Supercharge Your Innovation With Domain-Expert AI Agents!

Human explosive power level detection kit and human explosive power level detection method

A kit and explosive technology, applied in the field of genetic testing kits for human explosive power level, can solve problems such as unpredictability and inability to explore individual potential, and achieve the effect of achieving high efficiency, effective and reasonable self-advantage

Inactive Publication Date: 2016-05-25
WUHAN BAIYUAN TECH CO LTD +1
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, when faced with the selection of young athletes, these traditional methods are not predictive and cannot discover the true potential of the individual

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human explosive power level detection kit and human explosive power level detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0047] The explosive level gene detection kit includes the box body and reagents stored separately in the box body. The stored reagents include:

[0048] (1) PCR reaction primer set for 7 gene SNP polymorphic sites (the following primer sequence directions are all from 5' to 3'):

[0049] Primer set for SNPrs699:

[0050] 1CTGGCTGCTCCCTGAC

[0051] 2GTCCACACTGGCTCCCA

[0052] 3GTTTGTGCAGGGCCTG

[0053] 4CAAGGGTGGTCACCAG

[0054] Primer set for SNPrs1815739:

[0055] 1CTGCCCGAGGCTGACC

[0056] 2GGCACCTCGCTCTCA

[0057] 3GCACACTGCTGCCCTTTC

[0058] 4CACATCTGAAGATGGAC

[0059] Primer set for SNPrs16892496:

[0060] 1GAAGAGCAAGCCCCCA

[0061] 2GACTTGTATCCCACG

[0062] 3AATTCAATAAACATGTATTG

[0063] 4GAATGGAAACTCCAAG

[0064] Primer set for SNPrs4253778:

[0065] 1CTTGATATCTAGTTTC

[0066] 2GAAATGAAGCTTTTGAATCC

[0067] 3TCCCCACTCTGGGTCTCCT

[0068] 4TATTCATAGACTAGG

[0069] Primer set for SNPrs2010963:

[0070] 1GTGCGAGCAGCGAAAGC

[0071] 2GCACTTTGCCCCTGTCC

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a human explosive power level gene detection kit, which comprises a box and reagents separately stored inside the box, wherein the reagents comprise (1) a PCR reaction primer group for seven gene SNP polymorphic loci, (2) a PCR amplification reagent, and (3) an agarose gel electrophoresis analysis reagent. According to the present invention, with the PCR primer design, the multiple PCR amplification reactions can be simultaneously performed on the same PCR instrument to detect the related gene of the subject and achieve the high efficiency and the specificity of the detection, the gene basis of the explosive power level is obtained through analysis, whether the individual is fit to engage in the explosive power-related sports is evaluated, and the scientific basis for selecting the sport is provided for professional sport organizations and coaches; and for the public body building training, the potential sport ability assessment is provided for the individual, the individual can well select the sport suitable for the own physical condition, such that the own disadvantages can be efficiently and rationally provided, and the training purpose is achieved.

Description

technical field [0001] The invention relates to gene detection, in particular to a human body explosive force level gene detection kit. Background technique [0002] The genetic law of athletic ability provides a theoretical basis for the scientific selection of athletes. Coaches can select those children with special talents for certain sports and give them scientific training according to the different requirements of athletes for different sports. , so that their innate abilities can be fully utilized and developed. Therefore, the selection of athletes must be based on the special characteristics of different athletes, and the indicators with high heritability should be used as the basis for selection, so as to make the selection of athletes scientific. [0003] Explosive power events mainly include four groups of events: sprinting, jumping, throwing and weightlifting. Their outstanding feature is that athletes are required to maximize their physical potential in a short...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 李则轩邱嘉铭张舒朱轶凡别茜张静静范家成卢骏
Owner WUHAN BAIYUAN TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More