant is a wheat plant in the seedling stage.

Images