A maltogenic amylase mutant with improved enzyme activity and screening method thereof

Abstract

The present invention relates to a maltogenic amylase mutant with improved enzyme activity and a screening method thereof, belonging to the field of bioengineering technology. The present invention first constructs a maltogenic amylase mutant library, then uses P in a recombinant Bacillus subtilis glvc and P amyE The promoters express fluorescent protein and maltogenic amylase mutants, respectively. glvc After mutation, the response range and induction intensity to maltose were further improved. Since the maltogenic amylase mutant reacts with soluble starch to produce maltose, under the induction of maltose, P glvc The promoter expresses fluorescent protein, so the fluorescence intensity difference of the recombinant strains is used to screen the highly active maltogenic amylase mutant AmyM. Q440N and AmyM S442N / Q661L The mutant has been significantly improved in enzyme activity, catalytic efficiency and thermal stability compared with the wild type, and can be more widely used in hydrolyzing starch to prepare maltose.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, in particular to a maltogenic amylase mutant with improved enzyme activity and a screening method thereof. Background Art

[0002] Maltogenic amylase (EC 3.2.1.133), also known as maltogenic amylase or maltose α-amylase, belongs to the GH13 family of glycoside hydrolases. It can effectively hydrolyze macromolecular carbohydrates such as amylose, maltotriose, and cyclodextrin. The main product is maltose and the by-product is glucose. This product characteristic makes maltogenic amylase an indispensable catalyst in the starch saccharification industry. It is of great significance to improve saccharification efficiency and optimize sugar solution composition. It is widely used in starch saccharification industry, flour industry and food baking.

[0003] In recent years, the research on maltogenic amylase has gradually deepened, covering many aspects from extensive screening in natural environments, rational design based on the relationship between enzyme structure and function, to directed evolution using modern biotechnology. These research efforts have not only improved the performance of maltogenic amylase, such as improving the thermal stability, pH tolerance range and substrate specificity of the enzyme, but also preliminarily revealed some of the mysteries of its catalytic mechanism. However, current research still faces many challenges, such as the low efficiency of traditional screening methods and limited effective action sites in rational design. These have to some extent limited the efficient screening and directed modification of maltogenic amylase, thereby affecting the cost-effectiveness of its industrial application and the further improvement of enzyme activity. It is particularly worth mentioning that the thermal stability of maltogenic amylase plays a vital role in industrial production. In high-temperature processes such as starch saccharification and food baking, the thermal stability of the enzyme directly determines its catalytic efficiency and service life. A maltogenic amylase with high thermal stability can still maintain high catalytic activity at higher operating temperatures, which not only improves production efficiency, but also reduces the cost of frequent addition of new enzymes due to enzyme inactivation. In addition, high thermal stability also helps to simplify the production process, reduce cooling steps, and further reduce energy consumption and production costs.

[0004] Therefore, accelerating the efficient screening and molecular improvement of maltogenic amylase-producing strains, especially the targeted optimization of the thermal stability of the enzyme, has become a hot topic and difficulty in current research. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a maltogenic amylase mutant with improved enzyme activity and a screening method thereof. The present invention uses the maltogenic amylase gene as a template to perform an error-prone PCR reaction to obtain a maltogenic amylase mutant library; P is used in a recombinant Bacillus subtilis to glvcand P amyE promoters to express fluorescent protein and maltogenic amylase mutants, respectively, and to P glvc The maltogenic amylase mutant reacts with soluble starch to produce maltose. Under the induction of maltose, P glvc The promoter expresses fluorescent protein. The fluorescence intensity in the fermentation supernatant in the reaction system is detected to screen for highly active maltogenic amylase mutants.

[0006] The first object of the present invention is to provide a high-throughput screening method for maltogenic amylase, comprising the following steps:

[0007] Step S1, using a maltogenic amylase gene as a template, performing an error-prone PCR reaction to obtain a maltogenic amylase mutant library, wherein the maltogenic amylase gene sequence is shown in SEQ ID NO.1;

[0008] Step S2: constructing a first expression vector and a second expression vector, wherein the first expression vector uses P glvc The promoter expresses fluorescent protein, and the second expression vector uses P amyE Promoter to express maltogenic amylase mutant, the P glvc The promoter nucleotide sequence is shown in SEQ ID NO.2;

[0009] Step S3, transferring the first expression vector and the second expression vector into a host Bacillus subtilis to obtain a recombinant Bacillus subtilis;

[0010] Step S4, adding the recombinant Bacillus subtilis to the reaction system, using soluble starch as a substrate to obtain a fermentation supernatant, the maltogenic amylase mutant reacts with the soluble starch to generate maltose, and P glvc The promoter expresses fluorescent protein;

[0011] Step S5, detecting the fluorescence intensity in the fermentation supernatant, wherein the enzyme activity of the maltogenic amylase mutant is positively correlated with the fluorescence intensity, and a highly active maltogenic amylase mutant is screened therefrom.

[0012] Furthermore, in step S1, the error-prone PCR uses an upstream primer having a sequence as shown in SEQ ID NO.3 and a downstream primer having a sequence as shown in SEQ ID NO.4.

[0013] Specifically, the upstream primer sequence is TCTTCTTCTGCTTCTGTTAAGGGTGATG.

[0014] Specifically, the downstream primer sequence is TTAGTGATGGTGATGATGGTGGTTTTGC.

[0015] Further, in step S2, the P glvc The promoter uses the nucleotide sequence shown in SEQ ID NO.2 as the starting sequence and undergoes any of the following mutations:

[0016] (1) Guanine at position 363 mutated to adenine;

[0017] (2) thymine at position 280 mutated to cytosine;

[0018] (3) Thymine at position 382 mutated to cytosine.

[0019] Preferably, the P glvc The promoter uses the sequence shown in SEQ ID NO.2 as the starting sequence, and the thymine at position 382 is mutated to cytosine.

[0020] Furthermore, in step S2, in the second expression vector, the yvcE signal peptide is expressed upstream of the maltogenic amylase mutant.

[0021] Furthermore, in step S3, the amyE gene is knocked out in the host Bacillus subtilis.

[0022] The second object of the present invention is to provide a maltogenic amylase mutant obtained by the high-throughput screening method, wherein the mutant is subjected to any of the following mutations based on SEQ ID NO.5:

[0023] (1) Glutamine at position 440 was mutated to asparagine;

[0024] (2) Serine at position 442 was mutated to asparagine, and glutamine at position 661 was mutated to leucine.

[0025] The third object of the present invention is to provide a gene encoding the above-mentioned maltogenic amylase mutant.

[0026] The fourth object of the present invention is to provide an expression vector comprising the above gene.

[0027] A fifth object of the present invention is to provide a host cell comprising the above maltogenic amylase mutant or the above expression vector, wherein the host cell is a non-plant cell.

[0028] The sixth object of the present invention is to provide the use of the above mutant, the above gene, the above expression vector or the above host cell in hydrolyzing soluble starch.

[0029] Beneficial effects of the present invention:

[0030] The present invention provides a method for screening a maltogenic amylase mutant with improved enzyme activity, using P glvc and PamyE The promoters express fluorescent protein and maltogenic amylase mutants, respectively. glvc After mutation, the response range and induction intensity to maltose are further improved without affecting the growth of the strain, and can be used to construct a maltose-responsive biosensor. The enzyme activity of the maltogenic amylase mutant can be reflected by detecting the fluorescence intensity in the fermentation supernatant in the reaction system, and the highly active maltogenic amylase mutant AmyM can be screened from it. Q440N and AmyM S442N / Q661L The mutant has been significantly improved in enzyme activity, catalytic efficiency and thermal stability compared with the wild type. The enzyme activity is increased by 26.24% and 24.79% respectively compared with the wild type, and it can maintain a certain stability at 60°C or 80°C, which is conducive to its wider application in hydrolyzing starch to prepare maltose. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein

[0032] Figure 1 This is a graph showing the HPLC detection result after the reaction of the recombinant Bacillus subtilis producing maltogenic amylase with soluble starch in Example 1 of the present invention;

[0033] Figure 2 The promoter P used in Example 1 of the present invention glvc The results of maltose-induced expression of its mutants, where A is the difference in fluorescence intensity of different promoters under different concentrations of maltose induction, and B is the promoter P glvc (T382C) OD under different concentrations of maltose induction 600 difference;

[0034] Figure 3 The recombinant strain in Example 1 of the present invention uses promoter P glvc (T382C) expression difference results in different concentrations of starch and glucose medium, where A is the OD of the bacteria in different concentrations of glucose medium 600 Difference, B is the OD of bacteria in different concentrations of soluble starch medium 600 Difference, C is the difference of fluorescence intensity in medium with different concentrations of glucose, and D is the difference of fluorescence intensity in medium with different concentrations of soluble starch;

[0035] Figure 4 The recombinant strain in Example 1 of the present invention uses promoter P glvc (T382C) Expression difference results in different concentrations of maltose medium;

[0036] Figure 5The different enzyme activities of maltogenic amylase and promoter P in Example 1 of the present invention glvc (T382C) linear relationship diagram of fluorescence intensity of induced expression;

[0037] Figure 6 1 is a graph showing the difference in fluorescence intensity in the fermentation supernatant of 65 recombinant mutant strains in Example 1 of the present invention, wherein the blue one is a recombinant strain expressing wild-type maltogenic amylase;

[0038] Figure 7 The wild type AmyM and mutant AmyM in Example 2 of the present invention are Q440N and AmyM S442N / Q661L Enzyme activity test result diagram;

[0039] Figure 8 The wild type AmyM and mutant AmyM in Example 2 of the present invention are Q440N and AmyM S442N / Q661L Enzyme activity results at 40, 50, 60, 70, 80 and 90°C;

[0040] Fig. 9 The wild type AmyM and mutant AmyM in Example 2 of the present invention are Q440N and AmyM S442N / Q661L The residual enzyme activity changes at 60℃ and 80℃, respectively, where A is 60℃ and B is 80℃. DETAILED DESCRIPTION

[0041] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0042] Promoter P glvc (G363A, T280C, T382C) disclosed in patent CN113061608A is an evolution method of an inducible promoter and its application.

[0043] LB medium: 10 g / L peptone, 5 g / L yeast powder, 10 g / L NaCl, 15 g / L agar was added to the solid medium, ampicillin was added at a final concentration of 100 μg / mL when cloning plasmids in Escherichia coli, and kanamycin (pP43NMK) and 10 μg / mL chloramphenicol (pHT01) were added at a final concentration of 50 μg / mL when culturing recombinant Bacillus subtilis.

[0044] TB fermentation medium: 24 g / L yeast powder, 12 g / L peptone, 5 g / L glycerol, 16.43 g / L K2HPO4·3H2O, 2.32 g / L KH2PO4, added with a final concentration of 50 μg / mL kanamycin, and for screening, additionally added with 10 g / L soluble starch and a final concentration of 10 μg / mL chloramphenicol.

[0045] Maltogenic amylase activity test:

[0046] The activity of maltogenic amylase was determined by the modified 3,5-dinitrosalicylic acid method (DNS). The substrate was 500 μL of 1% (w / v) soluble starch solution (dissolved in pH=5.5, 50 mM citrate buffer) preheated at 60°C for 10 min, 100 μL of diluted enzyme solution was added and mixed for 10 min, 600 μL of DNS was added to terminate the reaction, the color was developed in a boiling water bath for 7 min, 200 μL of the color development liquid was placed in a 96-well plate of an ELISA reader, and the absorbance was measured at 540 nm. Under the above conditions, the amount of enzyme required to catalyze the production of 1 μmoL maltose per minute is one unit of enzyme activity.

[0047] Example 1: Screening of maltogenic amylase strains

[0048] (1) Construction of high-throughput screening method for maltogenic amylase-producing strains:

[0049] The endogenous amylase gene amyE (sequence in WP_003234692.1) was knocked out in Bacillus subtilis, and pP43NMK was used as the expression vector. amyE As the promoter, the yvcE signal peptide was selected to express the maltogenic amylase gene amyM (nucleotide sequence as shown in SEQ ID NO.1, amino acid sequence as shown in SEQ ID NO.5), and the recombinant strain B. subtilis168ΔamyE / pP43NMK-P was constructed. amyE -yvcE-amyM.

[0050] B.subtilis168ΔamyE / pP43NMK-P amyE -yvcE-amyM seed solution was inoculated into a 250mL Erlenmeyer flask containing 50mL LB medium at a 2% (v / v) inoculation rate and placed in a shaking incubator at 37°C and 220rpm. The fermentation supernatant was reacted with 10g / L soluble starch solution for 10min and the reaction was immediately terminated. The product was detected by HPLC. The control was the inactivated enzyme solution reacted with soluble starch under the same conditions. The results are shown in Figure 1 As shown, maltose was detected in the product after reaction with soluble starch.

[0051] The pHT01 vector was used, and the promoter P with an expanded maltose concentration response range was selected based on the cell growth coupling method based on tetracycline screening in the laboratory. glvc (G363A, T280C) and the mutant P with increased induction strength glvc (T382C), respectively connected with green fluorescent protein eGFP, amplified in E. coli JM109, and transferred into Bacillus subtilis 168ΔamyE for expression to obtain the recombinant strain B. subtilis 168ΔamyE / pHT01-P glvc -eGFP.

[0052] Different concentrations of maltose were added to TB medium, and B. subtilis168ΔamyE / pHT01-P glvc After activating the -eGFP seed solution for 10-12 hours, the solution was inoculated with 1% inoculum into 48-well plates containing 600 μL of medium with different maltose concentrations and cultured at 37°C for 10-12 hours. The fermentation solution was transferred to a 96-well plate and the green fluorescence intensity of the bacteria was detected using an ELISA reader (excitation wavelength 488 nm and emission wavelength 520 nm). Figure 2 As shown in A, in TB medium containing 0-8 g / L maltose, the promoter P glvc (T382C) has good gradient induction expression ability to maltose and also has high induction expression intensity, so the promoter P was selected glvc (T382C) was used as the promoter of the biosensor. 600 Test, the results are as follows Figure 2 As shown in B, the addition of different concentrations of maltose had little effect on bacterial growth. 600 Stay steady.

[0053] (2) Validation of high-throughput screening method for maltogenic amylase-producing strains:

[0054] The recombinant strain B. subtilis168ΔamyE / pHT01-P glvc -eGFP was cultured in TB medium containing different concentrations of starch and glucose for 12 h, and the fluorescence and OD were detected 600 , where the promoter P glvc P glvc (T382C). Figure 3 As shown in A and B, the addition of glucose or soluble starch had no significant effect on cell growth and did not cause OD 600 Such as Figure 3 As shown in C and D in Figure 1, in the absence of maltose in the reaction system, the addition of glucose or soluble starch will not cause P glvc(T382C) expresses fluorescent protein.

[0055] During the screening process, maltogenic amylase reacts with soluble starch to produce maltose, which then induces P glvc (T382C) expresses fluorescent protein, so 10 g / L substrate soluble starch was added to TB medium containing different concentrations of maltose to verify the effect of soluble starch on the biosensor. Figure 4 As shown, in the range of 0-8 g / L maltose concentration, P glvc (T382C) still has good gradient response ability to maltose. The above fluorescence results are minus the background interference. 600 Testing showed that the addition of soluble starch had little effect on bacterial growth.

[0056] In addition, pure maltose amylase with an activity range of 0.05-1 U / mL was added to the above culture medium and cultured at 37°C for 20 h in a 48-well plate. The enzyme reacted with the substrate soluble starch to produce different concentrations of maltose-induced promoter P glvc (T382C) expression, and the green fluorescence intensity of the fermentation liquid was detected by an ELISA instrument after 20 hours. Figure 5 As shown, as the enzyme activity increases, the fluorescence intensity increases basically linearly, proving that the level of enzyme activity can be distinguished by the level of fluorescence expression intensity.

[0057] (3) Application of high-throughput screening method for maltogenic amylase-producing strains:

[0058] The mutant library was constructed by error-prone PCR, with primer sequences as shown in SEQ ID NO.3-4, and transferred into the existing pHT01-P glvc In the competent cell of B. subtilis168ΔamyE containing (T382C)-eGFP screening plasmid, the AmyM expression plasmid (pP43NMK-P amyE -yvcE-amyM) produces maltogenic amylase which is secreted into the extracellular space and reacts with the substrate soluble starch to produce maltose. Different concentrations of maltose induce P glvc (T382C) produces green fluorescence of different intensities, and the fluorescence intensity is used to find AmyM mutants with high enzyme activity. In the first round of screening, 65 strains showing strong fluorescence were identified from 3,000 strains. The same method was used to screen these 65 strains in the second round of screening. The results are as follows Figure 6 As shown, two strains with significantly increased fluorescence were found, and mutant AmyM was obtained by sequencing. Q440N and AmyM S442N / Q661L .

[0059] Example 2: Determination of enzymatic properties of mutants

[0060] With B.subtilis168ΔamyE / pP43NMK-P amyE -yvcE-amyM was used as a template to obtain mutant AmyM Q440N and AmyM S442N / Q661L Plasmid pP43NMK-P amyE -yvcE-amyM Q440N and pP43NMK-P amyE -yvcE-amyM S442N / Q661L , the primer sequences are shown in the following table.

[0061] Table 1 Primer sequences

[0062] Primer Sequence(5'-3') Q440N-F CGTAATACTAACTCTAGCTATTCTATTTCTGGATTACAAA Q440N-R GAGTTAGTATTACGGTTAATTGCTACTAATACTACATCATTG S442N-F ATACTCAATCTAACTATTCTATTTCTGGATTACAAACTGC S442N-R AGTTAGATTGAGTATTACGGTTAATTGCTACTAATACTA Q661L-F ACAATCCTATGGGAAAACGGTTCTAACC Q661L-R TTCCCATAGGATTGTACCATCAGCAC

[0063] The PCR system was: 2×Phanta Max Master Mix (dye plus), 1 μL each of upstream primer and downstream primer, 1 μL (0.1 μg) of DNA template and 7 μL of deionized water.

[0064] The PCR amplification procedure was as follows: (1) pre-denaturation at 95°C for 3 min; (2) denaturation at 95°C for 15 s; (3) annealing at 55°C for 15 s; (4) extension at 72°C for 4 min; steps (2) to (4) were repeated for 25 cycles; (5) extension was continued at 72°C for 10 min, and then cooled to 4°C.

[0065] The resulting plasmid pP43NMK-P amyE -yvcE-amyM Q440N and pP43NMK-P amyE -yvcE-amyM S442N / Q661L After amplification in E.coli JM109, the cells were transferred to the competent state of B.subtilis168ΔamyE and inoculated into LB medium containing kanamycin. The cells were cultured at 37°C overnight with shaking. The cells were inoculated into a 250mL Erlenmeyer flask containing 50mL LB medium at a 2% (v / v) inoculation volume and cultured in a shaking incubator at 37°C and 220rpm. The activity of maltogenic amylase in the fermentation supernatant was detected by DNS method. The results were as follows: Figure 7 As shown, AmyM Q440N and AmyM S442N / Q661L The enzyme activities were increased by 26.24% and 24.79%, respectively.

[0066] To determine the kinetic parameters, the purified AmyM wild type and mutants were diluted to about 0.11 mg / mL and reacted with different concentrations (0.1, 0.2, 0.4, 0.6, 0.8, 1, 2, 4, 6, 8 and 10 g / L) of soluble starch. The protein concentration was determined using the BCA method. V was calculated by fitting according to the Michaelis-Menten equation. max , K m , K cat and K cat / K m The results are shown in Table 2. Q440N and AmyM S442N / Q661L The specific activities of AmyM mutants were increased by 35.56% and 24.51%, respectively. Q440N and AmyM S442N / Q661L K cat The catalytic efficiency (K cat / K m ) were 1.99 and 1.62 times that of the wild type, respectively.

[0067] Table 2 Kinetic parameters of AmyM wild type and mutants

[0068] Mutation Specific enzyme activity (U / mg) <![CDATA[K m (g / L)]]> <![CDATA[K cat (s -1 )]]> <![CDATA[K cat / K m [L / (s·g)]]]> WT 2262.23 1.57 3502.71 2235.41 Q440N 3066.79 0.99 4403.81 4457.07 S442N / Q661L 2816.65 1.14 4125.10 3630.10

[0069] To determine the optimal temperature, the enzyme activities of AmyM wild type and mutants were measured at 40, 50, 60, 70, 80 and 90 °C. Figure 8 ), and the thermal stability of AmyM wild type and mutants at 60°C or 80°C. Purified AmyM and mutants were incubated at 60°C or 80°C, and samples were taken at different times. After cooling on ice, the enzyme activity of each sample was measured, and the results are shown in Fig. 9 As shown, A is 60°C and B is 80°C. The first-order inactivation model was used to fit and analyze the t of each mutant. 1 / 2 The Tm values ​​were measured using circular dichroism spectroscopy, with the system temperature gradually increasing from 25°C to 99°C.

[0070] Mutant AmyM Q440N and AmyM S442N / Q661L The temperature stability at 80°C was better than that of wild type WT. Q440N and AmyM S442N / Q661L At 80℃, t 1 / 2 The increases were 19.91% and 84.90% respectively (see Table 3). Q440N and mutants Q440N and AmyM S442N / Q661LThe optimal temperature for AmyM is 60°C. At 60°C, the half-life of AmyM is t 1 / 2 is 106.64h, while AmyM Q440N The half-lives of AmyM and S442N / Q661L were 169.06 h and 177.73 h, respectively. Q440N and AmyM S442N / Q661L The Tm of the mutants increased by 0.77°C and 3.03°C, respectively. These findings highlight the potential of the mutants for industrial applications.

[0071] Table 3 Stability of wild-type and mutant AmyM

[0072] Mutation <![CDATA[t 1 / 2 (℃)]]> <![CDATA[t 1 / 2 (80℃)]]> Tm(℃) WT 106.64 20.94 79.03 Q440N 169.06 25.11 79.80 S442N / Q661L 177.73 38.72 82.06

[0073] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A maltogenic amylase mutant, characterized in that The mutant is subjected to any of the following mutations based on SEQ ID NO.5: (1) Glutamine at position 440 mutated to asparagine; (2) Serine at position 442 mutated to asparagine, and glutamine at position 661 mutated to leucine.

2. A gene encoding the maltogenic amylase mutant according to claim 1.

3. An expression vector comprising the gene according to claim 2.

4. A host cell comprising the maltogenic amylase mutant according to claim 1 or the expression vector according to claim 3, wherein the host cell is a non-plant cell.

5. Use of the mutant according to claim 1, the gene according to claim 2, the expression vector according to claim 3 or the host cell according to claim 4 in hydrolyzing soluble starch.

Images